ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags13c12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF235097.2| Homo sapiens chromosome X multiple clones map p11.23, complete sequence Length = 140335 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 527 ccagctgcggcagctgctgcagctggagcagcc 559 |||||||||||||||||||| ||||| |||||| Sbjct: 77755 ccagctgcggcagctgctgctgctggggcagcc 77723
>ref|NM_033215.3| Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 3F (PPP1R3F), mRNA Length = 2941 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 527 ccagctgcggcagctgctgcagctggagcagcc 559 |||||||||||||||||||| ||||| |||||| Sbjct: 941 ccagctgcggcagctgctgctgctggggcagcc 909
>dbj|AK056909.1| Homo sapiens cDNA FLJ32347 fis, clone PROST2006988, moderately similar to Mus musculus DXImx48e protein (DXImx48e) mRNA Length = 2680 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 527 ccagctgcggcagctgctgcagctggagcagcc 559 |||||||||||||||||||| ||||| |||||| Sbjct: 777 ccagctgcggcagctgctgctgctggggcagcc 745
>gb|AY810151.1| Schistosoma japonicum SJCHGC07130 protein mRNA, partial cds Length = 549 Score = 48.1 bits (24), Expect = 0.034 Identities = 24/24 (100%) Strand = Plus / Minus Query: 528 cagctgcggcagctgctgcagctg 551 |||||||||||||||||||||||| Sbjct: 358 cagctgcggcagctgctgcagctg 335
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 528 cagctgcggcagctgctgcagctggag 554 |||| |||||||||||||||||||||| Sbjct: 6682974 cagcggcggcagctgctgcagctggag 6682948
>dbj|AP001800.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0443E05 Length = 176935 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 528 cagctgcggcagctgctgcagctggag 554 |||| |||||||||||||||||||||| Sbjct: 35126 cagcggcggcagctgctgcagctggag 35100
>ref|XM_617555.2| PREDICTED: Bos taurus similar to nuclear receptor co-repressor/HDAC3 complex subunit (LOC537393), partial mRNA Length = 1285 Score = 44.1 bits (22), Expect = 0.53 Identities = 28/30 (93%) Strand = Plus / Plus Query: 522 aagcaccagctgcggcagctgctgcagctg 551 ||||| ||||||| |||||||||||||||| Sbjct: 483 aagcagcagctgctgcagctgctgcagctg 512
>gb|BC064764.1| Mus musculus forkhead box P1, mRNA (cDNA clone MGC:76591 IMAGE:30430449), complete cds Length = 2348 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctgg 567 ||||| |||||||||||| |||||| ||| |||||||| Sbjct: 809 gctgctgcagctgctgcatctggagaagctgctgctgg 772
>ref|XM_755880.1| Ustilago maydis 521 hypothetical protein (UM04826.1) partial mRNA Length = 2331 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 533 gcggcagctgctgcagctggagcagc 558 ||||||||||||||||||| |||||| Sbjct: 377 gcggcagctgctgcagctgcagcagc 352
>ref|XM_860376.1| PREDICTED: Canis familiaris similar to RNA-binding protein 4 (RNA-binding motif protein 4) (Lark homolog) (Hlark) (RNA-binding motif protein 4a), transcript variant 3 (LOC610648), mRNA Length = 1476 Score = 44.1 bits (22), Expect = 0.53 Identities = 28/30 (93%) Strand = Plus / Plus Query: 537 cagctgctgcagctggagcagccgctgctg 566 |||||||||| |||| |||||||||||||| Sbjct: 943 cagctgctgctgctgcagcagccgctgctg 972
>ref|XM_860358.1| PREDICTED: Canis familiaris similar to RNA-binding protein 4 (RNA-binding motif protein 4) (Lark homolog) (Hlark) (RNA-binding motif protein 4a), transcript variant 2 (LOC610648), mRNA Length = 2027 Score = 44.1 bits (22), Expect = 0.53 Identities = 28/30 (93%) Strand = Plus / Plus Query: 537 cagctgctgcagctggagcagccgctgctg 566 |||||||||| |||| |||||||||||||| Sbjct: 1057 cagctgctgctgctgcagcagccgctgctg 1086
>ref|XM_847210.1| PREDICTED: Canis familiaris similar to RNA-binding protein 4 (RNA-binding motif protein 4) (Lark homolog) (Hlark) (RNA-binding motif protein 4a), transcript variant 1 (LOC610648), mRNA Length = 1913 Score = 44.1 bits (22), Expect = 0.53 Identities = 28/30 (93%) Strand = Plus / Plus Query: 537 cagctgctgcagctggagcagccgctgctg 566 |||||||||| |||| |||||||||||||| Sbjct: 943 cagctgctgctgctgcagcagccgctgctg 972
>ref|XM_746375.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g13630) partial mRNA Length = 3564 Score = 44.1 bits (22), Expect = 0.53 Identities = 28/30 (93%) Strand = Plus / Plus Query: 520 agaagcaccagctgcggcagctgctgcagc 549 ||||||| ||||||| |||||||||||||| Sbjct: 729 agaagcagcagctgcagcagctgctgcagc 758
>gb|AC125137.3| Mus musculus BAC clone RP24-324K9 from chromosome 6, complete sequence Length = 170336 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Plus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctgg 567 ||||| |||||||||||| |||||| ||| |||||||| Sbjct: 146548 gctgctgcagctgctgcatctggagaagctgctgctgg 146585
>ref|NM_053202.1| Mus musculus forkhead box P1 (Foxp1), mRNA Length = 2118 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctgg 567 ||||| |||||||||||| |||||| ||| |||||||| Sbjct: 664 gctgctgcagctgctgcatctggagaagctgctgctgg 627
>dbj|AK139831.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library, clone:B020023N10 product:forkhead box P1, full insert sequence Length = 2831 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctgg 567 ||||| |||||||||||| |||||| ||| |||||||| Sbjct: 316 gctgctgcagctgctgcatctggagaagctgctgctgg 279
>dbj|AK077062.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932443N09 product:forkhead box P1, full insert sequence Length = 2405 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctgg 567 ||||| |||||||||||| |||||| ||| |||||||| Sbjct: 325 gctgctgcagctgctgcatctggagaagctgctgctgg 288
>gb|AF339104.1|AF339104 Mus musculus forkhead-related transcription factor 1B (Foxp1b) mRNA, complete cds Length = 1926 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctgg 567 ||||| |||||||||||| |||||| ||| |||||||| Sbjct: 664 gctgctgcagctgctgcatctggagaagctgctgctgg 627
>gb|AF339103.1|AF339103 Mus musculus forkhead-related transcription factor 1A (Foxp1a) mRNA, complete cds Length = 2118 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctgg 567 ||||| |||||||||||| |||||| ||| |||||||| Sbjct: 664 gctgctgcagctgctgcatctggagaagctgctgctgg 627
>dbj|AK033368.1| Mus musculus 16 days embryo lung cDNA, RIKEN full-length enriched library, clone:8430407G20 product:forkhead box P1, full insert sequence Length = 2415 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctgg 567 ||||| |||||||||||| |||||| ||| |||||||| Sbjct: 140 gctgctgcagctgctgcatctggagaagctgctgctgg 103
>gb|AC155839.4| Mus musculus 6 BAC RP24-96J4 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 173368 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Plus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctgg 567 ||||| |||||||||||| |||||| ||| |||||||| Sbjct: 35150 gctgctgcagctgctgcatctggagaagctgctgctgg 35187
>dbj|AB221602.1| Mus musculus cDNA pooled tissues:(tissue_type=brain,dev_stage=8-12 days neonate,strain=BALB/c),(tissue_type=testis, dev_stage=adult, strain=C57BL/6J), clone:V01X014A15 Length = 2122 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctgg 567 ||||| |||||||||||| |||||| ||| |||||||| Sbjct: 668 gctgctgcagctgctgcatctggagaagctgctgctgg 631
>dbj|AB221601.1| Mus musculus cDNA pooled tissues:(tissue_type=brain,dev_stage=8-12 days neonate,strain=BALB/c),(tissue_type=testis, dev_stage=adult, strain=C57BL/6J), clone:V01X014A13 Length = 2120 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctgg 567 ||||| |||||||||||| |||||| ||| |||||||| Sbjct: 670 gctgctgcagctgctgcatctggagaagctgctgctgg 633
>ref|NM_129548.2| Arabidopsis thaliana zinc ion binding AT2G39900 mRNA, complete cds Length = 948 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 536 gcagctgctgcagctggagcagccg 560 |||||||||||||||| |||||||| Sbjct: 740 gcagctgctgcagctgtagcagccg 764
>gb|AC102124.16| Mus musculus chromosome 18, clone RP23-188D1, complete sequence Length = 222450 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 517 aggagaagcaccagctgcggcagctgctg 545 |||||||| || ||||||||||||||||| Sbjct: 60615 aggagaaggacaagctgcggcagctgctg 60587
>ref|XM_322125.1| Neurospora crassa OR74A hypothetical protein (NCU00040.1) partial mRNA Length = 3180 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Minus Query: 483 caccctcacgtttccacttggggacatacttgc 515 ||||||||||| |||||||||| || ||||||| Sbjct: 3175 caccctcacgtctccacttgggaacgtacttgc 3143
>gb|AC147021.3| Pan troglodytes BAC clone RP43-85B14 from 7, complete sequence Length = 159960 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 587 acagcagcagcagctggtgca 607 ||||||||||||||||||||| Sbjct: 38397 acagcagcagcagctggtgca 38377
>ref|XM_951058.1| Neurospora crassa OR74A hypothetical protein (NCU00040.1) partial mRNA Length = 3180 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Minus Query: 483 caccctcacgtttccacttggggacatacttgc 515 ||||||||||| |||||||||| || ||||||| Sbjct: 3175 caccctcacgtctccacttgggaacgtacttgc 3143
>ref|NM_145614.2| Mus musculus dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex) (Dlat), mRNA Length = 4034 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 535 ggcagctgctgcagctggagcagcc 559 ||||||||||||||| ||||||||| Sbjct: 1512 ggcagctgctgcagcaggagcagcc 1488
>gb|AC148920.1| Mus musculus BAC clone RP23-273O10 from chromosome 19, complete sequence Length = 224526 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 207 aagaatttgcagaggtcctag 227 ||||||||||||||||||||| Sbjct: 184899 aagaatttgcagaggtcctag 184919
>gb|BC059275.1| Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 3F, mRNA (cDNA clone IMAGE:3602251), partial cds Length = 3403 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Minus Query: 527 ccagctgcggcagctgctgcagctggagcagcc 559 |||||||| ||||||||||| ||||| |||||| Sbjct: 889 ccagctgctgcagctgctgctgctggggcagcc 857
>ref|XM_548997.2| PREDICTED: Canis familiaris similar to protein phosphatase 1, regulatory (inhibitor) subunit 3F (LOC491877), mRNA Length = 2911 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Minus Query: 527 ccagctgcggcagctgctgcagctggagcagcc 559 |||||||| ||||||||||| ||||| |||||| Sbjct: 938 ccagctgctgcagctgctgctgctggggcagcc 906
>ref|XM_619554.3| PREDICTED: Mus musculus lipoxygenase homology domains 1 (Loxhd1), mRNA Length = 3814 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 517 aggagaagcaccagctgcggcagctgctg 545 |||||||| || ||||||||||||||||| Sbjct: 2588 aggagaaggacaagctgcggcagctgctg 2616
>ref|XM_973146.1| PREDICTED: Mus musculus lipoxygenase homology domains 1 (Loxhd1), mRNA Length = 7225 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 517 aggagaagcaccagctgcggcagctgctg 545 |||||||| || ||||||||||||||||| Sbjct: 2993 aggagaaggacaagctgcggcagctgctg 3021
>ref|XM_916184.2| PREDICTED: Mus musculus lipoxygenase homology domains 1 (Loxhd1), mRNA Length = 7537 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 517 aggagaagcaccagctgcggcagctgctg 545 |||||||| || ||||||||||||||||| Sbjct: 2993 aggagaaggacaagctgcggcagctgctg 3021
>gb|AC006317.3| Homo sapiens PAC clone RP4-715F13 from 7, complete sequence Length = 145878 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 587 acagcagcagcagctggtgca 607 ||||||||||||||||||||| Sbjct: 141235 acagcagcagcagctggtgca 141255
>gb|AC118227.12| Mus musculus chromosome 15, clone RP23-379H6, complete sequence Length = 200663 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 531 ctgcggcagctgctgcagctg 551 ||||||||||||||||||||| Sbjct: 134321 ctgcggcagctgctgcagctg 134301
>emb|CR626875.10| Zebrafish DNA sequence from clone DKEY-31J4 in linkage group 15, complete sequence Length = 212742 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 75 cttcaattgtgtatgaagctcccag 99 |||||||||||||| |||||||||| Sbjct: 176829 cttcaattgtgtataaagctcccag 176853
>emb|BX901973.12| Zebrafish DNA sequence from clone DKEY-26L17 in linkage group 3, complete sequence Length = 226081 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 380 tcacgcagaggaggagcttcc 400 ||||||||||||||||||||| Sbjct: 213562 tcacgcagaggaggagcttcc 213582
>emb|Z79754.1|CEF25H2 Caenorhabditis elegans Cosmid F25H2, complete sequence Length = 42366 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 518 ggagaagcaccagctgcggcagctgctgcagctggagcagc 558 |||| |||| |||||| |||||| || |||||||||||||| Sbjct: 34989 ggagcagcagcagctggggcagcggcggcagctggagcagc 34949
>gb|BC069862.1| Mus musculus dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex), mRNA (cDNA clone MGC:78049 IMAGE:5388446), complete cds Length = 2084 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 535 ggcagctgctgcagctggagcagcc 559 ||||||||||||||| ||||||||| Sbjct: 1254 ggcagctgctgcagcaggagcagcc 1230
>gb|AC153131.5| Mus musculus BAC clone RP24-356O12 from chromosome 19, complete sequence Length = 184864 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 207 aagaatttgcagaggtcctag 227 ||||||||||||||||||||| Sbjct: 78398 aagaatttgcagaggtcctag 78418
>gb|AY122901.1| Arabidopsis thaliana At2g39900/T28M21.6 mRNA, complete cds Length = 603 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 536 gcagctgctgcagctggagcagccg 560 |||||||||||||||| |||||||| Sbjct: 565 gcagctgctgcagctgtagcagccg 589
>gb|AE012146.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 54 of 460 of the complete genome Length = 12022 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 523 agcaccagctgcggcagctgc 543 ||||||||||||||||||||| Sbjct: 5932 agcaccagctgcggcagctgc 5952
>gb|AY094448.1| Arabidopsis thaliana At2g39900/T28M21.6 mRNA, complete cds Length = 948 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 536 gcagctgctgcagctggagcagccg 560 |||||||||||||||| |||||||| Sbjct: 740 gcagctgctgcagctgtagcagccg 764
>gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 map CIC10A06, complete sequence Length = 108847 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 536 gcagctgctgcagctggagcagccg 560 |||||||||||||||| |||||||| Sbjct: 28890 gcagctgctgcagctgtagcagccg 28914
>gb|AY044265.1| Mus musculus dihydrolipoamide S-acetyltransferase precursor, mRNA, partial cds Length = 1700 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 535 ggcagctgctgcagctggagcagcc 559 ||||||||||||||| ||||||||| Sbjct: 948 ggcagctgctgcagcaggagcagcc 924
>dbj|AK166090.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730037G16 product:dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex), full insert sequence Length = 2530 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 535 ggcagctgctgcagctggagcagcc 559 ||||||||||||||| ||||||||| Sbjct: 1281 ggcagctgctgcagcaggagcagcc 1257
>dbj|AK032124.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6332404G05 product:DIHYDROLIPOAMIDE ACETYLTRANSFERASE PRECURSOR (EC 2.3.1.12) homolog [Sus scrofa], full insert sequence Length = 4034 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 535 ggcagctgctgcagctggagcagcc 559 ||||||||||||||| ||||||||| Sbjct: 1512 ggcagctgctgcagcaggagcagcc 1488
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 523 agcaccagctgcggcagctgc 543 ||||||||||||||||||||| Sbjct: 593788 agcaccagctgcggcagctgc 593808
>ref|NM_060365.3| Caenorhabditis elegans F25H2.10 (deoxyribonuclease) mRNA, complete cds Length = 1030 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 518 ggagaagcaccagctgcggcagctgctgcagctggagcagc 558 |||| |||| |||||| |||||| || |||||||||||||| Sbjct: 917 ggagcagcagcagctggggcagcggcggcagctggagcagc 877
>dbj|AK030047.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932417K07 product:HYPOTHETICAL 76.6 KDA PROTEIN homolog [Macaca fascicularis], full insert sequence Length = 3814 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 517 aggagaagcaccagctgcggcagctgctg 545 |||||||| || ||||||||||||||||| Sbjct: 2588 aggagaaggacaagctgcggcagctgctg 2616
>dbj|AK043771.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830030N02 product:DIHYDROLIPOAMIDE S-ACETYLTRANSFERASE (FRAGMENT) homolog [Mus musculus], full insert sequence Length = 3555 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 535 ggcagctgctgcagctggagcagcc 559 ||||||||||||||| ||||||||| Sbjct: 1200 ggcagctgctgcagcaggagcagcc 1176
>gb|AF229644.1|AF229644 Mus musculus DXImx48e protein (DXImx48e) mRNA, complete cds Length = 2968 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Minus Query: 527 ccagctgcggcagctgctgcagctggagcagcc 559 |||||||| ||||||||||| ||||| |||||| Sbjct: 794 ccagctgctgcagctgctgctgctggggcagcc 762
>emb|BX842049.1|CNS09Y98 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL12ZB11 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 904 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 536 gcagctgctgcagctggagcagccg 560 |||||||||||||||| |||||||| Sbjct: 695 gcagctgctgcagctgtagcagccg 719
>gb|AF277994.1|AF277994 Mus musculus scurfin (Foxp3) gene, complete cds Length = 30858 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 527 ccagctgcggcagctgctgcagctggagcagcc 559 |||||||| ||||||||||| ||||| |||||| Sbjct: 6162 ccagctgctgcagctgctgctgctggggcagcc 6194
>ref|NM_204237.1| Gallus gallus transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (TLE4), mRNA Length = 2781 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 536 gcagctgctgcagctggagcagccgctgc 564 |||||||||||||||| ||||||||||| Sbjct: 1241 gcagctgctgcagctgctgcagccgctgc 1213
>ref|NM_138605.1| Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 3F (Ppp1r3f), mRNA Length = 2968 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Minus Query: 527 ccagctgcggcagctgctgcagctggagcagcc 559 |||||||| ||||||||||| ||||| |||||| Sbjct: 794 ccagctgctgcagctgctgctgctggggcagcc 762
>ref|XM_343775.2| PREDICTED: Rattus norvegicus similar to DXImx48e protein (LOC363453), mRNA Length = 1731 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Minus Query: 527 ccagctgcggcagctgctgcagctggagcagcc 559 |||||||| ||||||||||| ||||| |||||| Sbjct: 403 ccagctgctgcagctgctgctgctggggcagcc 371
>gb|U82806.1|XMU82806 Xiphophorus maculatus melanoma receptor tyrosine kinase gene, partial cds Length = 90 Score = 42.1 bits (21), Expect = 2.1 Identities = 33/37 (89%) Strand = Plus / Plus Query: 530 gctgcggcagctgctgcagctggagcagccgctgctg 566 ||||| |||||||||||||||| ||| || ||||||| Sbjct: 27 gctgctgcagctgctgcagctgcagctgctgctgctg 63
>gb|AC155259.1| Mus musculus BAC clone RP24-70C15 from 9, complete sequence Length = 222729 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 470 tgactgctactgtcaccctca 490 ||||||||||||||||||||| Sbjct: 119029 tgactgctactgtcaccctca 119009
>gb|BC026680.1| Mus musculus dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex), mRNA (cDNA clone MGC:37696 IMAGE:5059786), complete cds Length = 2101 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 535 ggcagctgctgcagctggagcagcc 559 ||||||||||||||| ||||||||| Sbjct: 1259 ggcagctgctgcagcaggagcagcc 1235
>dbj|AB080584.1| Gallus gallus Grg4 mRNA for groucho-related gene 4, complete cds Length = 2781 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 536 gcagctgctgcagctggagcagccgctgc 564 |||||||||||||||| ||||||||||| Sbjct: 1241 gcagctgctgcagctgctgcagccgctgc 1213
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 534 cggcagctgctgcagctggag 554 ||||||||||||||||||||| Sbjct: 1000074 cggcagctgctgcagctggag 1000054
>emb|AL731793.18| Mouse DNA sequence from clone RP23-135F22 on chromosome X, complete sequence Length = 149465 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 527 ccagctgcggcagctgctgcagctggagcagcc 559 |||||||| ||||||||||| ||||| |||||| Sbjct: 137548 ccagctgctgcagctgctgctgctggggcagcc 137580
>gb|BC060320.1| Homo sapiens transducin (beta)-like 1X-linked receptor 1, mRNA (cDNA clone IMAGE:4358996), partial cds Length = 566 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 528 cagctgcggcagctgctgcagctg 551 |||||||||||||||| ||||||| Sbjct: 529 cagctgcggcagctgcagcagctg 506
>gb|AY304002.1| Ovis aries prion protein gene, partial cds Length = 99 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 72 agctgctgcagctggagcag 91
>gb|AY320375.1| Bos taurus prion protein gene, partial cds Length = 396 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 303 agctgctgcagctggagcag 322
>gb|AY320373.1| Bos taurus prion protein gene, partial cds Length = 390 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 225 agctgctgcagctggagcag 244
>gb|AY320372.1| Bos taurus prion protein gene, partial cds Length = 312 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 288 agctgctgcagctggagcag 307
>gb|AY320370.1| Bos taurus prion protein gene, partial cds Length = 390 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 285 agctgctgcagctggagcag 304
>gb|AY320369.1| Bos taurus prion protein gene, partial cds Length = 390 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 285 agctgctgcagctggagcag 304
>gb|AY320368.1| Bos taurus prion protein gene, partial cds Length = 360 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 285 agctgctgcagctggagcag 304
>gb|AY320367.1| Bos taurus prion protein gene, partial cds Length = 399 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 288 agctgctgcagctggagcag 307
>gb|AY320366.1| Bos taurus prion protein gene, partial cds Length = 399 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 288 agctgctgcagctggagcag 307
>gb|AY769958.1| Bison bison prion protein PrP (Prnp) gene, intron 2 and complete cds Length = 1422 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 1000 agctgctgcagctggagcag 1019
>gb|AY769957.1| Ovis canadensis canadensis prion protein PrP (Prnp) gene, intron 2 and complete cds Length = 1405 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 983 agctgctgcagctggagcag 1002
>gb|AY769955.1| Capreolus capreolus prion protein PrP (Prnp) gene, intron 2 and complete cds Length = 1498 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 987 agctgctgcagctggagcag 1006
>gb|DQ205538.1| Bos taurus prion protein (PRNP) and prion-like protein doppel (PRND) genes, complete cds; PRNT (PRNT) gene, exons 1 and 2; and putative protein gene, complete cds Length = 104027 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 65951 agctgctgcagctggagcag 65970
>ref|NM_128172.2| Arabidopsis thaliana FTSH4; ATP-dependent peptidase/ ATPase/ metallopeptidase AT2G26140 (FTSH4) mRNA, complete cds Length = 2713 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 528 cagctgcggcagctgctgcagctg 551 ||||||||||||||||||| |||| Sbjct: 2284 cagctgcggcagctgctgcggctg 2261
>gb|AY769894.1| Bubalus bubalis prion protein (Prp) mRNA, partial cds Length = 630 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 279 agctgctgcagctggagcag 298
>gb|AY423026.1| Danio rerio dystrobrevin, beta (DTNB) mRNA, complete cds Length = 3069 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 163 caggaagcttcagcgcctcc 182 |||||||||||||||||||| Sbjct: 481 caggaagcttcagcgcctcc 462
>gb|AC168217.2| Mus musculus BAC clone RP24-498P8 from chromosome 9, complete sequence Length = 171426 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 536 gcagctgctgcagctggagc 555 |||||||||||||||||||| Sbjct: 163766 gcagctgctgcagctggagc 163785
>ref|XM_520248.1| PREDICTED: Pan troglodytes similar to nuclear receptor subfamily 5, group A, member 1; fushi tarazu factor (Drosophila) homolog 1; steroidogenic factor-1 (LOC464724), mRNA Length = 1401 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 536 gcagctgctgcagctggagc 555 |||||||||||||||||||| Sbjct: 747 gcagctgctgcagctggagc 766
>ref|XM_526387.1| PREDICTED: Pan troglodytes similar to nuclear receptor co-repressor/HDAC3 complex subunit; TBL1-related protein 1 (LOC471003), mRNA Length = 1635 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 528 cagctgcggcagctgctgcagctg 551 |||||||||||||||| ||||||| Sbjct: 442 cagctgcggcagctgcagcagctg 419
>ref|NM_024665.3| Homo sapiens transducin (beta)-like 1X-linked receptor 1 (TBL1XR1), mRNA Length = 5911 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 528 cagctgcggcagctgctgcagctg 551 |||||||||||||||| ||||||| Sbjct: 602 cagctgcggcagctgcagcagctg 579
>gb|AY768534.1| Bubalus bubalis isolate JW42_2 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY768533.1| Bubalus bubalis isolate JW42_1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720706.1| Antilope cervicapra isolate BlackbuckhomoB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720705.1| Antilope cervicapra isolate BlackbuckhomoA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720704.1| Tragelaphus imberbis isolate Z14HomoB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720703.1| Tragelaphus imberbis isolate Z14HomoA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720698.1| Bos gaurus isolate GaurhomoB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720697.1| Bos gaurus isolate GaurhomoA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720696.1| Bison bison isolate CR227All1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720695.1| Bison bison isolate CR227All2 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720694.1| Bos javanicus isolate TWBt2 prion protein (PRNP) gene, exon 3 and complete cds Length = 771 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 351 agctgctgcagctggagcag 370
>gb|AY720693.1| Bos javanicus isolate TWBt6 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720692.1| Bos javanicus isolate Bt478-2 prion protein (PRNP) gene, exon 3 and complete cds Length = 771 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 351 agctgctgcagctggagcag 370
>gb|AY720691.1| Bos javanicus isolate Bt478-1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720690.1| Bubalus bubalis isolate JW41_2 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720689.1| Bubalus bubalis isolate JW41_1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720688.1| Bubalus depressicornis isolate Ano2 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720687.1| Bubalus depressicornis isolate Ano1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720686.1| Syncerus caffer caffer isolate Z17-7 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720685.1| Syncerus caffer caffer isolate Z17-1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720684.1| Syncerus caffer nanus isolate Z18-2 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720683.1| Syncerus caffer nanus isolate Z18-1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720682.1| Bos indicus isolate 24Brahman2 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720681.1| Bos indicus isolate 27Brahmousin2 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720680.1| Bos indicus isolate 24Brahman1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720679.1| Bos indicus isolate 27Brahmousin1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720678.1| Bos taurus isolate 52SalersB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720677.1| Bos taurus isolate 52SalersA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720676.1| Bos taurus isolate 56BelgianBlueB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720675.1| Bos taurus isolate 56BelgianBlueA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720674.1| Bos taurus isolate 40Brwnsws1 prion protein (PRNP) gene, exon 3 and complete cds Length = 819 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 399 agctgctgcagctggagcag 418
>gb|AY720673.1| Bos taurus isolate Brownswiss41.7 prion protein (PRNP) gene, exon 3 and complete cds Length = 819 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 399 agctgctgcagctggagcag 418
>gb|AY720672.1| Bos taurus isolate Brownswiss39.3 prion protein (PRNP) gene, exon 3 and complete cds Length = 747 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 327 agctgctgcagctggagcag 346
>gb|AY720671.1| Bos taurus isolate 53SalersB prion protein (PRNP) gene, exon 3 and complete cds Length = 771 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 351 agctgctgcagctggagcag 370
>gb|AY720670.1| Bos taurus isolate 53SalersA prion protein (PRNP) gene, exon 3 and complete cds Length = 771 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 351 agctgctgcagctggagcag 370
>gb|AY720669.1| Bos taurus isolate Branvieh37.3 prion protein (PRNP) gene, exon 3 and complete cds Length = 771 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 351 agctgctgcagctggagcag 370
>gb|AY720668.1| Bos taurus isolate Charolais45.7 prion protein (PRNP) gene, exon 3 and complete cds Length = 771 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 351 agctgctgcagctggagcag 370
>gb|AY720667.1| Bos taurus isolate 59GelbviehFB1 prion protein (PRNP) gene, exon 3 and complete cds Length = 771 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 351 agctgctgcagctggagcag 370
>gb|AY720666.1| Bos indicus isolate IndiaNelore12B prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720665.1| Bos indicus isolate IndiaNelore12A prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720664.1| Bos taurus isolate Braunvieh37.1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720663.1| Bos taurus isolate 58CorrienteB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720662.1| Bos taurus isolate 58CorrienteA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720661.1| Bos indicus isolate 19BrafordB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720660.1| Bos indicus isolate 19BrafordA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720659.1| Bos indicus isolate 98RomagnolaB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720658.1| Bos indicus isolate 98RomagnolaA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720657.1| Bos taurus isolate 84MaineAnjouB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720656.1| Bos taurus isolate 84MaineAnjouA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720655.1| Bos taurus isolate 71GelbviehB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720654.1| Bos taurus isolate 71GelbviehA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720653.1| Bos taurus isolate 70GelbviehB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720652.1| Bos taurus isolate 70GelbviehA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720651.1| Bos taurus isolate 57BlondDAqtnB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720650.1| Bos taurus isolate 57BlondDAqtnA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720649.1| Bos taurus isolate 50LonghornB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720648.1| Bos taurus isolate 50LonghornA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720647.1| Bos indicus isolate 11BeefmasterB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720646.1| Bos indicus isolate 11BeefmasterA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720645.1| Bos taurus isolate 117SimmentalBKB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720644.1| Bos taurus isolate 117SimmentalBKA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720643.1| Bos taurus isolate 114SimmentalRDB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720642.1| Bos taurus isolate 114SimmentalRDA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720641.1| Bos taurus isolate 80Limousin2 prion protein (PRNP) gene, exon 3 and complete cds Length = 771 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 351 agctgctgcagctggagcag 370
>gb|AY720640.1| Bos taurus isolate 80Limousin1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720639.1| Bos indicus isolate 112SimbrahB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720638.1| Bos indicus isolate 112SimbrahA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720637.1| Bos taurus isolate 113SimmentalRDB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720636.1| Bos taurus isolate 113SimmentalRDA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720635.1| Bos taurus isolate 116SimmentalRDB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720634.1| Bos taurus isolate 116SimmentalRDA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720633.1| Bos taurus isolate 118SimmentalBKB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720632.1| Bos taurus isolate 118SimmentalBKA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720631.1| Bos taurus isolate 119SimmentalBKB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720630.1| Bos taurus isolate 119SimmentalBKA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720629.1| Bos taurus isolate 120SimmentalBKB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720628.1| Bos taurus isolate 120SimmentalBKA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720627.1| Bos taurus isolate 126A3XCrossB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720626.1| Bos taurus isolate 126A3XCrossA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720625.1| Bos taurus isolate 13BelgianBlueB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720624.1| Bos taurus isolate 13BelgianBlueA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720623.1| Bos taurus isolate 14BelgianBlueB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720622.1| Bos taurus isolate 14BelgianBlueA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720621.1| Bos indicus isolate 21BrafordB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720620.1| Bos indicus isolate 21BrafordA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720619.1| Bos indicus isolate 22BrafordB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720618.1| Bos indicus isolate 22BrafordA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720617.1| Bos indicus isolate 25BrahmanB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720616.1| Bos indicus isolate 25BrahmanA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720615.1| Bos indicus isolate 32BrangusB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720614.1| Bos indicus isolate 32BrangusA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720613.1| Bos taurus isolate 47CharolaisB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720612.1| Bos taurus isolate 47CharolaisA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720611.1| Bos taurus isolate 55TarentaiseB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720610.1| Bos taurus isolate 55TarentaiseA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720609.1| Bos taurus isolate 5AngusB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720608.1| Bos taurus isolate 5AngusA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720607.1| Bos taurus isolate 60MurrayGreyB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720606.1| Bos taurus isolate 60MurrayGreyA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720605.1| Bos taurus isolate 66ChianinaChiaB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720604.1| Bos taurus isolate 66ChianinaChiaA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720603.1| Bos taurus isolate 67ChianinaChiaB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720602.1| Bos taurus isolate 67ChianinaChiaA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720601.1| Bos taurus isolate 69GelbviehB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720600.1| Bos taurus isolate 69GelbviehA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720599.1| Bos taurus X Bison bison isolate 6BeefaloB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720598.1| Bos taurus X Bison bison isolate 6BeefaloA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720597.1| Bos taurus isolate 73HolsteinB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720596.1| Bos taurus isolate 73HolsteinA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720595.1| Bos taurus isolate 76HolsteinB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720594.1| Bos taurus isolate 76HolsteinA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720593.1| Bos indicus isolate 7BeefmasterB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720592.1| Bos indicus isolate 7BeefmasterA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720591.1| Bos taurus isolate 83MneAnjou1 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720590.1| Bos indicus isolate 88PiedmonteseB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720589.1| Bos indicus isolate 88PiedmonteseA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720588.1| Bos taurus isolate Brownswiss39.2 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720587.1| Bos indicus isolate 86USNeloreB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720586.1| Bos indicus isolate 86USNeloreA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720584.1| Bos taurus isolate 62ScottishHighldB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720583.1| Bos taurus isolate 62ScottishHighldA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720582.1| Bos taurus isolate 108ShorthornB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720581.1| Bos taurus isolate 108ShorthornA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720580.1| Bos indicus isolate 9BeefmasterB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720579.1| Bos indicus isolate 9BeefmasterA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720578.1| Bos indicus isolate 99SantaGertrudB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720577.1| Bos indicus isolate 99SantaGertrudA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720576.1| Bos indicus isolate 95RedBrangusB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720575.1| Bos indicus isolate 95RedBrangusA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720574.1| Bos taurus isolate 92RedAngusB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720573.1| Bos taurus isolate 92RedAngusA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720572.1| Bos taurus isolate 68ChianinaChiaB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720571.1| Bos taurus isolate 68ChianinaChiaA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720570.1| Bos taurus isolate 51MurrayGreyB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720569.1| Bos taurus isolate 51MurrayGreyA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720568.1| Bos taurus isolate 4AngusB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720567.1| Bos taurus isolate 4AngusA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720566.1| Bos taurus isolate 44CharolaisB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720565.1| Bos taurus isolate 44CharolaisA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720564.1| Bos taurus isolate 125A3XCrossB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720563.1| Bos taurus isolate 125A3XCrossA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720562.1| Bos taurus isolate 115SimmentalRDB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720561.1| Bos taurus isolate 115SimmentalRDA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720560.1| Bos taurus isolate 109ShorthornB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720559.1| Bos taurus isolate 109ShorthornA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720558.1| Bos taurus isolate 107ShorthornB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720557.1| Bos taurus isolate 107ShorthornA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720556.1| Bos taurus isolate 105ShorthornB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720555.1| Bos taurus isolate 105ShorthornA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720554.1| Bos taurus isolate 91RedAngusB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720553.1| Bos taurus isolate 91RedAngusA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720552.1| Bos taurus isolate 90RedAngusB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720551.1| Bos taurus isolate 90RedAngusA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720550.1| Bos taurus isolate 83MneAnjou2 prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720549.1| Bos taurus isolate 82MaineAnjouB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720548.1| Bos taurus isolate 82MaineAnjouA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720547.1| Bos taurus isolate 2AngusB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720546.1| Bos taurus isolate 2AngusA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720545.1| Bos taurus isolate 106ShorthornB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720544.1| Bos taurus isolate 106ShorthornA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720543.1| Bos indicus isolate 100SantaGertrudB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720542.1| Bos indicus isolate 100SantaGertrudA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720541.1| Bos taurus isolate 38BraunviehB prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394
>gb|AY720540.1| Bos taurus isolate 38BraunviehA prion protein (PRNP) gene, exon 3 and complete cds Length = 795 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 538 agctgctgcagctggagcag 557 |||||||||||||||||||| Sbjct: 375 agctgctgcagctggagcag 394 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,109,736 Number of Sequences: 3902068 Number of extensions: 6109736 Number of successful extensions: 173643 Number of sequences better than 10.0: 686 Number of HSP's better than 10.0 without gapping: 686 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 171618 Number of HSP's gapped (non-prelim): 2016 length of query: 611 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 588 effective length of database: 17,143,297,704 effective search space: 10080259049952 effective search space used: 10080259049952 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
