>emb|AJ508712.1|HVU508712 Hordeum vulgare mRNA for putative thionin
          Length = 414

 Score = 75.8 bits (38), Expect = 8e-12
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 1   ctcttggncacggganacattgtncatgttgtcacagacggnngtcctgcatc 53
           ||||||| ||||||| ||||||| |||||||||||||||||  ||||||||||
Sbjct: 330 ctcttggccacgggaaacattgtccatgttgtcacagacggaagtcctgcatc 278

>emb|X05589.1|HVTHIOR4 Barley mRNA for leaf-specific thionin (clone DG3)
          Length = 544

 Score = 75.8 bits (38), Expect = 8e-12
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 1   ctcttggncacggganacattgtncatgttgtcacagacggnngtcctgcatc 53
           ||||||| ||||||| ||||||| |||||||||||||||||  ||||||||||
Sbjct: 300 ctcttggccacgggaaacattgtccatgttgtcacagacggaagtcctgcatc 248

>emb|X05590.1|HVTHIOR5 Barley mRNA for leaf-specific thionin (clone DD3)
          Length = 491

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 1   ctcttggncacggganacattgtncatgttgtcacagacggnngtcctgcatc 53
           ||||||| ||||||| ||||||| || ||||||||||||||  ||||||||||
Sbjct: 214 ctcttggccacgggaaacattgtccaggttgtcacagacggaagtcctgcatc 162

>gb|M19048.1|BLYTHNC Barley leaf specific thionin mRNA, complete cds, clone pKG1940
          Length = 663

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 1   ctcttggncacggganacattgtncatgttgtcacagacggnngtcctgcatc 53
           ||||||| ||||||| ||||||| |||||||||||||||||  |||| |||||
Sbjct: 373 ctcttggccacgggaaacattgtccatgttgtcacagacggaagtccggcatc 321

>gb|M19047.1|BLYTHNB Barley leaf specific thionin mRNA, complete cds, clone pKG1348
          Length = 608

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 1   ctcttggncacggganacattgtncatgttgtcacagacggnngtcctgcatc 53
           ||||||| ||||||| ||||||| |||||||||||||||||  |||| |||||
Sbjct: 373 ctcttggccacgggaaacattgtccatgttgtcacagacggaagtccggcatc 321

>gb|M19046.1|BLYTHNA Barley leaf specific thionin mRNA, complete cds, clone pKG2872
          Length = 540

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 1   ctcttggncacggganacattgtncatgttgtcacagacggnngtcctgcatc 53
           ||||||| ||||||| ||||||| |||||||||||||||||  |||| |||||
Sbjct: 373 ctcttggccacgggaaacattgtccatgttgtcacagacggaagtccggcatc 321

>emb|X05576.1|HVTHIOR1 Barley mRNA for leaf-specific thionin (clone DB4)
          Length = 637

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 1   ctcttggncacggganacattgtncatgttgtcacagac 39
           ||||||| ||||| | ||||||| |||||||||||||||
Sbjct: 348 ctcttggccacggaaaacattgtccatgttgtcacagac 310

>emb|X05587.1|HVTHIOR2 Barley mRNA for leaf-specific thionin (clone DC4)
          Length = 658

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 1   ctcttggncacggganacattgtncatgttgtcacagac 39
           ||||||| ||||| | ||||||| |||||||||||||||
Sbjct: 355 ctcttggccacggaaaacattgtccatgttgtcacagac 317

>gb|L36883.1|BLYBTH7T Hordeum vulgare thionin (BTH7) gene, complete cds
          Length = 2259

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 18   cattgtncatgttgtcacagacggnngtcctgcatc 53
            |||||| |||||||||||| ||||  ||||||||||
Sbjct: 1963 cattgtccatgttgtcacaaacggaagtcctgcatc 1928

>emb|X05588.1|HVTHIOR3 Barley mRNA for leaf-specific thionin (clone DF2)
          Length = 453

 Score = 44.1 bits (22), Expect = 0.030
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 1   ctcttggncacggganacattgtncatgttgtcacagac 39
           ||||||| || || | ||||||| |||||||||||||||
Sbjct: 175 ctcttggccatggaaaacattgtccatgttgtcacagac 137

>dbj|AB072342.1| Avena sativa mRNA for thionin Asthi5, complete cds
          Length = 641

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 32/37 (86%)
 Strand = Plus / Minus

                                                
Query: 17  acattgtncatgttgtcacagacggnngtcctgcatc 53
           ||||||| |||||||||||| ||||  ||| ||||||
Sbjct: 359 acattgtccatgttgtcacaaacggaagtcatgcatc 323

>gb|L36882.1|BLYBTH6T Hordeum vulgare thionin (bth6) gene, complete cds
          Length = 2406

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 18   cattgtncatgttgtcacagac 39
            |||||| |||||||||||||||
Sbjct: 1937 cattgtccatgttgtcacagac 1916


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 54,355
Number of Sequences: 3902068
Number of extensions: 54355
Number of successful extensions: 14786
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14774
Number of HSP's gapped (non-prelim): 12
length of query: 53
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 33
effective length of database: 17,155,003,908
effective search space: 566115128964
effective search space used: 566115128964
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)