ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags12n04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_192684.1| Oryza sativa (japonica cultivar-group), predic... 92 2e-15
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
3dbj|AP003303.4| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
4dbj|AP003022.2| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
5emb|AL359736.19| Human DNA sequence from clone RP11-307N16 on ch... 46 0.13
6ref|XM_790515.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.50
7gb|AC010040.6| Drosophila melanogaster 3L BAC RP98-13E21 (Roswel... 44 0.50
8gb|BT024400.1| Drosophila melanogaster IP05056 full insert cDNA 44 0.50
9gb|AE003555.3| Drosophila melanogaster chromosome 3L, section 30... 44 0.50
10emb|AL672091.4| Mouse DNA sequence from clone RP23-185L10 on chr... 44 0.50
11gb|BC085096.1| Mus musculus cDNA clone MGC:102640 IMAGE:30731739... 42 2.0
12ref|NM_027285.2| Mus musculus RIKEN cDNA 1700029I01 gene (170002... 42 2.0
13gb|AC122491.3| Mus musculus BAC clone RP24-390D3 from chromosome... 42 2.0
14ref|XM_987785.1| PREDICTED: Mus musculus similar to zinc finger ... 42 2.0
15ref|XM_001006744.1| PREDICTED: Mus musculus similar to reduced e... 42 2.0
16gb|BC066875.1| Mus musculus cDNA clone MGC:76795 IMAGE:30111586,... 42 2.0
17ref|XM_984726.1| PREDICTED: Mus musculus similar to zinc finger ... 42 2.0
18ref|XM_984410.1| PREDICTED: Mus musculus similar to zinc finger ... 42 2.0
19ref|XM_993901.1| PREDICTED: Mus musculus similar to zinc finger ... 42 2.0
20gb|AC117202.2| Mus musculus BAC clone RP23-248L5 from 14, comple... 42 2.0
21gb|AC117210.3| Mus musculus BAC clone RP23-286E20 from 10, compl... 42 2.0
22gb|AC138642.10| Mus musculus chromosome 3, clone RP23-21O7, comp... 42 2.0
23gb|BC108336.1| Mus musculus similar to zinc finger protein 665, ... 42 2.0
24gb|BC085112.1| Mus musculus similar to RIKEN cDNA 1700029I01, mR... 42 2.0
25emb|AL445309.13| Human DNA sequence from clone RP11-506K6 on chr... 42 2.0
26emb|CR788296.8| Mouse DNA sequence from clone RP23-17C23 on chro... 42 2.0
27dbj|AK139880.1| Mus musculus 2 cells egg cDNA, RIKEN full-length... 42 2.0
28gb|AY920776.1| Nausithoe rubra large subunit 28S ribosomal RNA g... 42 2.0
29gb|AC079389.2| Rattus norvegicus strain Brown Norway chromosome ... 42 2.0
30emb|AL626778.12| Mouse DNA sequence from clone RP23-326E2 on chr... 42 2.0
31gb|AC020893.6| Homo sapiens chromosome 5 clone CTC-250P20, compl... 42 2.0
32gb|BC096621.1| Mus musculus RIKEN cDNA 1700029I01 gene, mRNA (cD... 42 2.0
33gb|AY570760.1| Daedalea quercina isolate Dqu1 small subunit ribo... 42 2.0
34ref|XM_347236.2| PREDICTED: Rattus norvegicus SEC23A (S. cerevis... 42 2.0
35ref|NM_001037926.1| Mus musculus similar to zinc finger protein ... 42 2.0
36ref|NM_001014397.1| Mus musculus similar to RIKEN cDNA 1700029I0... 42 2.0
37emb|AL731663.12| Mouse DNA sequence from clone RP23-360J20 on ch... 42 2.0
38emb|AL929465.6| Mouse DNA sequence from clone RP23-395N7 on chro... 42 2.0
39gb|BC024323.1| Mus musculus RIKEN cDNA 1700029I01 gene, mRNA (cD... 42 2.0
40gb|U27034.1|DQU27034 Daedalea quercina mitochondrial small subun... 42 2.0
41emb|AL954334.4| Mouse DNA sequence from clone RP24-93B5 on chrom... 42 2.0
42emb|AL606987.11| Mouse DNA sequence from clone RP23-383I4 on chr... 42 2.0
43emb|AL606910.14| Mouse DNA sequence from clone RP23-282C23 on ch... 42 2.0
44emb|AL713973.7| Mouse DNA sequence from clone RP23-60A13 on chro... 42 2.0
45emb|AL606931.6| Mouse DNA sequence from clone RP23-162H3 on chro... 42 2.0
46ref|XM_414818.1| PREDICTED: Gallus gallus similar to unconventio... 40 7.9
47gb|AC101980.8| Mus musculus chromosome 7, clone RP24-339E15, com... 40 7.9
48emb|BX001006.7| Zebrafish DNA sequence from clone DKEY-148M7 in ... 40 7.9
49emb|AL354868.10| Human DNA sequence from clone RP11-339A7 on chr... 40 7.9
50emb|BX649458.8| Zebrafish DNA sequence from clone DKEY-14P20 in ... 40 7.9
51gb|AC008618.7| Homo sapiens chromosome 5 clone CTB-146E17, compl... 40 7.9
52gb|AC008565.6|AC008565 Homo sapiens chromosome 5 clone CTC-538F1... 40 7.9
53dbj|AP003277.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
54gb|AF091786.1|AF091786 Oncorhynchus nerka non-classical MHC clas... 40 7.9
55gb|AC131662.4| Mus musculus BAC clone RP23-257H24 from chromosom... 40 7.9
56gb|AC153902.4| Mus musculus 6 BAC RP23-5K15 (Roswell Park Cancer... 40 7.9
57emb|BX470104.1| Zebrafish DNA sequence from clone DKEY-148M7, co... 40 7.9
58gb|M19647.1|RATKALA Rat renal kallikrein gene, complete cds, clo... 40 7.9 
>ref|NM_192684.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2505

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                        
Query: 448  tcagctcttctctccttgatgcatcctcggcttcttggaaggcggtgtcatgaaaagctt 507
            ||||| ||||||| |  |||| ||||||  |||||| ||||| |||||||||||||||||
Sbjct: 2505 tcagcccttctctgcccgatgtatcctcaacttctttgaaggtggtgtcatgaaaagctt 2446

                                                      
Query: 508  tctaacagatgtaacgggatcatcctcctcattgagaaggct 549
            ||||||||| ||||| || |||||||||||| | ||||||||
Sbjct: 2445 tctaacagacgtaacagggtcatcctcctcactaagaaggct 2404
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                            
Query: 448      tcagctcttctctccttgatgcatcctcggcttcttggaaggcggtgtcatgaaaagctt 507
                ||||| ||||||| |  |||| ||||||  |||||| ||||| |||||||||||||||||
Sbjct: 23857324 tcagcccttctctgcccgatgtatcctcaacttctttgaaggtggtgtcatgaaaagctt 23857265

                                             
Query: 508      tctaacagatgtaacgggatcatcctcct 536
                ||||||||| ||||| || ||||||||||
Sbjct: 23857264 tctaacagacgtaacagggtcatcctcct 23857236



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 90       ctacagtttacaggtgctgaacag 113
                |||||||| |||||||||||||||
Sbjct: 42870608 ctacagttgacaggtgctgaacag 42870631
to top
>dbj|AP003303.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0704D04
          Length = 147638

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                        
Query: 448  tcagctcttctctccttgatgcatcctcggcttcttggaaggcggtgtcatgaaaagctt 507
            ||||| ||||||| |  |||| ||||||  |||||| ||||| |||||||||||||||||
Sbjct: 3728 tcagcccttctctgcccgatgtatcctcaacttctttgaaggtggtgtcatgaaaagctt 3669

                                         
Query: 508  tctaacagatgtaacgggatcatcctcct 536
            ||||||||| ||||| || ||||||||||
Sbjct: 3668 tctaacagacgtaacagggtcatcctcct 3640
to top
>dbj|AP003022.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0681B11
          Length = 144091

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                          
Query: 448    tcagctcttctctccttgatgcatcctcggcttcttggaaggcggtgtcatgaaaagctt 507
              ||||| ||||||| |  |||| ||||||  |||||| ||||| |||||||||||||||||
Sbjct: 137909 tcagcccttctctgcccgatgtatcctcaacttctttgaaggtggtgtcatgaaaagctt 137850

                                           
Query: 508    tctaacagatgtaacgggatcatcctcct 536
              ||||||||| ||||| || ||||||||||
Sbjct: 137849 tctaacagacgtaacagggtcatcctcct 137821
to top
>emb|AL359736.19| Human DNA sequence from clone RP11-307N16 on chromosome 13 Contains the
              gene for a novel protein (FLJ31208), three novel genes, a
              novel pseudogene and three CpG islands, complete sequence
          Length = 178850

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 311    ctgtttccctttttcttgttccc 333
              |||||||||||||||||||||||
Sbjct: 139789 ctgtttccctttttcttgttccc 139767
to top
>ref|XM_790515.1| PREDICTED: Strongylocentrotus purpuratus similar to CG4877-PA,
           isoform A (LOC590930), mRNA
          Length = 3363

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 445 ttctcagctcttctctccttgatgca 470
           |||| |||||||||||||||||||||
Sbjct: 555 ttctgagctcttctctccttgatgca 530
to top
>gb|AC010040.6| Drosophila melanogaster 3L BAC RP98-13E21 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 159672

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 120   acaccactactaagctagtaca 141
             ||||||||||||||||||||||
Sbjct: 99491 acaccactactaagctagtaca 99512
to top
>gb|BT024400.1| Drosophila melanogaster IP05056 full insert cDNA
          Length = 1018

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 120 acaccactactaagctagtaca 141
           ||||||||||||||||||||||
Sbjct: 542 acaccactactaagctagtaca 563
to top
>gb|AE003555.3| Drosophila melanogaster chromosome 3L, section 30 of 83 of the
            complete sequence
          Length = 283781

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 120  acaccactactaagctagtaca 141
            ||||||||||||||||||||||
Sbjct: 4740 acaccactactaagctagtaca 4761
to top
>emb|AL672091.4| Mouse DNA sequence from clone RP23-185L10 on chromosome X, complete
              sequence
          Length = 206291

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 308    catctgtttccctttttcttgttccc 333
              |||||||||||||| |||||||||||
Sbjct: 188853 catctgtttcccttgttcttgttccc 188828
to top
>gb|BC085096.1| Mus musculus cDNA clone MGC:102640 IMAGE:30731739, complete cds
          Length = 2875

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2429 ggtgtcatgaaaagctttcta 2409
to top
>ref|NM_027285.2| Mus musculus RIKEN cDNA 1700029I01 gene (1700029I01Rik), mRNA
          Length = 4593

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2370 ggtgtcatgaaaagctttcta 2350
to top
>gb|AC122491.3| Mus musculus BAC clone RP24-390D3 from chromosome 3, complete sequence
          Length = 175092

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 491    ggtgtcatgaaaagctttcta 511
              |||||||||||||||||||||
Sbjct: 106636 ggtgtcatgaaaagctttcta 106656
to top
>ref|XM_987785.1| PREDICTED: Mus musculus similar to zinc finger protein 665
            (LOC671566), mRNA
          Length = 3762

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2108 ggtgtcatgaaaagctttcta 2088
to top
>ref|XM_001006744.1| PREDICTED: Mus musculus similar to reduced expression 2 (LOC673960),
            mRNA
          Length = 1418

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 1206 ggtgtcatgaaaagctttcta 1186
to top
>gb|BC066875.1| Mus musculus cDNA clone MGC:76795 IMAGE:30111586, complete cds
          Length = 2891

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2453 ggtgtcatgaaaagctttcta 2433
to top
>ref|XM_984726.1| PREDICTED: Mus musculus similar to zinc finger protein 665
            (LOC666581), mRNA
          Length = 3672

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2644 ggtgtcatgaaaagctttcta 2624
to top
>ref|XM_984410.1| PREDICTED: Mus musculus similar to zinc finger protein 665
            (LOC666532), mRNA
          Length = 4391

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2741 ggtgtcatgaaaagctttcta 2721
to top
>ref|XM_993901.1| PREDICTED: Mus musculus similar to zinc finger protein 665
            (LOC668033), mRNA
          Length = 2832

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2598 ggtgtcatgaaaagctttcta 2578
to top
>gb|AC117202.2| Mus musculus BAC clone RP23-248L5 from 14, complete sequence
          Length = 209508

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 491    ggtgtcatgaaaagctttcta 511
              |||||||||||||||||||||
Sbjct: 156347 ggtgtcatgaaaagctttcta 156367
to top
>gb|AC117210.3| Mus musculus BAC clone RP23-286E20 from 10, complete sequence
          Length = 178173

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 491    ggtgtcatgaaaagctttcta 511
              |||||||||||||||||||||
Sbjct: 130654 ggtgtcatgaaaagctttcta 130674
to top
>gb|AC138642.10| Mus musculus chromosome 3, clone RP23-21O7, complete sequence
          Length = 252108

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 1333 ggtgtcatgaaaagctttcta 1353
to top
>gb|BC108336.1| Mus musculus similar to zinc finger protein 665, mRNA (cDNA clone
            MGC:117846 IMAGE:30462068), complete cds
          Length = 2825

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2591 ggtgtcatgaaaagctttcta 2571
to top
>gb|BC085112.1| Mus musculus similar to RIKEN cDNA 1700029I01, mRNA (cDNA clone
            MGC:102641 IMAGE:30731985), complete cds
          Length = 2819

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2374 ggtgtcatgaaaagctttcta 2354
to top
>emb|AL445309.13| Human DNA sequence from clone RP11-506K6 on chromosome 6 Contains the
              gene for a novel protein similar to tubulin beta
              polypeptide TUBB, a novel gene, the 3' end of the gene for
              the possible ortholog of rat ion transporter protein
              (NRITP) and five CpG islands, complete sequence
          Length = 136587

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 231    aacagatgaccaatgaattgt 251
              |||||||||||||||||||||
Sbjct: 129521 aacagatgaccaatgaattgt 129501
to top
>emb|CR788296.8| Mouse DNA sequence from clone RP23-17C23 on chromosome 4, complete
           sequence
          Length = 32853

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 491 ggtgtcatgaaaagctttcta 511
           |||||||||||||||||||||
Sbjct: 497 ggtgtcatgaaaagctttcta 477
to top
>dbj|AK139880.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
            clone:B020031M12 product:hypothetical Zn-finger, C2H2
            type/KRAB box containing protein, full insert sequence
          Length = 2534

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2341 ggtgtcatgaaaagctttcta 2321
to top
>gb|AY920776.1| Nausithoe rubra large subunit 28S ribosomal RNA gene, partial
           sequence
          Length = 3306

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 303 aactccatctgtttccctttt 323
           |||||||||||||||||||||
Sbjct: 381 aactccatctgtttccctttt 361
to top
>gb|AC079389.2| Rattus norvegicus strain Brown Norway chromosome 6 clone RP31-263K14,
             complete sequence
          Length = 151836

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 208   atttctttaatcaccataaca 228
             |||||||||||||||||||||
Sbjct: 13910 atttctttaatcaccataaca 13930
to top
>emb|AL626778.12| Mouse DNA sequence from clone RP23-326E2 on chromosome 4, complete
              sequence
          Length = 186208

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 491    ggtgtcatgaaaagctttcta 511
              |||||||||||||||||||||
Sbjct: 123298 ggtgtcatgaaaagctttcta 123278
to top
>gb|AC020893.6| Homo sapiens chromosome 5 clone CTC-250P20, complete sequence
          Length = 124235

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 199   gtcctccagatttctttaatc 219
             |||||||||||||||||||||
Sbjct: 79325 gtcctccagatttctttaatc 79305
to top
>gb|BC096621.1| Mus musculus RIKEN cDNA 1700029I01 gene, mRNA (cDNA clone MGC:106059
            IMAGE:30464103), complete cds
          Length = 4593

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2370 ggtgtcatgaaaagctttcta 2350
to top
>gb|AY570760.1| Daedalea quercina isolate Dqu1 small subunit ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 539

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 440 tacggttctcagctcttctct 460
           |||||||||||||||||||||
Sbjct: 297 tacggttctcagctcttctct 277
to top
>ref|XM_347236.2| PREDICTED: Rattus norvegicus SEC23A (S. cerevisiae) (predicted)
            (Sec23a_predicted), mRNA
          Length = 4034

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 208  atttctttaatcaccataaca 228
            |||||||||||||||||||||
Sbjct: 3126 atttctttaatcaccataaca 3106
to top
>ref|NM_001037926.1| Mus musculus similar to zinc finger protein 665 (MGC117846), mRNA
          Length = 2825

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2591 ggtgtcatgaaaagctttcta 2571
to top
>ref|NM_001014397.1| Mus musculus similar to RIKEN cDNA 1700029I01 (LOC433804), mRNA
          Length = 2819

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2374 ggtgtcatgaaaagctttcta 2354
to top
>emb|AL731663.12| Mouse DNA sequence from clone RP23-360J20 on chromosome 4, complete
             sequence
          Length = 181033

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 491   ggtgtcatgaaaagctttcta 511
             |||||||||||||||||||||
Sbjct: 73242 ggtgtcatgaaaagctttcta 73222
to top
>emb|AL929465.6| Mouse DNA sequence from clone RP23-395N7 on chromosome 4, complete
              sequence
          Length = 197037

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 491    ggtgtcatgaaaagctttcta 511
              |||||||||||||||||||||
Sbjct: 126832 ggtgtcatgaaaagctttcta 126812
to top
>gb|BC024323.1| Mus musculus RIKEN cDNA 1700029I01 gene, mRNA (cDNA clone MGC:19361
            IMAGE:4242170), complete cds
          Length = 2812

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 2586 ggtgtcatgaaaagctttcta 2566
to top
>gb|U27034.1|DQU27034 Daedalea quercina mitochondrial small subunit ribosomal RNA,
           mitochondrial gene, partial sequence
          Length = 539

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 440 tacggttctcagctcttctct 460
           |||||||||||||||||||||
Sbjct: 298 tacggttctcagctcttctct 278
to top
>emb|AL954334.4| Mouse DNA sequence from clone RP24-93B5 on chromosome 4, complete
             sequence
          Length = 125201

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 491   ggtgtcatgaaaagctttcta 511
             |||||||||||||||||||||
Sbjct: 54489 ggtgtcatgaaaagctttcta 54469
to top
>emb|AL606987.11| Mouse DNA sequence from clone RP23-383I4 on chromosome 4, complete
              sequence
          Length = 212647

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 491    ggtgtcatgaaaagctttcta 511
              |||||||||||||||||||||
Sbjct: 167073 ggtgtcatgaaaagctttcta 167093
to top
>emb|AL606910.14| Mouse DNA sequence from clone RP23-282C23 on chromosome 4, complete
            sequence
          Length = 185210

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 8220 ggtgtcatgaaaagctttcta 8200
to top
>emb|AL713973.7| Mouse DNA sequence from clone RP23-60A13 on chromosome 4, complete
            sequence
          Length = 79377

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 491  ggtgtcatgaaaagctttcta 511
            |||||||||||||||||||||
Sbjct: 9324 ggtgtcatgaaaagctttcta 9304
to top
>emb|AL606931.6| Mouse DNA sequence from clone RP23-162H3 on chromosome 4, complete
             sequence
          Length = 108136

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 491   ggtgtcatgaaaagctttcta 511
             |||||||||||||||||||||
Sbjct: 47315 ggtgtcatgaaaagctttcta 47295
to top
>ref|XM_414818.1| PREDICTED: Gallus gallus similar to unconventional myosin-15
            (LOC416514), mRNA
          Length = 10208

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 449  cagctcttctctccttgatg 468
            ||||||||||||||||||||
Sbjct: 7948 cagctcttctctccttgatg 7929
to top
>gb|AC101980.8| Mus musculus chromosome 7, clone RP24-339E15, complete sequence
          Length = 219739

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 551    agcttagtctccaattctgaaact 574
              ||||||||||||| ||||||||||
Sbjct: 219238 agcttagtctccatttctgaaact 219261
to top
>emb|BX001006.7| Zebrafish DNA sequence from clone DKEY-148M7 in linkage group 3, complete
              sequence
          Length = 193997

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 200    tcctccagatttctttaatc 219
              ||||||||||||||||||||
Sbjct: 178364 tcctccagatttctttaatc 178383
to top
>emb|AL354868.10| Human DNA sequence from clone RP11-339A7 on chromosome 6 Contains a
             ribosomal protein L21 (RPL21) pseudogene, complete
             sequence
          Length = 164018

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 99    acaggtgctgaacagcaaatgaca 122
             |||||||||||| |||||||||||
Sbjct: 35821 acaggtgctgaatagcaaatgaca 35798
to top
>emb|BX649458.8| Zebrafish DNA sequence from clone DKEY-14P20 in linkage group 2, complete
              sequence
          Length = 147578

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 200    tcctccagatttctttaatc 219
              ||||||||||||||||||||
Sbjct: 103978 tcctccagatttctttaatc 103997
to top
>gb|AC008618.7| Homo sapiens chromosome 5 clone CTB-146E17, complete sequence
          Length = 139029

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 308  catctgtttccctttttctt 327
            ||||||||||||||||||||
Sbjct: 9951 catctgtttccctttttctt 9932
to top
>gb|AC008565.6|AC008565 Homo sapiens chromosome 5 clone CTC-538F12, complete sequence
          Length = 167086

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 308    catctgtttccctttttctt 327
              ||||||||||||||||||||
Sbjct: 113323 catctgtttccctttttctt 113342
to top
>dbj|AP003277.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518C01
          Length = 173555

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 90    ctacagtttacaggtgctgaacag 113
             |||||||| |||||||||||||||
Sbjct: 64342 ctacagttgacaggtgctgaacag 64365
to top
>gb|AF091786.1|AF091786 Oncorhynchus nerka non-classical MHC class I heavy chain (Onne-UAA)
           mRNA, Onne-UAA*0101 allele, partial cds, alternatively
           spliced
          Length = 1113

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 308 catctgtttccctttttctt 327
           ||||||||||||||||||||
Sbjct: 475 catctgtttccctttttctt 456
to top
>gb|AC131662.4| Mus musculus BAC clone RP23-257H24 from chromosome 7, complete sequence
          Length = 178528

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 551   agcttagtctccaattctgaaact 574
             ||||||||||||| ||||||||||
Sbjct: 22928 agcttagtctccatttctgaaact 22951
to top
>gb|AC153902.4| Mus musculus 6 BAC RP23-5K15 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 208717

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 311    ctgtttccctttttcttgtt 330
              ||||||||||||||||||||
Sbjct: 100414 ctgtttccctttttcttgtt 100395
to top
>emb|BX470104.1| Zebrafish DNA sequence from clone DKEY-148M7, complete sequence
          Length = 43130

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   tcctccagatttctttaatc 219
             ||||||||||||||||||||
Sbjct: 27497 tcctccagatttctttaatc 27516
to top
>gb|M19647.1|RATKALA Rat renal kallikrein gene, complete cds, clone RSKG-7
          Length = 6257

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 212 ctttaatcaccataacatgaacag 235
           |||||||||||| |||||||||||
Sbjct: 921 ctttaatcaccaaaacatgaacag 944


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,169,127
Number of Sequences: 3902068
Number of extensions: 5169127
Number of successful extensions: 94546
Number of sequences better than 10.0: 58
Number of HSP's better than 10.0 without gapping: 59
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94400
Number of HSP's gapped (non-prelim): 146
length of query: 580
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 557
effective length of database: 17,143,297,704
effective search space: 9548816821128
effective search space used: 9548816821128
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top