| Clone Name | rbags13c01 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_500389.1| Yarrowia lipolytica CLIB122, YALI0B01540g predicted mRNA Length = 210 Score = 44.1 bits (22), Expect = 0.080 Identities = 22/22 (100%) Strand = Plus / Minus Query: 88 actcgtcatcctcgtcatcgtc 109 |||||||||||||||||||||| Sbjct: 208 actcgtcatcctcgtcatcgtc 187
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica Length = 3066374 Score = 44.1 bits (22), Expect = 0.080 Identities = 22/22 (100%) Strand = Plus / Plus Query: 88 actcgtcatcctcgtcatcgtc 109 |||||||||||||||||||||| Sbjct: 245151 actcgtcatcctcgtcatcgtc 245172
>ref|XM_780232.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein LOC580159 (LOC580159), mRNA Length = 1902 Score = 42.1 bits (21), Expect = 0.32 Identities = 21/21 (100%) Strand = Plus / Minus Query: 89 ctcgtcatcctcgtcatcgtc 109 ||||||||||||||||||||| Sbjct: 1131 ctcgtcatcctcgtcatcgtc 1111
>gb|AC125291.3| Drosophila melanogaster X BAC CH221-17A11 (CHORI Sheared BAC Drosophila melanogaster library) complete sequence Length = 166613 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 150462 tcgtcatcctcgtcatcgtc 150443
>ref|XM_754221.1| Ustilago maydis 521 hypothetical protein (UM03167.1) partial mRNA Length = 2610 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 1748 tcgtcatcctcgtcatcgtc 1729
>ref|XM_754531.1| Ustilago maydis 521 hypothetical protein (UM03477.1) partial mRNA Length = 3900 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 1019 tcgtcatcctcgtcatcgtc 1000
>emb|AJ296686.1|PAB296686 Picea abies ATC microsatellite DNA, clone EATC1A02 Length = 421 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 191 tcgtcatcctcgtcatcgtc 210
>ref|XM_380961.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG00785.1) partial mRNA Length = 600 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 593 tcgtcatcctcgtcatcgtc 574
>emb|AJ890137.1| Murid Herpesvirus 2 r138 gene (partial), r139 gene, r140 gene, r141 gene and r142 gene (partial) Length = 7462 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 3340 tcgtcatcctcgtcatcgtc 3359
>gb|AC023723.4| Drosophila melanogaster X BAC RP98-48E6 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179363 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 13719 tcgtcatcctcgtcatcgtc 13700
>gb|AC023709.4| Drosophila melanogaster X BAC RP98-10I17 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 163710 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 111766 tcgtcatcctcgtcatcgtc 111747
>gb|AF232689.2| Rat cytomegalovirus Maastricht, complete genome Length = 230138 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 190797 tcgtcatcctcgtcatcgtc 190816
>ref|NM_132413.1| Drosophila melanogaster CG15295-RA (CG15295), mRNA Length = 2288 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 962 tcgtcatcctcgtcatcgtc 943
>gb|AE003451.5| Drosophila melanogaster chromosome X, section 35 of 74 of the complete sequence Length = 285729 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 130980 tcgtcatcctcgtcatcgtc 130999
>gb|AY664418.1| Zea mays cultivar Mo17 locus 9008, complete sequence Length = 282600 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 115897 tcgtcatcctcgtcatcgtc 115916
>gb|AY664414.1| Zea mays cultivar B73 locus 9008, complete sequence Length = 339089 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 tcgtcatcctcgtcatcgtc 109 |||||||||||||||||||| Sbjct: 129620 tcgtcatcctcgtcatcgtc 129639
>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome Length = 2560265 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 89 ctcgtcatcctcgtcatcg 107 ||||||||||||||||||| Sbjct: 2138194 ctcgtcatcctcgtcatcg 2138176
>ref|XM_369396.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein (MG06068.4) partial mRNA Length = 1614 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 89 ctcgtcatcctcgtcatcg 107 ||||||||||||||||||| Sbjct: 1305 ctcgtcatcctcgtcatcg 1287
>ref|XM_388646.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08470.1) partial mRNA Length = 1191 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 91 cgtcatcctcgtcatcgtc 109 ||||||||||||||||||| Sbjct: 182 cgtcatcctcgtcatcgtc 200
>ref|XM_670854.1| Plasmodium berghei strain ANKA hypothetical protein (PB000009.03.0) partial mRNA Length = 981 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 26 cagactttaacaaaaacgc 44 ||||||||||||||||||| Sbjct: 931 cagactttaacaaaaacgc 949
>gb|U88167.2| Caenorhabditis elegans cosmid D2092, complete sequence Length = 41558 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 82 ctcttcactcgtcatcctc 100 ||||||||||||||||||| Sbjct: 12228 ctcttcactcgtcatcctc 12246
>ref|XM_787663.1| PREDICTED: Strongylocentrotus purpuratus similar to ZIP4 protein (LOC587958), mRNA Length = 2654 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 89 ctcgtcatcctcgtcatcg 107 ||||||||||||||||||| Sbjct: 1948 ctcgtcatcctcgtcatcg 1966
>gb|AC120036.5| Homo sapiens chromosome 8, clone RP11-1134I14, complete sequence Length = 177423 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 58 acactggggagatggacac 76 ||||||||||||||||||| Sbjct: 169156 acactggggagatggacac 169174
>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III, complete sequence Length = 907057 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 88 actcgtcatcctcgtcatc 106 ||||||||||||||||||| Sbjct: 429998 actcgtcatcctcgtcatc 429980
>gb|AC138681.3| Homo sapiens chromosome 8, clone RP13-41K17, complete sequence Length = 28800 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 58 acactggggagatggacac 76 ||||||||||||||||||| Sbjct: 16177 acactggggagatggacac 16159
>ref|NM_208794.1| Eremothecium gossypii ACR038Wp (ACR038W), mRNA Length = 2025 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 88 actcgtcatcctcgtcatc 106 ||||||||||||||||||| Sbjct: 1993 actcgtcatcctcgtcatc 1975
>gb|U03640.1|HSIGLV8F Human clone FL6 Ig lambda light chain V-region germline (Vlambda-VIII.2) gene, partial cds Length = 775 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 58 acactggggagatggacac 76 ||||||||||||||||||| Sbjct: 753 acactggggagatggacac 735
>gb|U03636.1|HSIGLV8B Human clone TL6 Ig lambda light chain V-region germline (Vlambda-VIII.2) gene, partial cds Length = 775 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 58 acactggggagatggacac 76 ||||||||||||||||||| Sbjct: 753 acactggggagatggacac 735
>gb|AY849331.1| Drosophila americana strain G96-48 suppressor of Hairy wing (su(Hw)) gene, partial cds Length = 1497 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 91 cgtcatcctcgtcatcgtc 109 ||||||||||||||||||| Sbjct: 118 cgtcatcctcgtcatcgtc 100
>gb|AY849330.1| Drosophila americana strain G96-47 suppressor of Hairy wing (su(Hw)) gene, partial cds Length = 1515 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 91 cgtcatcctcgtcatcgtc 109 ||||||||||||||||||| Sbjct: 118 cgtcatcctcgtcatcgtc 100
>gb|AY849329.1| Drosophila americana strain G96-45 suppressor of Hairy wing (su(Hw)) gene, partial cds Length = 1515 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 91 cgtcatcctcgtcatcgtc 109 ||||||||||||||||||| Sbjct: 118 cgtcatcctcgtcatcgtc 100
>gb|AY849328.1| Drosophila americana strain G96-31 suppressor of Hairy wing (su(Hw)) gene, partial cds Length = 1515 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 91 cgtcatcctcgtcatcgtc 109 ||||||||||||||||||| Sbjct: 118 cgtcatcctcgtcatcgtc 100
>gb|AY849327.1| Drosophila americana strain G96-11 suppressor of Hairy wing (su(Hw)) gene, partial cds Length = 1516 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 91 cgtcatcctcgtcatcgtc 109 ||||||||||||||||||| Sbjct: 118 cgtcatcctcgtcatcgtc 100
>gb|U48288.1|RRU48288 Rattus norvegicus A-kinase anchoring protein AKAP 220 mRNA, complete cds Length = 9748 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 59 cactggggagatggacacg 77 ||||||||||||||||||| Sbjct: 1986 cactggggagatggacacg 2004 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 603,557 Number of Sequences: 3902068 Number of extensions: 603557 Number of successful extensions: 42234 Number of sequences better than 10.0: 34 Number of HSP's better than 10.0 without gapping: 34 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 42124 Number of HSP's gapped (non-prelim): 110 length of query: 109 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 88 effective length of database: 17,151,101,840 effective search space: 1509296961920 effective search space used: 1509296961920 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)