ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags13c01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_500389.1| Yarrowia lipolytica CLIB122, YALI0B01540g predi... 44 0.080
2emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 44 0.080
3ref|XM_780232.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 42 0.32
4gb|AC125291.3| Drosophila melanogaster X BAC CH221-17A11 (CHORI ... 40 1.2
5ref|XM_754221.1| Ustilago maydis 521 hypothetical protein (UM031... 40 1.2
6ref|XM_754531.1| Ustilago maydis 521 hypothetical protein (UM034... 40 1.2
7emb|AJ296686.1|PAB296686 Picea abies ATC microsatellite DNA, clo... 40 1.2
8ref|XM_380961.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 40 1.2
9emb|AJ890137.1| Murid Herpesvirus 2 r138 gene (partial), r139 ge... 40 1.2
10gb|AC023723.4| Drosophila melanogaster X BAC RP98-48E6 (Roswell ... 40 1.2
11gb|AC023709.4| Drosophila melanogaster X BAC RP98-10I17 (Roswell... 40 1.2
12gb|AF232689.2| Rat cytomegalovirus Maastricht, complete genome 40 1.2
13ref|NM_132413.1| Drosophila melanogaster CG15295-RA (CG15295), mRNA 40 1.2
14gb|AE003451.5| Drosophila melanogaster chromosome X, section 35 ... 40 1.2
15gb|AY664418.1| Zea mays cultivar Mo17 locus 9008, complete sequence 40 1.2
16gb|AY664414.1| Zea mays cultivar B73 locus 9008, complete sequence 40 1.2
17gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome 38 4.9
18ref|XM_369396.1| Magnaporthe grisea 70-15 chromosome III hypothe... 38 4.9
19ref|XM_388646.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 38 4.9
20ref|XM_670854.1| Plasmodium berghei strain ANKA hypothetical pro... 38 4.9
21gb|U88167.2| Caenorhabditis elegans cosmid D2092, complete sequence 38 4.9
22ref|XM_787663.1| PREDICTED: Strongylocentrotus purpuratus simila... 38 4.9
23gb|AC120036.5| Homo sapiens chromosome 8, clone RP11-1134I14, co... 38 4.9
24gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 38 4.9
25gb|AC138681.3| Homo sapiens chromosome 8, clone RP13-41K17, comp... 38 4.9
26ref|NM_208794.1| Eremothecium gossypii ACR038Wp (ACR038W), mRNA 38 4.9
27gb|U03640.1|HSIGLV8F Human clone FL6 Ig lambda light chain V-reg... 38 4.9
28gb|U03636.1|HSIGLV8B Human clone TL6 Ig lambda light chain V-reg... 38 4.9
29gb|AY849331.1| Drosophila americana strain G96-48 suppressor of ... 38 4.9
30gb|AY849330.1| Drosophila americana strain G96-47 suppressor of ... 38 4.9
31gb|AY849329.1| Drosophila americana strain G96-45 suppressor of ... 38 4.9
32gb|AY849328.1| Drosophila americana strain G96-31 suppressor of ... 38 4.9
33gb|AY849327.1| Drosophila americana strain G96-11 suppressor of ... 38 4.9
34gb|U48288.1|RRU48288 Rattus norvegicus A-kinase anchoring protei... 38 4.9

>ref|XM_500389.1| Yarrowia lipolytica CLIB122, YALI0B01540g predicted mRNA
          Length = 210

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 88  actcgtcatcctcgtcatcgtc 109
           ||||||||||||||||||||||
Sbjct: 208 actcgtcatcctcgtcatcgtc 187



to top

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 88     actcgtcatcctcgtcatcgtc 109
              ||||||||||||||||||||||
Sbjct: 245151 actcgtcatcctcgtcatcgtc 245172



to top

>ref|XM_780232.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
            LOC580159 (LOC580159), mRNA
          Length = 1902

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 89   ctcgtcatcctcgtcatcgtc 109
            |||||||||||||||||||||
Sbjct: 1131 ctcgtcatcctcgtcatcgtc 1111



to top

>gb|AC125291.3| Drosophila melanogaster X BAC CH221-17A11 (CHORI Sheared BAC Drosophila
              melanogaster library) complete sequence
          Length = 166613

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 90     tcgtcatcctcgtcatcgtc 109
              ||||||||||||||||||||
Sbjct: 150462 tcgtcatcctcgtcatcgtc 150443



to top

>ref|XM_754221.1| Ustilago maydis 521 hypothetical protein (UM03167.1) partial mRNA
          Length = 2610

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 90   tcgtcatcctcgtcatcgtc 109
            ||||||||||||||||||||
Sbjct: 1748 tcgtcatcctcgtcatcgtc 1729



to top

>ref|XM_754531.1| Ustilago maydis 521 hypothetical protein (UM03477.1) partial mRNA
          Length = 3900

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 90   tcgtcatcctcgtcatcgtc 109
            ||||||||||||||||||||
Sbjct: 1019 tcgtcatcctcgtcatcgtc 1000



to top

>emb|AJ296686.1|PAB296686 Picea abies ATC microsatellite DNA, clone EATC1A02
          Length = 421

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  tcgtcatcctcgtcatcgtc 109
           ||||||||||||||||||||
Sbjct: 191 tcgtcatcctcgtcatcgtc 210



to top

>ref|XM_380961.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG00785.1)
           partial mRNA
          Length = 600

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  tcgtcatcctcgtcatcgtc 109
           ||||||||||||||||||||
Sbjct: 593 tcgtcatcctcgtcatcgtc 574



to top

>emb|AJ890137.1| Murid Herpesvirus 2 r138 gene (partial), r139 gene, r140 gene, r141
            gene and r142 gene (partial)
          Length = 7462

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 90   tcgtcatcctcgtcatcgtc 109
            ||||||||||||||||||||
Sbjct: 3340 tcgtcatcctcgtcatcgtc 3359



to top

>gb|AC023723.4| Drosophila melanogaster X BAC RP98-48E6 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 179363

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 90    tcgtcatcctcgtcatcgtc 109
             ||||||||||||||||||||
Sbjct: 13719 tcgtcatcctcgtcatcgtc 13700



to top

>gb|AC023709.4| Drosophila melanogaster X BAC RP98-10I17 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 163710

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 90     tcgtcatcctcgtcatcgtc 109
              ||||||||||||||||||||
Sbjct: 111766 tcgtcatcctcgtcatcgtc 111747



to top

>gb|AF232689.2| Rat cytomegalovirus Maastricht, complete genome
          Length = 230138

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     tcgtcatcctcgtcatcgtc 109
              ||||||||||||||||||||
Sbjct: 190797 tcgtcatcctcgtcatcgtc 190816



to top

>ref|NM_132413.1| Drosophila melanogaster CG15295-RA (CG15295), mRNA
          Length = 2288

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  tcgtcatcctcgtcatcgtc 109
           ||||||||||||||||||||
Sbjct: 962 tcgtcatcctcgtcatcgtc 943



to top

>gb|AE003451.5| Drosophila melanogaster chromosome X, section 35 of 74 of the complete
              sequence
          Length = 285729

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     tcgtcatcctcgtcatcgtc 109
              ||||||||||||||||||||
Sbjct: 130980 tcgtcatcctcgtcatcgtc 130999



to top

>gb|AY664418.1| Zea mays cultivar Mo17 locus 9008, complete sequence
          Length = 282600

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     tcgtcatcctcgtcatcgtc 109
              ||||||||||||||||||||
Sbjct: 115897 tcgtcatcctcgtcatcgtc 115916



to top

>gb|AY664414.1| Zea mays cultivar B73 locus 9008, complete sequence
          Length = 339089

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     tcgtcatcctcgtcatcgtc 109
              ||||||||||||||||||||
Sbjct: 129620 tcgtcatcctcgtcatcgtc 129639



to top

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 89      ctcgtcatcctcgtcatcg 107
               |||||||||||||||||||
Sbjct: 2138194 ctcgtcatcctcgtcatcg 2138176



to top

>ref|XM_369396.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein
            (MG06068.4) partial mRNA
          Length = 1614

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 89   ctcgtcatcctcgtcatcg 107
            |||||||||||||||||||
Sbjct: 1305 ctcgtcatcctcgtcatcg 1287



to top

>ref|XM_388646.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08470.1)
           partial mRNA
          Length = 1191

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 91  cgtcatcctcgtcatcgtc 109
           |||||||||||||||||||
Sbjct: 182 cgtcatcctcgtcatcgtc 200



to top

>ref|XM_670854.1| Plasmodium berghei strain ANKA hypothetical protein (PB000009.03.0)
           partial mRNA
          Length = 981

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 26  cagactttaacaaaaacgc 44
           |||||||||||||||||||
Sbjct: 931 cagactttaacaaaaacgc 949



to top

>gb|U88167.2| Caenorhabditis elegans cosmid D2092, complete sequence
          Length = 41558

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 82    ctcttcactcgtcatcctc 100
             |||||||||||||||||||
Sbjct: 12228 ctcttcactcgtcatcctc 12246



to top

>ref|XM_787663.1| PREDICTED: Strongylocentrotus purpuratus similar to ZIP4 protein
            (LOC587958), mRNA
          Length = 2654

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 89   ctcgtcatcctcgtcatcg 107
            |||||||||||||||||||
Sbjct: 1948 ctcgtcatcctcgtcatcg 1966



to top

>gb|AC120036.5| Homo sapiens chromosome 8, clone RP11-1134I14, complete sequence
          Length = 177423

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 58     acactggggagatggacac 76
              |||||||||||||||||||
Sbjct: 169156 acactggggagatggacac 169174



to top

>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 88     actcgtcatcctcgtcatc 106
              |||||||||||||||||||
Sbjct: 429998 actcgtcatcctcgtcatc 429980



to top

>gb|AC138681.3| Homo sapiens chromosome 8, clone RP13-41K17, complete sequence
          Length = 28800

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 58    acactggggagatggacac 76
             |||||||||||||||||||
Sbjct: 16177 acactggggagatggacac 16159



to top

>ref|NM_208794.1| Eremothecium gossypii ACR038Wp (ACR038W), mRNA
          Length = 2025

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 88   actcgtcatcctcgtcatc 106
            |||||||||||||||||||
Sbjct: 1993 actcgtcatcctcgtcatc 1975



to top

>gb|U03640.1|HSIGLV8F Human clone FL6 Ig lambda light chain V-region germline
           (Vlambda-VIII.2) gene, partial cds
          Length = 775

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 58  acactggggagatggacac 76
           |||||||||||||||||||
Sbjct: 753 acactggggagatggacac 735



to top

>gb|U03636.1|HSIGLV8B Human clone TL6 Ig lambda light chain V-region germline
           (Vlambda-VIII.2) gene, partial cds
          Length = 775

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 58  acactggggagatggacac 76
           |||||||||||||||||||
Sbjct: 753 acactggggagatggacac 735



to top

>gb|AY849331.1| Drosophila americana strain G96-48 suppressor of Hairy wing
           (su(Hw)) gene, partial cds
          Length = 1497

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 91  cgtcatcctcgtcatcgtc 109
           |||||||||||||||||||
Sbjct: 118 cgtcatcctcgtcatcgtc 100



to top

>gb|AY849330.1| Drosophila americana strain G96-47 suppressor of Hairy wing
           (su(Hw)) gene, partial cds
          Length = 1515

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 91  cgtcatcctcgtcatcgtc 109
           |||||||||||||||||||
Sbjct: 118 cgtcatcctcgtcatcgtc 100



to top

>gb|AY849329.1| Drosophila americana strain G96-45 suppressor of Hairy wing
           (su(Hw)) gene, partial cds
          Length = 1515

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 91  cgtcatcctcgtcatcgtc 109
           |||||||||||||||||||
Sbjct: 118 cgtcatcctcgtcatcgtc 100



to top

>gb|AY849328.1| Drosophila americana strain G96-31 suppressor of Hairy wing
           (su(Hw)) gene, partial cds
          Length = 1515

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 91  cgtcatcctcgtcatcgtc 109
           |||||||||||||||||||
Sbjct: 118 cgtcatcctcgtcatcgtc 100



to top

>gb|AY849327.1| Drosophila americana strain G96-11 suppressor of Hairy wing
           (su(Hw)) gene, partial cds
          Length = 1516

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 91  cgtcatcctcgtcatcgtc 109
           |||||||||||||||||||
Sbjct: 118 cgtcatcctcgtcatcgtc 100



to top

>gb|U48288.1|RRU48288 Rattus norvegicus A-kinase anchoring protein AKAP 220 mRNA, complete
            cds
          Length = 9748

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 59   cactggggagatggacacg 77
            |||||||||||||||||||
Sbjct: 1986 cactggggagatggacacg 2004


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 603,557
Number of Sequences: 3902068
Number of extensions: 603557
Number of successful extensions: 42234
Number of sequences better than 10.0: 34
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42124
Number of HSP's gapped (non-prelim): 110
length of query: 109
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 88
effective length of database: 17,151,101,840
effective search space: 1509296961920
effective search space used: 1509296961920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top