| Clone Name | rbags12l21 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC084677.1|CBRG47L22 Caenorhabditis briggsae cosmid G47L22, complete sequence Length = 43559 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 accatctggacaacccggacat 286 |||||||||||||||||||||| Sbjct: 24273 accatctggacaacccggacat 24252 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 accatctggacaacccggacat 286 |||||||||||||||||||||| Sbjct: 20072 accatctggacaacccggacat 20051
>emb|AL354661.14| Human DNA sequence from clone RP11-386D8 on chromosome 9 Contains the gene for a novel olfactory (seven transmembrane helix) receptor and the 3' end of the gene for a novel protein (including KIAA0368), complete sequence Length = 138069 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 125 caagaagacagaaaacaacag 145 ||||||||||||||||||||| Sbjct: 115615 caagaagacagaaaacaacag 115635
>gb|AC092593.2| Homo sapiens BAC clone RP11-68D16 from 4, complete sequence Length = 128255 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 32 aggattttaccttccttttta 52 ||||||||||||||||||||| Sbjct: 36656 aggattttaccttccttttta 36676
>gb|AC108425.9| Mus musculus chromosome 1, clone RP23-119I1, complete sequence Length = 187230 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 tacaagaagacagaaaacaa 142 |||||||||||||||||||| Sbjct: 140986 tacaagaagacagaaaacaa 140967
>ref|XM_629255.1| Dictyostelium discoideum hypothetical protein (DDB0219833), partial mRNA Length = 2118 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 150 ttcacattttatagttttat 169 |||||||||||||||||||| Sbjct: 1128 ttcacattttatagttttat 1109
>gb|AC124440.3| Mus musculus BAC clone RP24-176E5 from chromosome 3, complete sequence Length = 173198 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 118 attgctacaagaagacagaa 137 |||||||||||||||||||| Sbjct: 83783 attgctacaagaagacagaa 83802
>emb|AL359770.12| Human DNA sequence from clone RP11-286B9 on chromosome 13, complete sequence Length = 104638 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 attttaccttcctttttatg 54 |||||||||||||||||||| Sbjct: 87681 attttaccttcctttttatg 87662
>emb|AL133284.13| Human DNA sequence from clone RP11-67K19 on chromosome 9q33.1-34.11 Contains part of the ASTN2 gene for astrotactin 2 (KIAA0634), the TRIM32 gene for tripartite motif-containing 32, and a novel gene, complete sequence Length = 155466 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 116 atattgctacaagaagacagaaaa 139 |||||| ||||||||||||||||| Sbjct: 44585 atattgatacaagaagacagaaaa 44608
>gb|AC158578.5| Mus musculus chromosome 1, clone RP24-370C23, complete sequence Length = 165463 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 tacaagaagacagaaaacaa 142 |||||||||||||||||||| Sbjct: 128741 tacaagaagacagaaaacaa 128760
>gb|AC007669.6|AC007669 Drosophila melanogaster, chromosome 3R, region 88A-88A, BAC clone BACR25B05, complete sequence Length = 181794 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 acattttatagttttataca 172 |||||||||||||||||||| Sbjct: 93588 acattttatagttttataca 93569
>gb|AC020973.3|AC020973 Mus musculus chromosome 18 clone RPCI-23_72C14, complete sequence Length = 213062 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 attttaccttcctttttatg 54 |||||||||||||||||||| Sbjct: 75641 attttaccttcctttttatg 75660
>gb|AC020972.3|AC020972 Mus musculus chromosome 18 clone RP23-6P18, complete sequence Length = 218100 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 attttaccttcctttttatg 54 |||||||||||||||||||| Sbjct: 30984 attttaccttcctttttatg 30965
>gb|AE003702.3| Drosophila melanogaster chromosome 3R, section 40 of 118 of the complete sequence Length = 227413 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 acattttatagttttataca 172 |||||||||||||||||||| Sbjct: 114035 acattttatagttttataca 114016
>emb|CR848047.6| Zebrafish DNA sequence from clone DKEY-235H8 in linkage group 16, complete sequence Length = 166830 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 150 ttcacattttatagttttat 169 |||||||||||||||||||| Sbjct: 55362 ttcacattttatagttttat 55343 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,668,372 Number of Sequences: 3902068 Number of extensions: 3668372 Number of successful extensions: 86532 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 86508 Number of HSP's gapped (non-prelim): 24 length of query: 402 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 380 effective length of database: 17,147,199,772 effective search space: 6515935913360 effective search space used: 6515935913360 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)