ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags13a17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK120211.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 5e-54
2gb|AY105786.1| Zea mays PCO072281 mRNA sequence 139 1e-29
3gb|AC104283.2| Oryza sativa (japonica cultivar-group) chromosome... 127 5e-26
4dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 127 5e-26
5gb|BT013516.1| Lycopersicon esculentum clone 132233F, mRNA sequence 48 0.039
6gb|AC092765.2| Homo sapiens chromosome 1 clone RP11-400N13, comp... 42 2.4
7gb|AC022867.10| Homo sapiens chromosome 8, clone RP11-367C12, co... 42 2.4
8gb|AY092028.1| Mus musculus DAP kinase-related apoptotic kinase ... 40 9.5
9gb|AC150896.6| Mus musculus BAC clone RP23-414N3 from chromosome... 40 9.5
10emb|BX323049.20| Zebrafish DNA sequence from clone DKEY-30L22 in... 40 9.5
11gb|AC162933.2| Mus musculus BAC clone RP23-148J22 from chromosom... 40 9.5
12emb|AL353607.20| Human DNA sequence from clone RP11-652B19 on ch... 40 9.5
13ref|XM_781706.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 9.5
14emb|BX572097.1| Prochlorococcus marinus MIT9313 complete genome;... 40 9.5
15gb|AC110792.3| Homo sapiens BAC clone RP11-571I18 from 4, comple... 40 9.5
16ref|NM_133810.2| Mus musculus serine/threonine kinase 17b (apopt... 40 9.5
17dbj|AK153108.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 9.5
18dbj|AK165291.1| Mus musculus 6 days neonate spleen cDNA, RIKEN f... 40 9.5
19dbj|AK035693.1| Mus musculus adult male urinary bladder cDNA, RI... 40 9.5
20dbj|AK076932.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 9.5
21dbj|AK083332.1| Mus musculus 2 days neonate thymus thymic cells ... 40 9.5
22dbj|AK041139.1| Mus musculus adult male aorta and vein cDNA, RIK... 40 9.5
23ref|NM_133392.1| Rattus norvegicus serine/threonine kinase 17b (... 40 9.5
24gb|AC167467.1| Mus musculus BAC clone RP23-158E17 from chromosom... 40 9.5
25emb|CT025545.28| Mouse DNA sequence from clone RP24-88C18 on chr... 40 9.5
26emb|BX005088.4| Zebrafish DNA sequence from clone CH211-160E15 i... 40 9.5
27gb|AC138328.3| Mus musculus BAC clone RP23-378F20 from 1, comple... 40 9.5
28gb|BC006579.1| Mus musculus serine/threonine kinase 17b (apoptos... 40 9.5
29emb|AL392024.3|CNS06C8K Human chromosome 14 DNA sequence BAC R-1... 40 9.5
30dbj|AB070349.1| Rattus norvegicus DRAK2 mRNA for death-associate... 40 9.5

>dbj|AK120211.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013039A16, full
            insert sequence
          Length = 3402

 Score =  220 bits (111), Expect = 5e-54
 Identities = 218/252 (86%), Gaps = 5/252 (1%)
 Strand = Plus / Minus

                                                                        
Query: 441  gtataatgtatgtaccttgcaactggcaaagaaatttctgacgagaaacatacagggtca 500
            |||||||||||||||||||  ||||| ||||| ||||| | | ||||||||   || |||
Sbjct: 2876 gtataatgtatgtaccttgtgactggtaaagagatttccgtcaagaaacat---ggatca 2820

                                                                        
Query: 501  agaagatggagggggttggc--atgtatcatatgtaagcaagggagttcctgtcgccagc 558
            ||||| |||||| ||||     ||||||||||| |||||||| || || ||||| | |||
Sbjct: 2819 agaagctggaggtggttcaacgatgtatcatatataagcaagagaatttctgtcactagc 2760

                                                                        
Query: 559  agaatgcggccgtcccctagttggtgtaggtggccgttgtatgttaagttcctgcatcca 618
            ||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2759 agactgtggccgtcctctagttggtgtaggtggccgttgtatgttaagttcctgcatcca 2700

                                                                        
Query: 619  tgtggcatccatggcacgctcaggggatgactcaggagaattaacaggtggtggaagtgg 678
            |||||| ||||||||||| || ||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 2699 tgtggcgtccatggcacgttctggggaagactctggagaattaactggtggaggaagtgg 2640

                        
Query: 679  atgaattaactt 690
            ||||||||||||
Sbjct: 2639 atgaattaactt 2628



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 31/32 (96%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                            
Query: 108  cttgtatagctgcgctgtgcaa-gcagcgtcc 138
            |||||||||||||||||||||| |||||||||
Sbjct: 3258 cttgtatagctgcgctgtgcaatgcagcgtcc 3227



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 220  acactacagttacaggtaaaccac 243
            |||||| |||||||||||||||||
Sbjct: 3157 acactaaagttacaggtaaaccac 3134



to top

>gb|AY105786.1| Zea mays PCO072281 mRNA sequence
          Length = 1610

 Score =  139 bits (70), Expect = 1e-29
 Identities = 144/168 (85%), Gaps = 3/168 (1%)
 Strand = Plus / Minus

                                                                        
Query: 523  gtatcatatgtaagcaagggagttcctgtcgccagcagaatgcggccgtcccctagttgg 582
            |||||||||||||||||| || ||||| || || ||||  || ||||| || || |||||
Sbjct: 1021 gtatcatatgtaagcaagagaattcctatcaccggcagcttgtggccgccctctggttgg 962

                                                                        
Query: 583  tgtaggtggccgttgtatgttaagttcctgcatccatgtggcatccatggcacgctcagg 642
             ||||||||||| || |||||||| |||||||||||||||||||||    |||| || ||
Sbjct: 961  agtaggtggccgctgaatgttaagctcctgcatccatgtggcatcc---ccacgttcggg 905

                                                            
Query: 643  ggatgactcaggagaattaacaggtggtggaagtggatgaattaactt 690
            ||| |||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 904  ggaggactcaggtgaattaacaggaggtggaagtggatgaattaactt 857



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 449  tatgtaccttgcaactggcaaagaaatttctga 481
            ||||||||||| |||||| ||||||||||||||
Sbjct: 1101 tatgtaccttgaaactggtaaagaaatttctga 1069



to top

>gb|AC104283.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1607_F09,
             complete sequence
          Length = 95755

 Score =  127 bits (64), Expect = 5e-26
 Identities = 150/177 (84%), Gaps = 5/177 (2%)
 Strand = Plus / Minus

                                                                         
Query: 441   gtataatgtatgtaccttgcaactggcaaagaaatttctgacgagaaacatacagggtca 500
             |||||||||||||||||||  ||||| ||||| ||||| | | ||||||||   || |||
Sbjct: 79188 gtataatgtatgtaccttgtgactggtaaagagatttccgtcaagaaacat---ggatca 79132

                                                                         
Query: 501   agaagatggagggggttggc--atgtatcatatgtaagcaagggagttcctgtcgccagc 558
             ||||| |||||| ||||     ||||||||||| |||||||| || || ||||| | |||
Sbjct: 79131 agaagctggaggtggttcaacgatgtatcatatataagcaagagaatttctgtcactagc 79072

                                                                      
Query: 559   agaatgcggccgtcccctagttggtgtaggtggccgttgtatgttaagttcctgcat 615
             ||| || |||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 79071 agactgtggccgtcctctagttggtgtaggtggccgttgtatgttaagttcctgcat 79015



 Score =  107 bits (54), Expect = 5e-20
 Identities = 75/82 (91%)
 Strand = Plus / Minus

                                                                         
Query: 609   cctgcatccatgtggcatccatggcacgctcaggggatgactcaggagaattaacaggtg 668
             |||||||||||||||| ||||||||||| || ||||| ||||| ||||||||||| ||||
Sbjct: 78838 cctgcatccatgtggcgtccatggcacgttctggggaagactctggagaattaactggtg 78779

                                   
Query: 669   gtggaagtggatgaattaactt 690
             | ||||||||||||||||||||
Sbjct: 78778 gaggaagtggatgaattaactt 78757



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 31/32 (96%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                             
Query: 108   cttgtatagctgcgctgtgc-aagcagcgtcc 138
             |||||||||||||||||||| |||||||||||
Sbjct: 79570 cttgtatagctgcgctgtgcaaagcagcgtcc 79539



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 220   acactacagttacaggtaaaccac 243
             |||||| |||||||||||||||||
Sbjct: 79469 acactaaagttacaggtaaaccac 79446



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score =  127 bits (64), Expect = 5e-26
 Identities = 150/177 (84%), Gaps = 5/177 (2%)
 Strand = Plus / Minus

                                                                           
Query: 441     gtataatgtatgtaccttgcaactggcaaagaaatttctgacgagaaacatacagggtca 500
               |||||||||||||||||||  ||||| ||||| ||||| | | ||||||||   || |||
Sbjct: 2512166 gtataatgtatgtaccttgtgactggtaaagagatttccgtcaagaaacat---ggatca 2512110

                                                                           
Query: 501     agaagatggagggggttggc--atgtatcatatgtaagcaagggagttcctgtcgccagc 558
               ||||| |||||| ||||     ||||||||||| |||||||| || || ||||| | |||
Sbjct: 2512109 agaagctggaggtggttcaacgatgtatcatatataagcaagagaatttctgtcactagc 2512050

                                                                        
Query: 559     agaatgcggccgtcccctagttggtgtaggtggccgttgtatgttaagttcctgcat 615
               ||| || |||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 2512049 agactgtggccgtcctctagttggtgtaggtggccgttgtatgttaagttcctgcat 2511993



 Score =  107 bits (54), Expect = 5e-20
 Identities = 75/82 (91%)
 Strand = Plus / Minus

                                                                           
Query: 609     cctgcatccatgtggcatccatggcacgctcaggggatgactcaggagaattaacaggtg 668
               |||||||||||||||| ||||||||||| || ||||| ||||| ||||||||||| ||||
Sbjct: 2511816 cctgcatccatgtggcgtccatggcacgttctggggaagactctggagaattaactggtg 2511757

                                     
Query: 669     gtggaagtggatgaattaactt 690
               | ||||||||||||||||||||
Sbjct: 2511756 gaggaagtggatgaattaactt 2511735



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 31/32 (96%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                               
Query: 108     cttgtatagctgcgctgtgc-aagcagcgtcc 138
               |||||||||||||||||||| |||||||||||
Sbjct: 2512548 cttgtatagctgcgctgtgcaaagcagcgtcc 2512517



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 220     acactacagttacaggtaaaccac 243
               |||||| |||||||||||||||||
Sbjct: 2512447 acactaaagttacaggtaaaccac 2512424



to top

>gb|BT013516.1| Lycopersicon esculentum clone 132233F, mRNA sequence
          Length = 3104

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                        
Query: 572  cccctagttggtgtaggtggccgttgtatgttaagttcctgcatccatgtggcatccatg 631
            |||||||| || ||||| || | ||| ||||| |||||||||||||| ||| ||||||||
Sbjct: 2707 cccctagtaggagtaggcggtctttgaatgttgagttcctgcatccaagtgtcatccatg 2648



to top

>gb|AC092765.2| Homo sapiens chromosome 1 clone RP11-400N13, complete sequence
          Length = 188261

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 636    gctcaggggatgactcaggag 656
              |||||||||||||||||||||
Sbjct: 115677 gctcaggggatgactcaggag 115697



to top

>gb|AC022867.10| Homo sapiens chromosome 8, clone RP11-367C12, complete sequence
          Length = 196931

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 301   ccttcagaactgttatgtatg 321
             |||||||||||||||||||||
Sbjct: 60728 ccttcagaactgttatgtatg 60708



to top

>gb|AY092028.1| Mus musculus DAP kinase-related apoptotic kinase 2 (Drak2) mRNA,
           complete cds
          Length = 3251

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 aatgtctcgaaaaattggga 407
           ||||||||||||||||||||
Sbjct: 679 aatgtctcgaaaaattggga 698



to top

>gb|AC150896.6| Mus musculus BAC clone RP23-414N3 from chromosome 1, complete sequence
          Length = 207503

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 388    aatgtctcgaaaaattggga 407
              ||||||||||||||||||||
Sbjct: 207429 aatgtctcgaaaaattggga 207448



to top

>emb|BX323049.20| Zebrafish DNA sequence from clone DKEY-30L22 in linkage group 9, complete
              sequence
          Length = 214040

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 290    ttccattcctcccttcagaa 309
              ||||||||||||||||||||
Sbjct: 117229 ttccattcctcccttcagaa 117210



to top

>gb|AC162933.2| Mus musculus BAC clone RP23-148J22 from chromosome 12, complete sequence
          Length = 236972

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 375    ttaactactgggcaatgtct 394
              ||||||||||||||||||||
Sbjct: 165759 ttaactactgggcaatgtct 165778



to top

>emb|AL353607.20| Human DNA sequence from clone RP11-652B19 on chromosome 9 Contains part
             of the PCSK5 gene for proprotein convertase
             subtilisin/kexin type 5, complete sequence
          Length = 141170

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    acattcctataacaaattta 35
             ||||||||||||||||||||
Sbjct: 53201 acattcctataacaaattta 53220



to top

>ref|XM_781706.1| PREDICTED: Strongylocentrotus purpuratus similar to zinc finger, FYVE
            domain containing 1 isoform 1 (LOC581719), mRNA
          Length = 2598

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 612  gcatccatgtggcatccatg 631
            ||||||||||||||||||||
Sbjct: 1328 gcatccatgtggcatccatg 1309



to top

>emb|BX572097.1| Prochlorococcus marinus MIT9313 complete genome; segment 3/7
          Length = 349823

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 649    ctcaggagaattaacaggtg 668
              ||||||||||||||||||||
Sbjct: 152742 ctcaggagaattaacaggtg 152723



to top

>gb|AC110792.3| Homo sapiens BAC clone RP11-571I18 from 4, complete sequence
          Length = 170202

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     ttgtaaacattcctataaca 29
              ||||||||||||||||||||
Sbjct: 139943 ttgtaaacattcctataaca 139962



to top

>ref|NM_133810.2| Mus musculus serine/threonine kinase 17b (apoptosis-inducing)
           (Stk17b), mRNA
          Length = 3251

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 aatgtctcgaaaaattggga 407
           ||||||||||||||||||||
Sbjct: 679 aatgtctcgaaaaattggga 698



to top

>dbj|AK153108.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830123D22
           product:serine/threonine kinase 17b
           (apoptosis-inducing), full insert sequence
          Length = 2618

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 aatgtctcgaaaaattggga 407
           ||||||||||||||||||||
Sbjct: 670 aatgtctcgaaaaattggga 689



to top

>dbj|AK165291.1| Mus musculus 6 days neonate spleen cDNA, RIKEN full-length enriched
           library, clone:F430010E05 product:serine/threonine
           kinase 17b (apoptosis-inducing), full insert sequence
          Length = 2629

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 aatgtctcgaaaaattggga 407
           ||||||||||||||||||||
Sbjct: 666 aatgtctcgaaaaattggga 685



to top

>dbj|AK035693.1| Mus musculus adult male urinary bladder cDNA, RIKEN full-length
           enriched library, clone:9530091H16
           product:serine/threonine kinase 17b
           (apoptosis-inducing), full insert sequence
          Length = 2492

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 aatgtctcgaaaaattggga 407
           ||||||||||||||||||||
Sbjct: 694 aatgtctcgaaaaattggga 713



to top

>dbj|AK076932.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930558I12 product:serine/threonine
           kinase 17b (apoptosis-inducing), full insert sequence
          Length = 1434

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 aatgtctcgaaaaattggga 407
           ||||||||||||||||||||
Sbjct: 693 aatgtctcgaaaaattggga 712



to top

>dbj|AK083332.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:C920007K17
           product:serine/threonine kinase 17b
           (apoptosis-inducing), full insert sequence
          Length = 1581

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 aatgtctcgaaaaattggga 407
           ||||||||||||||||||||
Sbjct: 695 aatgtctcgaaaaattggga 714



to top

>dbj|AK041139.1| Mus musculus adult male aorta and vein cDNA, RIKEN full-length
           enriched library, clone:A530085G23
           product:serine/threonine kinase 17b
           (apoptosis-inducing), full insert sequence
          Length = 1745

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 aatgtctcgaaaaattggga 407
           ||||||||||||||||||||
Sbjct: 61  aatgtctcgaaaaattggga 80



to top

>ref|NM_133392.1| Rattus norvegicus serine/threonine kinase 17b (apoptosis-inducing)
           (Stk17b), mRNA
          Length = 2159

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 aatgtctcgaaaaattggga 407
           ||||||||||||||||||||
Sbjct: 710 aatgtctcgaaaaattggga 729



to top

>gb|AC167467.1| Mus musculus BAC clone RP23-158E17 from chromosome 9, complete sequence
          Length = 212426

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ttaatttattgtaaacattc 21
              ||||||||||||||||||||
Sbjct: 153304 ttaatttattgtaaacattc 153323



to top

>emb|CT025545.28| Mouse DNA sequence from clone RP24-88C18 on chromosome 12, complete
             sequence
          Length = 266295

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 375   ttaactactgggcaatgtct 394
             ||||||||||||||||||||
Sbjct: 42884 ttaactactgggcaatgtct 42865



to top

>emb|BX005088.4| Zebrafish DNA sequence from clone CH211-160E15 in linkage group 9,
              complete sequence
          Length = 193489

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 290    ttccattcctcccttcagaa 309
              ||||||||||||||||||||
Sbjct: 129235 ttccattcctcccttcagaa 129254



to top

>gb|AC138328.3| Mus musculus BAC clone RP23-378F20 from 1, complete sequence
          Length = 153109

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 388   aatgtctcgaaaaattggga 407
             ||||||||||||||||||||
Sbjct: 23292 aatgtctcgaaaaattggga 23311



to top

>gb|BC006579.1| Mus musculus serine/threonine kinase 17b (apoptosis-inducing), mRNA
           (cDNA clone MGC:6721 IMAGE:3586767), complete cds
          Length = 2676

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 aatgtctcgaaaaattggga 407
           ||||||||||||||||||||
Sbjct: 681 aatgtctcgaaaaattggga 700



to top

>emb|AL392024.3|CNS06C8K Human chromosome 14 DNA sequence BAC R-182E21 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 146235

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 375    ttaactactgggcaatgtct 394
              ||||||||||||||||||||
Sbjct: 132392 ttaactactgggcaatgtct 132411



to top

>dbj|AB070349.1| Rattus norvegicus DRAK2 mRNA for death-associated protein
           kinase-related apoptosis inducing protein kinase,
           complete cds
          Length = 2159

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 aatgtctcgaaaaattggga 407
           ||||||||||||||||||||
Sbjct: 710 aatgtctcgaaaaattggga 729


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,782,939
Number of Sequences: 3902068
Number of extensions: 5782939
Number of successful extensions: 105084
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 104977
Number of HSP's gapped (non-prelim): 106
length of query: 695
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 672
effective length of database: 17,143,297,704
effective search space: 11520296057088
effective search space used: 11520296057088
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top