| Clone Name | rbags13a14 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC121593.3| Mus musculus BAC clone RP23-292N18 from 6, complete sequence Length = 179881 Score = 38.2 bits (19), Expect = 0.73 Identities = 21/22 (95%) Strand = Plus / Minus Query: 9 gtgcaccaccacatncacatgc 30 |||||||||||||| ||||||| Sbjct: 12992 gtgcaccaccacatacacatgc 12971
>gb|AC164642.3| Mus musculus BAC clone RP23-248L4 from chromosome 6, complete sequence Length = 212166 Score = 38.2 bits (19), Expect = 0.73 Identities = 21/22 (95%) Strand = Plus / Plus Query: 9 gtgcaccaccacatncacatgc 30 |||||||||||||| ||||||| Sbjct: 487 gtgcaccaccacatacacatgc 508
>ref|XM_993739.1| PREDICTED: Mus musculus cDNA sequence AK129128 (AK129128), mRNA Length = 5001 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 aactggtgcaccaccaca 21 |||||||||||||||||| Sbjct: 4824 aactggtgcaccaccaca 4807
>ref|XM_922094.2| PREDICTED: Mus musculus cDNA sequence AK129128, transcript variant 5 (AK129128), mRNA Length = 5781 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 aactggtgcaccaccaca 21 |||||||||||||||||| Sbjct: 5204 aactggtgcaccaccaca 5187
>ref|XM_898433.2| PREDICTED: Mus musculus cDNA sequence AK129128, transcript variant 2 (AK129128), mRNA Length = 5381 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 aactggtgcaccaccaca 21 |||||||||||||||||| Sbjct: 5204 aactggtgcaccaccaca 5187
>dbj|AK085121.1| Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430040E23 product:unclassifiable, full insert sequence Length = 1485 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 aactggtgcaccaccaca 21 |||||||||||||||||| Sbjct: 1374 aactggtgcaccaccaca 1357
>gb|AC154226.3| Mus musculus BAC clone RP24-353J14 from chromosome 13, complete sequence Length = 196991 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 aactggtgcaccaccaca 21 |||||||||||||||||| Sbjct: 20631 aactggtgcaccaccaca 20614
>gb|AC154355.1| Mus musculus BAC clone RP23-220N4 from 13, complete sequence Length = 168447 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 aactggtgcaccaccaca 21 |||||||||||||||||| Sbjct: 63996 aactggtgcaccaccaca 63979
>emb|CT010470.9| Mouse DNA sequence from clone RP23-313D12 on chromosome 13, complete sequence Length = 199355 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 aactggtgcaccaccaca 21 |||||||||||||||||| Sbjct: 122452 aactggtgcaccaccaca 122435 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 271,316 Number of Sequences: 3902068 Number of extensions: 271316 Number of successful extensions: 96970 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 96956 Number of HSP's gapped (non-prelim): 14 length of query: 33 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 13 effective length of database: 17,155,003,908 effective search space: 223015050804 effective search space used: 223015050804 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)