ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags12k16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_476842.1| Oryza sativa (japonica cultivar-group), mRNA 54 5e-04
2dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 54 5e-04
3dbj|AP003826.4| Oryza sativa (japonica cultivar-group) genomic D... 54 5e-04
4dbj|AK101824.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 5e-04
5gb|AC160410.3| Mus musculus 10 BAC RP24-356L3 (Roswell Park Canc... 52 0.002
6gb|AC170188.2| Mus musculus BAC clone RP24-195M20 from chromosom... 50 0.008
7gb|AC132347.4| Mus musculus BAC clone RP24-186F6 from chromosome... 50 0.008
8emb|BX088589.14| Zebrafish DNA sequence from clone DKEY-27E7 in ... 50 0.008
9dbj|AK109075.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.008
10gb|AC158938.13| Mus musculus chromosome 3, clone RP23-304F19, co... 50 0.008
11gb|DQ098931.1| Giardia intestinalis clone EJ7728 subtelomeric re... 48 0.030
12gb|DQ098930.1| Giardia intestinalis clone NJ1197 subtelomeric re... 48 0.030
13gb|DQ098929.1| Giardia intestinalis clone NG0253 subtelomeric re... 48 0.030
14gb|DQ098928.1| Giardia intestinalis clone NF0311 subtelomeric re... 48 0.030
15gb|DQ098927.1| Giardia intestinalis clone KJ1356 subtelomeric re... 48 0.030
16gb|DQ098926.1| Giardia intestinalis clone LJ0347 subtelomeric re... 48 0.030
17gb|DQ098925.1| Giardia intestinalis clone EJ2414 subtelomeric re... 48 0.030
18gb|DQ098924.1| Giardia intestinalis clone EJ1336 subtelomeric re... 48 0.030
19gb|DQ098923.1| Giardia intestinalis clone KI1170 subtelomeric re... 48 0.030
20gb|DQ098922.1| Giardia intestinalis clone EJ6107 subtelomeric re... 48 0.030
21gb|DQ098920.1| Giardia intestinalis clone AJ1354 subtelomeric re... 48 0.030
22gb|AC099707.14| Mus musculus chromosome 1, clone RP23-329C7, com... 48 0.030
23gb|AC131695.4| Mus musculus BAC clone RP23-396F8 from chromosome... 48 0.030
24gb|AC158349.5| Mus musculus chromosome 8, clone RP24-229D22, com... 48 0.030
25gb|AC044864.6| Mus musculus chromosome 3, clone RP23-168E14, com... 48 0.030
26gb|AC137525.3| Mus musculus BAC clone RP23-68H24 from chromosome... 48 0.030
27gb|AC124517.4| Mus musculus BAC clone RP23-387K15 from chromosom... 48 0.030
28emb|CT025605.11| Mouse DNA sequence from clone RP23-259D11 on ch... 48 0.030
29gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosom... 48 0.030
30gb|AC116051.4| Mus musculus BAC clone RP23-4L11 from 3, complete... 48 0.030
31gb|AC108430.11| Mus musculus chromosome 14, clone RP23-166L19, c... 48 0.030
32gb|AC131390.3| Homo sapiens chromosome 16 clone RP11-349E19, com... 48 0.030
33gb|DQ100078.1| Giardia intestinalis clone KJ2306 retrotransposon... 48 0.030
34gb|DQ100077.1| Giardia intestinalis clone NJ3761 retrotransposon... 48 0.030
35gb|AC161585.2| Mus musculus BAC clone RP24-506J9 from chromosome... 48 0.030
36emb|AL365361.12| Human DNA sequence from clone RP11-284N8 on chr... 48 0.030
37emb|AL035405.13|HS21O18 Human DNA sequence from clone RP1-21O18 ... 48 0.030
38emb|AL035671.5|HS420J14 Human DNA sequence from clone RP3-420J14... 48 0.030
39gb|AC160113.2| Mus musculus BAC clone RP24-84O12 from chromosome... 48 0.030
40gb|AC124591.4| Mus musculus BAC clone RP23-136G17 from chromosom... 48 0.030
41gb|AC023150.5| Homo sapiens BAC clone RP11-709L9 from 4, complet... 48 0.030
42gb|AC159378.8| Mus musculus 10 BAC RP23-199N18 (Roswell Park Can... 48 0.030
43gb|AC157943.2| Mus musculus BAC clone RP23-467N13 from chromosom... 48 0.030
44gb|AC159881.2| Mus musculus BAC clone RP24-493B12 from chromosom... 48 0.030
45gb|AC090954.3| Homo sapiens chromosome 3 clone RP11-616M11 map 3... 48 0.030
46gb|AC022379.2|AC022379 Homo sapiens chromosome 3 clone 996C6 map... 48 0.030
47gb|AC159334.9| Mus musculus 10 BAC RP24-369D19 (Roswell Park Can... 48 0.030
48gb|AC023471.4|AC023471 Homo sapiens chromosome 3 clone RP11-126L... 48 0.030
49gb|AC006994.4| Homo sapiens BAC clone RP11-396J8 from 2, complet... 48 0.030
50gb|AC017084.8| Homo sapiens BAC clone RP11-480F1 from 2, complet... 48 0.030
51gb|AC095350.8| Homo sapiens 12 BAC RP11-662M24 (Roswell Park Can... 48 0.030
52gb|AC090949.2| Homo sapiens chromosome 3 clone RP11-421B21 map 3... 48 0.030
53gb|AC102761.12| Mus musculus chromosome 8, clone RP24-227E21, co... 48 0.030
54gb|AC147637.3| Mus musculus BAC clone RP23-205M20 from 9, comple... 48 0.030
55gb|AC126931.4| Mus musculus BAC clone RP23-389M9 from 9, complet... 48 0.030
56emb|CT025537.7| Mouse DNA sequence from clone RP23-454O17 on chr... 48 0.030
57gb|AC114897.43| Mus musculus strain C57BL/6J clone rp23-158e11 m... 48 0.030
58gb|AC155652.25| Mus musculus 6 BAC RP24-480I7 (Roswell Park Canc... 48 0.030
59emb|AL845325.10| Mouse DNA sequence from clone RP23-32O9 on chro... 48 0.030
60emb|AL929320.7| Mouse DNA sequence from clone RP24-160E2 on chro... 48 0.030
61emb|AL929122.8| Mouse DNA sequence from clone RP23-174L3 on chro... 48 0.030
62gb|AC117789.17| Mus musculus chromosome 1, clone RP24-548D18, co... 48 0.030
63gb|AC027128.5| Homo sapiens chromosome 3 clone RP11-627C1 map 3p... 48 0.030
64gb|M73428.1|GIARGSMTEL Giardia lamblia telomeric repeat region a... 48 0.030
65gb|M73429.1|GIARGBM Giardia lamblia telomeric repeat region adja... 48 0.030
66gb|AC128571.4| Rattus norvegicus 6 BAC CH230-424O13 (Children's ... 46 0.12
67emb|AL590607.1|SPCPB1C11 S.pombe chromosome III BAC pB1C11 46 0.12
68emb|AJ271736.1|HSA271736 Homo sapiens Xq pseudoautosomal region;... 46 0.12
69emb|CR382344.9| Zebrafish DNA sequence from clone DKEY-150D12 in... 46 0.12
70dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 46 0.12
71emb|BX465187.7| Zebrafish DNA sequence from clone DKEYP-6C7 in l... 46 0.12
72gb|M57752.1|HUMTARSTB3 Human telomere associated repeat sequence... 46 0.12
73gb|AY731363.1| Zea mays cultivar F2834HT promoter region (whp1) ... 44 0.47
74gb|AY731362.1| Zea mays cultivar FI137TN promoter region (whp1) ... 44 0.47
75gb|AY731361.1| Zea mays cultivar KUI43 promoter region (whp1) ge... 44 0.47
76gb|AY731358.1| Zea mays cultivar TX601 promoter region (whp1) ge... 44 0.47
77gb|AY731357.1| Zea mays cultivar SC213R promoter region (whp1) g... 44 0.47
78gb|AY731356.1| Zea mays cultivar Ci187-2 promoter region (whp1) ... 44 0.47
79gb|AY731355.1| Zea mays cultivar CML247 promoter region (whp1) g... 44 0.47
80gb|AY731354.1| Zea mays cultivar CML91 promoter region (whp1) ge... 44 0.47
81gb|AY731351.1| Zea mays cultivar SG18 promoter region (whp1) gen... 44 0.47
82gb|AY731350.1| Zea mays cultivar SC55 promoter region (whp1) gen... 44 0.47
83gb|AY731348.1| Zea mays cultivar MS153 promoter region (whp1) ge... 44 0.47
84gb|AY731347.1| Zea mays cultivar KUI11 promoter region (whp1) ge... 44 0.47
85gb|AY731346.1| Zea mays cultivar H99 promoter region (whp1) gene... 44 0.47
86gb|AY731345.1| Zea mays cultivar F7 promoter region (whp1) gene,... 44 0.47
87gb|AY731344.1| Zea mays cultivar T232 promoter region (whp1) gen... 44 0.47
88gb|AY731340.1| Zea mays cultivar NC354 promoter region (whp1) ge... 44 0.47
89gb|AY731339.1| Zea mays cultivar ND246 promoter region (whp1) ge... 44 0.47
90gb|AY731338.1| Zea mays cultivar F44 promoter region (whp1) gene... 44 0.47
91gb|AY731337.1| Zea mays cultivar N192 promoter region (whp1) gen... 44 0.47
92gb|AY731336.1| Zea mays cultivar GE37 promoter region (whp1) gen... 44 0.47
93gb|AY731335.1| Zea mays cultivar CMV3 promoter region (whp1) gen... 44 0.47
94gb|AY731334.1| Zea mays cultivar A441-5 promoter region (whp1) g... 44 0.47
95gb|AY731333.1| Zea mays cultivar CM174 promoter region (whp1) ge... 44 0.47
96gb|AY731332.1| Zea mays cultivar B84 promoter region (whp1) gene... 44 0.47
97gb|AY731331.1| Zea mays cultivar A619 promoter region (whp1) gen... 44 0.47
98gb|AY731330.1| Zea mays cultivar B73 promoter region (whp1) gene... 44 0.47
99gb|AY731329.1| Zea mays cultivar B68 promoter region (whp1) gene... 44 0.47
100gb|AY731328.1| Zea mays cultivar B14A promoter region (whp1) gen... 44 0.47
101gb|AY731324.1| Zea mays cultivar B103 promoter region (whp1) gen... 44 0.47
102gb|AY731322.1| Zea mays cultivar A272 promoter region (whp1) gen... 44 0.47
103gb|AY731321.1| Zea mays cultivar 4Co63 promoter region (whp1) ge... 44 0.47
104gb|AY731320.1| Zea mays cultivar B97 promoter region (whp1) gene... 44 0.47
105gb|AY731319.1| Zea mays cultivar W64A promoter region (whp1) gen... 44 0.47
106gb|AY731318.1| Zea mays cultivar W182B promoter region (whp1) ge... 44 0.47
107gb|AY731314.1| Zea mays cultivar Tzi18 promoter region (whp1) ge... 44 0.47
108gb|AY731313.1| Zea mays cultivar SA24 promoter region (whp1) gen... 44 0.47
109gb|AY731312.1| Zea mays cultivar PA91 promoter region (whp1) gen... 44 0.47
110gb|AY731311.1| Zea mays cultivar WF9 promoter region (whp1) gene... 44 0.47
111gb|AY731310.1| Zea mays cultivar A554 promoter region (whp1) gen... 44 0.47
112gb|AY731308.1| Zea mays cultivar NC7A promoter region (whp1) gen... 44 0.47
113gb|AY731306.1| Zea mays cultivar NC350 promoter region (whp1) ge... 44 0.47
114gb|AY731304.1| Zea mays cultivar NC338 promoter region (whp1) ge... 44 0.47
115gb|AY731301.1| Zea mays cultivar NC296 promoter region (whp1) ge... 44 0.47
116gb|AY731300.1| Zea mays cultivar NC260 promoter region (whp1) ge... 44 0.47
117gb|AY731299.1| Zea mays cultivar NC250 promoter region (whp1) ge... 44 0.47
118gb|AY731298.1| Zea mays cultivar N28HT promoter region (whp1) ge... 44 0.47
119gb|AY731297.1| Zea mays cultivar Mo20W promoter region (whp1) ge... 44 0.47
120gb|AY731295.1| Zea mays cultivar GT119 promoter region (whp1) ge... 44 0.47
121gb|AY731294.1| Zea mays cultivar Mo6 promoter region (whp1) gene... 44 0.47
122gb|AY731290.1| Zea mays cultivar IL677A promoter region (whp1) g... 44 0.47
123ref|XM_508643.1| PREDICTED: Pan troglodytes similar to Beta-arre... 44 0.47
124gb|DQ098921.1| Giardia intestinalis clone MJ3348 subtelomeric re... 44 0.47
125gb|AC164700.3| Mus musculus BAC clone RP24-548M16 from chromosom... 44 0.47
126gb|AC161808.8| Mus musculus chromosome 5, clone RP24-386J15, com... 44 0.47
127gb|AY484588.1| Musa acuminata clone MuG9, genomic sequence 44 0.47
128gb|AC108755.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.47
129ref|NM_020251.2| Homo sapiens arrestin, beta 1 (ARRB1), transcri... 44 0.47
130ref|NM_004041.3| Homo sapiens arrestin, beta 1 (ARRB1), transcri... 44 0.47
131gb|BC003636.2| Homo sapiens arrestin, beta 1, transcript variant... 44 0.47
132gb|AC127027.13| Mus musculus chromosome 5, clone RP23-236G19, co... 44 0.47
133gb|AC125534.4| Mus musculus BAC clone RP23-460A22 from chromosom... 44 0.47
134gb|AC118613.8| Mus musculus chromosome 6, clone RP23-442E2, comp... 44 0.47
135emb|AL031905.7|HS460D19 Human DNA sequence from clone RP3-460D19... 44 0.47
136emb|X60204.1|ZMWHPCS Z.mays whp (white pollen) gene for chalcone... 44 0.47
137emb|CR620471.1| full-length cDNA clone CS0DI035YC13 of Placenta ... 44 0.47
138emb|CR613470.1| full-length cDNA clone CS0DD005YC21 of Neuroblas... 44 0.47
139emb|CR612323.1| full-length cDNA clone CS0DI058YK20 of Placenta ... 44 0.47
140emb|CR604964.1| full-length cDNA clone CS0DC027YG05 of Neuroblas... 44 0.47
141emb|CR604447.1| full-length cDNA clone CS0DI063YM22 of Placenta ... 44 0.47
142emb|CR596009.1| full-length cDNA clone CS0DC029YB06 of Neuroblas... 44 0.47
143gb|AC104298.2| Homo sapiens chromosome 3 clone RP11-96N5, comple... 44 0.47
144gb|DQ380826.1| Arhopala epimuta clone AEP037 microsatellite sequ... 44 0.47
145dbj|AB169682.1| Macaca fascicularis brain cDNA, clone: QccE-1777... 44 0.47
146dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.47
147dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.47
148gb|AC010203.14| Homo sapiens 12 BAC RP11-175P13 (Roswell Park Ca... 44 0.47
149dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.47
150dbj|AP006756.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.47
151gb|AC154016.2| Mus musculus 6 BAC RP24-146M9 (Roswell Park Cance... 44 0.47
152gb|AC002378.1|AC002378 Human PAC clone RP3-438O4 from 22q12.1-qt... 44 0.47
153dbj|AK065263.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.47
154emb|CR405682.23| Zebrafish DNA sequence from clone DKEYP-67E6 in... 44 0.47
155dbj|AB095006.1| Triticum aestivum Wcor15 gene for chloroplast-ta... 44 0.47
156gb|AC104548.6| Mus musculus chromosome 5, clone RP24-83N12, comp... 44 0.47
157gb|AF084940.1|AF084940 Homo sapiens beta-arrestin 1B mRNA, compl... 44 0.47
158gb|AF084040.1|AF084040 Homo sapiens beta-arrestin 1A mRNA, compl... 44 0.47
159gb|L04685.1|HUMARR1A Homo sapiens beta-arrestin 1 mRNA, 5` end 44 0.47
160gb|AC009206.21| Drosophila melanogaster clone BACR15A11, complet... 42 1.8
161gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 42 1.8
162gb|AC164156.2| Mus musculus BAC clone RP24-549I8 from chromosome... 42 1.8
163gb|AC006372.2| Homo sapiens BAC clone RP11-331D5 from 7, complet... 42 1.8
164gb|AC127231.4| Mus musculus BAC clone RP24-554M18 from chromosom... 42 1.8
165gb|DQ144902.1| Ascocalyx abietina strain FIN3-M1-T6 multiallelic... 42 1.8
166gb|DQ144901.1| Ascocalyx abietina strain FIN3-M1-T5 multiallelic... 42 1.8
167gb|DQ144900.1| Ascocalyx abietina strain FIN3-M1-T3 multiallelic... 42 1.8
168gb|DQ144899.1| Ascocalyx abietina strain FIN3-M1-T2 multiallelic... 42 1.8
169gb|DQ144898.1| Ascocalyx abietina strain FIN3-M1-T1 multiallelic... 42 1.8
170gb|DQ144897.1| Ascocalyx abietina strain FIN3-M1-P4 multiallelic... 42 1.8
171gb|DQ144896.1| Ascocalyx abietina strain FIN3-M1-P3 multiallelic... 42 1.8
172gb|DQ144895.1| Ascocalyx abietina strain FIN3-M1-P2 multiallelic... 42 1.8
173gb|DQ144894.1| Ascocalyx abietina strain FIN3-M1-P1 multiallelic... 42 1.8
174gb|DQ144442.1| Ascocalyx abietina clone pGAAA-1000-AU58-c micros... 42 1.8
175gb|DQ144441.1| Ascocalyx abietina clone pGAAA-1000-B1-c microsat... 42 1.8
176gb|AC160965.4| Mus musculus BAC clone RP24-334E4 from chromosome... 42 1.8
177gb|AC096035.6| Rattus norvegicus 4 BAC CH230-16M16 (Children's H... 42 1.8
178emb|AL670471.4| Human DNA sequence from clone RP11-290H1 on chro... 42 1.8
179gb|AC138134.6| Mus musculus strain C57BL/6J clone rp23-382i2 map... 42 1.8
180emb|AL591843.14| Mouse DNA sequence from clone RP23-351I6 on chr... 42 1.8
181gb|AC093454.3| Drosophila melanogaster 3L BAC RP98-23K2 (Roswell... 42 1.8
182gb|AC010660.6| Drosophila melanogaster 3L BAC RP98-9I16 (Roswell... 42 1.8
183emb|CR589951.3| Human DNA sequence from clone WI2-489O20 on chro... 42 1.8
184gb|AC092627.2| Homo sapiens BAC clone RP11-271B8 from 4, complet... 42 1.8
185gb|AC017026.8| Homo sapiens BAC clone RP11-269L4 from 2, complet... 42 1.8
186gb|AE003788.5| Drosophila melanogaster chromosome 2R, section 1 ... 42 1.8
187gb|AE003528.3| Drosophila melanogaster chromosome 3L, section 57... 42 1.8
188gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequ... 42 1.8
189gb|AC004486.1|AC004486 Homo sapiens 12q13 PAC RPCI3-432I18 (Rosw... 42 1.8
190gb|AC005900.1|AC005900 Homo sapiens chromosome 17, clone hRPK.99... 42 1.8
191emb|AL929467.6| Zebrafish DNA sequence from clone CH211-148E17, ... 42 1.8
192gb|AC149059.3| Mus musculus BAC clone RP23-325A2 from 18, comple... 42 1.8
193emb|AL845447.3| Mouse DNA sequence from clone RP23-133L20 on chr... 42 1.8
194gb|AC155818.5| Mus musculus BAC clone RP23-397H1 from chromosome... 40 7.3
195gb|AC165964.3| Mus musculus BAC clone RP23-334H24 from chromosom... 40 7.3
196gb|AC109201.12| Mus musculus chromosome 15, clone RP23-18P10, co... 40 7.3
197gb|AE014833.1| Plasmodium falciparum 3D7 chromosome 10 section 5... 40 7.3
198gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence 40 7.3
199gb|AC159454.1| Trypanosoma brucei chromosome 7 clone RPCI93-6C8,... 40 7.3
200gb|AC159429.1| Trypanosoma brucei chromosome 7 clone RPCI93-28B1... 40 7.3
201gb|AC147831.2| Xenopus tropicalis clone CH216-159I14, complete s... 40 7.3
202gb|AC161280.2| Pan troglodytes BAC clone CH251-392H4 from chromo... 40 7.3
203gb|AC161123.3| Pan troglodytes BAC clone CH251-618D5 from chromo... 40 7.3
204gb|AF106575.2| Caenorhabditis elegans cosmid K04F1, complete seq... 40 7.3
205gb|AC140841.2| Mus musculus BAC clone RP24-470M20 from chromosom... 40 7.3
206ref|XM_542307.2| PREDICTED: Canis familiaris similar to arrestin... 40 7.3
207ref|XM_844950.1| PREDICTED: Canis familiaris similar to arrestin... 40 7.3
208emb|AJ965256.1| Dehalococcoides sp. CBDB1 complete genome 40 7.3
209emb|Z83218.1|CEC31A11 Caenorhabditis elegans Cosmid C31A11, comp... 40 7.3
210emb|CT025638.1| Pan troglodytes chromosome X clone PTB-083N09 ma... 40 7.3
211ref|XM_814566.1| Trypanosoma cruzi strain CL Brener epsilon-adap... 40 7.3
212gb|AC114915.3| Mus musculus BAC clone RP23-54K21 from 2, complet... 40 7.3
213gb|AC119803.10| Mus musculus chromosome 6, clone RP23-124H21, co... 40 7.3
214gb|AF099917.1| Caenorhabditis elegans cosmid F54D10, complete se... 40 7.3
215gb|AF016654.1| Caenorhabditis elegans cosmid C17A2, complete seq... 40 7.3
216gb|AC012526.35| Mus musculus strain 129S6/SvEvTac clone rp21-671... 40 7.3
217gb|AC140026.11| Medicago truncatula clone mth2-36j24, complete s... 40 7.3
218emb|AL449196.1| Human DNA sequence from clone RP11-61K10 on chro... 40 7.3
219emb|AL390965.15| Human DNA sequence from clone RP11-640E11 on ch... 40 7.3
220emb|AL355985.18| Human DNA sequence from clone RP11-98O17 on chr... 40 7.3
221emb|AL157938.22| Human DNA sequence from clone RP11-544A12 on ch... 40 7.3
222emb|CR380951.1| Candida glabrata strain CBS138 chromosome E comp... 40 7.3
223gb|AC091002.54| Mus musculus strain C57BL/6J clone rp23-7n16 map... 40 7.3
224emb|AL133090.1|HSM801366 Homo sapiens mRNA; cDNA DKFZp434E0528 (... 40 7.3
225gb|AC079628.20| Homo sapiens 12 BAC RP11-688K16 (Roswell Park Ca... 40 7.3
226emb|BX649557.8| Zebrafish DNA sequence from clone DKEYP-61G11 in... 40 7.3
227gb|AC162465.3| Mus musculus 6 BAC RP24-108G5 (Roswell Park Cance... 40 7.3
228gb|AC092668.2| Homo sapiens BAC clone RP11-553F8 from 4, complet... 40 7.3
229gb|AC006082.22| Mus musculus strain 129/Sv ES cell line CJ7 chro... 40 7.3
230gb|AC016650.6| Homo sapiens chromosome 5 clone RPCI-1_167J12, co... 40 7.3
231gb|AC091045.3| Homo sapiens chromosome 15 clone RP11-111A22 map ... 40 7.3
232gb|AC013356.8|AC013356 Homo sapiens chromosome 15 clone RP11-64K... 40 7.3
233ref|NM_174243.2| Bos taurus arrestin, beta 1 (ARRB1), mRNA 40 7.3
234gb|AC005075.2|AC005075 Homo sapiens BAC clone CTA-219E16 from 7,... 40 7.3
235gb|AC118542.20| Mus musculus strain C57BL/6J chromosome 16 clone... 40 7.3
236emb|AL954869.9| Mouse DNA sequence from clone RP23-477I13 on chr... 40 7.3
237gb|U23515.1| Caenorhabditis elegans cosmid R144, complete sequence 40 7.3
238emb|Z93377.1|CEF13A7 Caenorhabditis elegans Cosmid F13A7, comple... 40 7.3
239gb|AC159315.4| Mus musculus BAC clone RP23-86H21 from chromosome... 40 7.3
240gb|AC153853.4| Mus musculus BAC RP23-341J13 (Roswell Park Cance... 40 7.3
241gb|AC147266.6| Mus musculus BAC clone RP24-246F6 from 8, complet... 40 7.3
242gb|AC123825.5| Mus musculus BAC clone RP24-93F18 from 8, complet... 40 7.3
243emb|BX005190.8| Mouse DNA sequence from clone RP23-383A22 on chr... 40 7.3
244gb|AC140407.5| Mus musculus BAC clone RP23-142K9 from chromosome... 40 7.3
245gb|AC171199.1| Mus musculus BAC clone RP24-469I17 from chromosom... 40 7.3
246emb|AL844844.8| Mouse DNA sequence from clone RP23-103D7 on chro... 40 7.3
247gb|M33601.1|BOVARRB Cow beta-arrestin mRNA, complete cds 40 7.3
248emb|AL592042.9| Mouse DNA sequence from clone RP23-380K13 on chr... 40 7.3 
>ref|XM_476842.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1956

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 293 gggtgggtagggtagggtagggtaggg 319
           |||||||||||||||||||||||||||
Sbjct: 116 gggtgggtagggtagggtagggtaggg 90
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                          
Query: 293     gggtgggtagggtagggtagggtaggg 319
               |||||||||||||||||||||||||||
Sbjct: 4171425 gggtgggtagggtagggtagggtaggg 4171399
to top
>dbj|AP003826.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1361_E02
          Length = 100168

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 293   gggtgggtagggtagggtagggtaggg 319
             |||||||||||||||||||||||||||
Sbjct: 55047 gggtgggtagggtagggtagggtaggg 55021
to top
>dbj|AK101824.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033067M16, full
           insert sequence
          Length = 1955

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 293 gggtgggtagggtagggtagggtaggg 319
           |||||||||||||||||||||||||||
Sbjct: 115 gggtgggtagggtagggtagggtaggg 89
to top
>gb|AC160410.3| Mus musculus 10 BAC RP24-356L3 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 172562

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 298    ggtagggtagggtagggtagggtcgg 323
              ||||||||||||||||||||||||||
Sbjct: 143695 ggtagggtagggtagggtagggtcgg 143670



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||| ||||
Sbjct: 143691 gggtagggtagggtagggtcgggt 143668
to top
>gb|AC170188.2| Mus musculus BAC clone RP24-195M20 from chromosome 13, complete
            sequence
          Length = 165687

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 296  tgggtagggtagggtagggtagggt 320
            |||||||||||||||||||||||||
Sbjct: 2605 tgggtagggtagggtagggtagggt 2581



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2599 gggtagggtagggtagggtagggt 2576



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2594 gggtagggtagggtagggtagggt 2571



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2589 gggtagggtagggtagggtagggt 2566



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2584 gggtagggtagggtagggtagggt 2561



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2579 gggtagggtagggtagggtagggt 2556



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 297  gggtagggtagggtagggtag 317
            |||||||||||||||||||||
Sbjct: 2574 gggtagggtagggtagggtag 2554
to top
>gb|AC132347.4| Mus musculus BAC clone RP24-186F6 from chromosome 13, complete sequence
          Length = 155751

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 296   tgggtagggtagggtagggtagggt 320
             |||||||||||||||||||||||||
Sbjct: 25304 tgggtagggtagggtagggtagggt 25328



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 25330 gggtagggtagggtagggtagggt 25353



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 25325 gggtagggtagggtagggtagggt 25348



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 25320 gggtagggtagggtagggtagggt 25343



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 25315 gggtagggtagggtagggtagggt 25338



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 25310 gggtagggtagggtagggtagggt 25333



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 297   gggtagggtagggtagggtag 317
             |||||||||||||||||||||
Sbjct: 25335 gggtagggtagggtagggtag 25355
to top
>emb|BX088589.14| Zebrafish DNA sequence from clone DKEY-27E7 in linkage group 12,
             complete sequence
          Length = 242558

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 296   tgggtagggtagggtagggtagggt 320
             |||||||||||||||||||||||||
Sbjct: 19341 tgggtagggtagggtagggtagggt 19365



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 19347 gggtagggtagggtagggtagggt 19370



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 19292 gggtagggtagggtagggtagggt 19315



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 19287 gggtagggtagggtagggtagggt 19310



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 296   tgggtagggtagggtagggtagg 318
             |||||||||||||||||||||||
Sbjct: 19421 tgggtagggtagggtagggtagg 19443



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 20112 gggtagggtagggtagggtagg 20133



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   tagggtagggtagggtagggtcggac 325
             ||||||||||||||||||||| ||||
Sbjct: 20110 tagggtagggtagggtagggtaggac 20135



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 19352 gggtagggtagggtagggtagg 19373



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 19635 tagggtagggtagggtagggt 19655



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 19445 tagggtagggtagggtagggt 19465



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 19390 tagggtagggtagggtagggt 19410



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 296   tgggtagggtagggtagggtagggt 320
             ||||||||||||||| |||||||||
Sbjct: 19326 tgggtagggtagggttgggtagggt 19350



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 19285 tagggtagggtagggtagggt 19305



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 297   gggtagggtagggtagggta 316
             ||||||||||||||||||||
Sbjct: 19637 gggtagggtagggtagggta 19656



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 297   gggtagggtagggtagggta 316
             ||||||||||||||||||||
Sbjct: 19447 gggtagggtagggtagggta 19466



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||| ||||||||||||||||
Sbjct: 19437 gggtaggatagggtagggtagggt 19460



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||||| |||||||||||
Sbjct: 19432 gggtagggtaggatagggtagggt 19455



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||| ||||||
Sbjct: 19427 gggtagggtagggtaggatagggt 19450



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||| |||||||||||||||||||
Sbjct: 19417 gggttgggtagggtagggtagggt 19440



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 297   gggtagggtagggtagggta 316
             ||||||||||||||||||||
Sbjct: 19392 gggtagggtagggtagggta 19411



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||| |||||||||||||||||||
Sbjct: 19337 gggttgggtagggtagggtagggt 19360



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||| ||||||||||||||
Sbjct: 19332 gggtagggttgggtagggtagggt 19355



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 297   gggtagggtagggtagggta 316
             ||||||||||||||||||||
Sbjct: 19297 gggtagggtagggtagggta 19316
to top
>dbj|AK109075.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-G07, full
           insert sequence
          Length = 984

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 296 tgggtagggtagggtagggtagggt 320
           |||||||||||||||||||||||||
Sbjct: 847 tgggtagggtagggtagggtagggt 871



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 853 gggtagggtagggtagggtagggt 876



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 297 gggtagggtagggtagggtagggtcgg 323
           |||||||||||||||||||| ||||||
Sbjct: 858 gggtagggtagggtagggtaaggtcgg 884
to top
>gb|AC158938.13| Mus musculus chromosome 3, clone RP23-304F19, complete sequence
          Length = 232469

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 296    tgggtagggtagggtagggtagggt 320
              |||||||||||||||||||||||||
Sbjct: 127038 tgggtagggtagggtagggtagggt 127014



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 127032 gggtagggtagggtagggtagggt 127009



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 296    tgggtagggtagggtagggtagg 318
              |||||||||||||||||||||||
Sbjct: 126693 tgggtagggtagggtagggtagg 126671



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 299    gtagggtagggtagggtagggt 320
              ||||||||||||||||||||||
Sbjct: 126645 gtagggtagggtagggtagggt 126624



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 296    tgggtagggtagggtagggtaggg 319
              ||||||||||||| ||||||||||
Sbjct: 127118 tgggtagggtaggatagggtaggg 127095



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||| ||||||
Sbjct: 126687 gggtagggtagggtaggatagggt 126664



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              |||||||||||| |||||||||||
Sbjct: 126682 gggtagggtaggatagggtagggt 126659



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||| ||||||||||||||||
Sbjct: 126677 gggtaggatagggtagggtagggt 126654
to top
>gb|DQ098931.1| Giardia intestinalis clone EJ7728 subtelomeric region (STR) 6
            sequence
          Length = 4816

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 4791 gggtagggtagggtagggtagggt 4814



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 4788 gtagggtagggtagggtagggt 4809



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 297  gggtagggtagggtagggtag 317
            |||||||||||||||||||||
Sbjct: 4796 gggtagggtagggtagggtag 4816
to top
>gb|DQ098930.1| Giardia intestinalis clone NJ1197 subtelomeric region (STR) 4
            sequence
          Length = 1710

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1684 gggtagggtagggtagggtagggt 1707



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1679 gggtagggtagggtagggtagggt 1702



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1674 gggtagggtagggtagggtagggt 1697



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1669 gggtagggtagggtagggtagggt 1692



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1664 gggtagggtagggtagggtagggt 1687



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1659 gggtagggtagggtagggtagggt 1682



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1654 gggtagggtagggtagggtagggt 1677



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1649 gggtagggtagggtagggtagggt 1672



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1644 gggtagggtagggtagggtagggt 1667



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1639 gggtagggtagggtagggtagggt 1662



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1634 gggtagggtagggtagggtagggt 1657



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1629 gggtagggtagggtagggtagggt 1652



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1624 gggtagggtagggtagggtagggt 1647



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1619 gggtagggtagggtagggtagggt 1642



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1614 gggtagggtagggtagggtagggt 1637



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1609 gggtagggtagggtagggtagggt 1632



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1604 gggtagggtagggtagggtagggt 1627



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1599 gggtagggtagggtagggtagggt 1622



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1594 gggtagggtagggtagggtagggt 1617



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1589 gggtagggtagggtagggtagggt 1612



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 297  gggtagggtagggtagggtagg 318
            ||||||||||||||||||||||
Sbjct: 1689 gggtagggtagggtagggtagg 1710



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 1586 gtagggtagggtagggtagggt 1607
to top
>gb|DQ098929.1| Giardia intestinalis clone NG0253 subtelomeric region (STR) 5
            sequence
          Length = 2574

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2551 gggtagggtagggtagggtagggt 2574



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2546 gggtagggtagggtagggtagggt 2569



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2541 gggtagggtagggtagggtagggt 2564



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2536 gggtagggtagggtagggtagggt 2559



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2531 gggtagggtagggtagggtagggt 2554



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2526 gggtagggtagggtagggtagggt 2549



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2521 gggtagggtagggtagggtagggt 2544



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2516 gggtagggtagggtagggtagggt 2539



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2511 gggtagggtagggtagggtagggt 2534



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2506 gggtagggtagggtagggtagggt 2529



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2501 gggtagggtagggtagggtagggt 2524



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2496 gggtagggtagggtagggtagggt 2519



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2491 gggtagggtagggtagggtagggt 2514



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2486 gggtagggtagggtagggtagggt 2509



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2481 gggtagggtagggtagggtagggt 2504



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2476 gggtagggtagggtagggtagggt 2499



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2471 gggtagggtagggtagggtagggt 2494



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2466 gggtagggtagggtagggtagggt 2489



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2461 gggtagggtagggtagggtagggt 2484



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2456 gggtagggtagggtagggtagggt 2479



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2451 gggtagggtagggtagggtagggt 2474



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2446 gggtagggtagggtagggtagggt 2469



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2387 gggtagggtagggtagggtagggt 2410



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2382 gggtagggtagggtagggtagggt 2405



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2377 gggtagggtagggtagggtagggt 2400



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2372 gggtagggtagggtagggtagggt 2395



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2367 gggtagggtagggtagggtagggt 2390



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2362 gggtagggtagggtagggtagggt 2385



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2357 gggtagggtagggtagggtagggt 2380



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2352 gggtagggtagggtagggtagggt 2375



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2347 gggtagggtagggtagggtagggt 2370



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2342 gggtagggtagggtagggtagggt 2365



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2337 gggtagggtagggtagggtagggt 2360



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2332 gggtagggtagggtagggtagggt 2355



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2327 gggtagggtagggtagggtagggt 2350



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2322 gggtagggtagggtagggtagggt 2345



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2317 gggtagggtagggtagggtagggt 2340



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2312 gggtagggtagggtagggtagggt 2335



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2307 gggtagggtagggtagggtagggt 2330



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2302 gggtagggtagggtagggtagggt 2325



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 298  ggtagggtagggtagggtagggt 320
            |||||||||||||||||||||||
Sbjct: 2442 ggtagggtagggtagggtagggt 2464



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            |||||||||||||||||||| |||
Sbjct: 2416 gggtagggtagggtagggtasggt 2439



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 2413 gtagggtagggtagggtagggt 2434



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 2299 gtagggtagggtagggtagggt 2320



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 297  gggtagggtagggtagggta 316
            ||||||||||||||||||||
Sbjct: 2392 gggtagggtagggtagggta 2411
to top
>gb|DQ098928.1| Giardia intestinalis clone NF0311 subtelomeric region (STR) 5
            sequence
          Length = 2575

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2517 gggtagggtagggtagggtagggt 2540



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2512 gggtagggtagggtagggtagggt 2535



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2507 gggtagggtagggtagggtagggt 2530



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2502 gggtagggtagggtagggtagggt 2525



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 297  gggtagggtagggtagggtaggg 319
            |||||||||||||||||||||||
Sbjct: 2553 gggtagggtagggtagggtaggg 2575



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 297  gggtagggtagggtagggtaggg 319
            |||||||||||||||||||||||
Sbjct: 2522 gggtagggtagggtagggtaggg 2544



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 2550 gtagggtagggtagggtagggt 2571



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 2499 gtagggtagggtagggtagggt 2520
to top
>gb|DQ098927.1| Giardia intestinalis clone KJ1356 subtelomeric region (STR) 4
            sequence
          Length = 2013

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1989 gggtagggtagggtagggtagggt 2012



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1984 gggtagggtagggtagggtagggt 2007



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1979 gggtagggtagggtagggtagggt 2002



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 1976 gtagggtagggtagggtagggt 1997



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 297  gggtagggtagggtagggta 316
            ||||||||||||||||||||
Sbjct: 1994 gggtagggtagggtagggta 2013
to top
>gb|DQ098926.1| Giardia intestinalis clone LJ0347 subtelomeric region (STR) 3
            sequence
          Length = 2432

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2409 gggtagggtagggtagggtagggt 2432



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2404 gggtagggtagggtagggtagggt 2427



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2399 gggtagggtagggtagggtagggt 2422



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2394 gggtagggtagggtagggtagggt 2417



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2364 gggtagggtagggtagggtagggt 2387



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2359 gggtagggtagggtagggtagggt 2382



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2354 gggtagggtagggtagggtagggt 2377



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2349 gggtagggtagggtagggtagggt 2372



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2344 gggtagggtagggtagggtagggt 2367



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2339 gggtagggtagggtagggtagggt 2362



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2334 gggtagggtagggtagggtagggt 2357



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 293  gggtgggtagggtagggtagggtagggt 320
            |||| |||||||||||||||||||||||
Sbjct: 2325 gggtaggtagggtagggtagggtagggt 2352



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2305 gggtagggtagggtagggtagggt 2328



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2300 gggtagggtagggtagggtagggt 2323



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2295 gggtagggtagggtagggtagggt 2318



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2290 gggtagggtagggtagggtagggt 2313



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2260 gggtagggtagggtagggtagggt 2283



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2255 gggtagggtagggtagggtagggt 2278



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2250 gggtagggtagggtagggtagggt 2273



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2245 gggtagggtagggtagggtagggt 2268



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2240 gggtagggtagggtagggtagggt 2263



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2235 gggtagggtagggtagggtagggt 2258



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2230 gggtagggtagggtagggtagggt 2253



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2225 gggtagggtagggtagggtagggt 2248



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2220 gggtagggtagggtagggtagggt 2243



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2190 gggtagggtagggtagggtagggt 2213



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2185 gggtagggtagggtagggtagggt 2208



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2180 gggtagggtagggtagggtagggt 2203



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2175 gggtagggtagggtagggtagggt 2198



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2170 gggtagggtagggtagggtagggt 2193



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2165 gggtagggtagggtagggtagggt 2188



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 298  ggtagggtagggtagggtagggt 320
            |||||||||||||||||||||||
Sbjct: 2390 ggtagggtagggtagggtagggt 2412



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 298  ggtagggtagggtagggtagggt 320
            |||||||||||||||||||||||
Sbjct: 2286 ggtagggtagggtagggtagggt 2308



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 298  ggtagggtagggtagggtagggt 320
            |||||||||||||||||||||||
Sbjct: 2216 ggtagggtagggtagggtagggt 2238



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||| ||||||||||||||||||
Sbjct: 2384 gggtasggtagggtagggtagggt 2407



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            |||||||||| |||||||||||||
Sbjct: 2379 gggtagggtasggtagggtagggt 2402



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||| ||||||||
Sbjct: 2374 gggtagggtagggtasggtagggt 2397



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            |||||||||||||||||||| |||
Sbjct: 2369 gggtagggtagggtagggtasggt 2392



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 297  gggtagggtagggtagggtagg 318
            ||||||||||||||||||||||
Sbjct: 2310 gggtagggtagggtagggtagg 2331



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 2162 gtagggtagggtagggtagggt 2183



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||| ||||||||||||||||||
Sbjct: 2280 gggtaaggtagggtagggtagggt 2303



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            |||||||||| |||||||||||||
Sbjct: 2275 gggtagggtaaggtagggtagggt 2298



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||| ||||||||
Sbjct: 2270 gggtagggtagggtaaggtagggt 2293



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 297  gggtagggtagggtagggta 316
            ||||||||||||||||||||
Sbjct: 2265 gggtagggtagggtagggta 2284



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||| ||||||||||||||||||
Sbjct: 2210 gggtaaggtagggtagggtagggt 2233



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            |||||||||| |||||||||||||
Sbjct: 2205 gggtagggtaaggtagggtagggt 2228



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||| ||||||||
Sbjct: 2200 gggtagggtagggtaaggtagggt 2223



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 297  gggtagggtagggtagggta 316
            ||||||||||||||||||||
Sbjct: 2195 gggtagggtagggtagggta 2214
to top
>gb|DQ098925.1| Giardia intestinalis clone EJ2414 subtelomeric region (STR) 3
            sequence
          Length = 2079

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2052 gggtagggtagggtagggtagggt 2075



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2047 gggtagggtagggtagggtagggt 2070



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2042 gggtagggtagggtagggtagggt 2065



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2037 gggtagggtagggtagggtagggt 2060



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2032 gggtagggtagggtagggtagggt 2055



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2027 gggtagggtagggtagggtagggt 2050



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1997 gggtagggtagggtagggtagggt 2020



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1992 gggtagggtagggtagggtagggt 2015



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1987 gggtagggtagggtagggtagggt 2010



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1982 gggtagggtagggtagggtagggt 2005



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1977 gggtagggtagggtagggtagggt 2000



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1972 gggtagggtagggtagggtagggt 1995



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1967 gggtagggtagggtagggtagggt 1990



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1962 gggtagggtagggtagggtagggt 1985



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1957 gggtagggtagggtagggtagggt 1980



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1952 gggtagggtagggtagggtagggt 1975



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1947 gggtagggtagggtagggtagggt 1970



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1942 gggtagggtagggtagggtagggt 1965



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1937 gggtagggtagggtagggtagggt 1960



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1932 gggtagggtagggtagggtagggt 1955



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1882 gggtagggtagggtagggtagggt 1905



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1877 gggtagggtagggtagggtagggt 1900



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1872 gggtagggtagggtagggtagggt 1895



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1867 gggtagggtagggtagggtagggt 1890



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1862 gggtagggtagggtagggtagggt 1885



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 297  gggtagggtagggtagggtaggg 319
            |||||||||||||||||||||||
Sbjct: 2057 gggtagggtagggtagggtaggg 2079



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 298  ggtagggtagggtagggtagggt 320
            |||||||||||||||||||||||
Sbjct: 2023 ggtagggtagggtagggtagggt 2045



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 298  ggtagggtagggtagggtagggt 320
            |||||||||||||||||||||||
Sbjct: 1928 ggtagggtagggtagggtagggt 1950



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||| ||||||||||||||||||
Sbjct: 2017 gggtaaggtagggtagggtagggt 2040



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            |||||||||| |||||||||||||
Sbjct: 2012 gggtagggtaaggtagggtagggt 2035



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||| ||||||||
Sbjct: 2007 gggtagggtagggtaaggtagggt 2030



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 297  gggtagggtagggtagggta 316
            ||||||||||||||||||||
Sbjct: 2002 gggtagggtagggtagggta 2021



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||| ||||||||||||||||||
Sbjct: 1922 gggtaaggtagggtagggtagggt 1945



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            |||||||||| |||||||||||||
Sbjct: 1917 gggtagggtaaggtagggtagggt 1940



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||| ||||||||
Sbjct: 1912 gggtagggtagggtaaggtagggt 1935



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||| ||||||||||||||||||
Sbjct: 1902 gggtaaggtagggtagggtagggt 1925



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            |||||||||| |||||||||||||
Sbjct: 1897 gggtagggtaaggtagggtagggt 1920



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||| ||||||||
Sbjct: 1892 gggtagggtagggtaaggtagggt 1915



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 297  gggtagggtagggtagggta 316
            ||||||||||||||||||||
Sbjct: 1887 gggtagggtagggtagggta 1906



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 301  agggtagggtagggtagggt 320
            ||||||||||||||||||||
Sbjct: 1861 agggtagggtagggtagggt 1880
to top
>gb|DQ098924.1| Giardia intestinalis clone EJ1336 subtelomeric region (STR) 3
            sequence
          Length = 2363

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2340 gggtagggtagggtagggtagggt 2363



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2335 gggtagggtagggtagggtagggt 2358



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 301  agggtagggtagggtagggt 320
            ||||||||||||||||||||
Sbjct: 2334 agggtagggtagggtagggt 2353
to top
>gb|DQ098923.1| Giardia intestinalis clone KI1170 subtelomeric region (STR) 3
            sequence
          Length = 2172

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2146 gggtagggtagggtagggtagggt 2169



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2141 gggtagggtagggtagggtagggt 2164



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2136 gggtagggtagggtagggtagggt 2159



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2131 gggtagggtagggtagggtagggt 2154



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 297  gggtagggtagggtagggtagg 318
            ||||||||||||||||||||||
Sbjct: 2151 gggtagggtagggtagggtagg 2172



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 2128 gtagggtagggtagggtagggt 2149
to top
>gb|DQ098922.1| Giardia intestinalis clone EJ6107 subtelomeric region (STR) 2
            sequence
          Length = 1909

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1886 gggtagggtagggtagggtagggt 1909



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1881 gggtagggtagggtagggtagggt 1904



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1876 gggtagggtagggtagggtagggt 1899



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1871 gggtagggtagggtagggtagggt 1894



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 1868 gtagggtagggtagggtagggt 1889
to top
>gb|DQ098920.1| Giardia intestinalis clone AJ1354 subtelomeric region (STR) 1
            sequence
          Length = 2074

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2046 gggtagggtagggtagggtagggt 2069



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2041 gggtagggtagggtagggtagggt 2064



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 2038 gtagggtagggtagggtagggt 2059



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 297  gggtagggtagggtagggta 316
            ||||||||||||||||||||
Sbjct: 2051 gggtagggtagggtagggta 2070
to top
>gb|AC099707.14| Mus musculus chromosome 1, clone RP23-329C7, complete sequence
          Length = 204557

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 51486 gggtagggtagggtagggtagggt 51463



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 51481 gggtagggtagggtagggtagggt 51458



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 51476 gggtagggtagggtagggtagggt 51453



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 297   gggtagggtagggtagggtaggg 319
             |||||||||||||||||||||||
Sbjct: 51471 gggtagggtagggtagggtaggg 51449



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 299   gtagggtagggtagggtagggt 320
             ||||||||||||||||||||||
Sbjct: 51489 gtagggtagggtagggtagggt 51468
to top
>gb|AC131695.4| Mus musculus BAC clone RP23-396F8 from chromosome 6, complete sequence
          Length = 199679

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 40334 gggtagggtagggtagggtagggt 40311



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 40329 gggtagggtagggtagggtagggt 40306



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 297   gggtagggtagggtagggtaggg 319
             |||||||||||||||||||||||
Sbjct: 40324 gggtagggtagggtagggtaggg 40302



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 40336 tagggtagggtagggtagggt 40316



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||||||||||| |||||
Sbjct: 40319 gggtagggtagggtagggcagggt 40296



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||| ||||||||||
Sbjct: 40314 gggtagggtagggcagggtagggt 40291



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||| |||||||||||||||
Sbjct: 40309 gggtagggcagggtagggtagggt 40286
to top
>gb|AC158349.5| Mus musculus chromosome 8, clone RP24-229D22, complete sequence
          Length = 163656

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 35669 gggtagggtagggtagggtagggt 35692



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 35674 gggtagggtagggtagggtagg 35695



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 35668 agggtagggtagggtagggt 35687
to top
>gb|AC044864.6| Mus musculus chromosome 3, clone RP23-168E14, complete sequence
          Length = 224119

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 51377 gggtagggtagggtagggtagggt 51354



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 51372 gggtagggtagggtagggtagggt 51349



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 51367 gggtagggtagggtagggtagggt 51344



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 51362 gggtagggtagggtagggtagggt 51339



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 51357 gggtagggtagggtagggtagggt 51334



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 298   ggtagggtagggtagggtagggt 320
             |||||||||||||||||||||||
Sbjct: 51381 ggtagggtagggtagggtagggt 51359



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 297   gggtagggtagggtagggta 316
             ||||||||||||||||||||
Sbjct: 51352 gggtagggtagggtagggta 51333
to top
>gb|AC137525.3| Mus musculus BAC clone RP23-68H24 from chromosome 3, complete sequence
          Length = 203159

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 198864 gggtagggtagggtagggtagggt 198841



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 198859 gggtagggtagggtagggtagggt 198836



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 198854 gggtagggtagggtagggtagggt 198831



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 198849 gggtagggtagggtagggtagggt 198826



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 198844 gggtagggtagggtagggtagggt 198821



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 298    ggtagggtagggtagggtagggt 320
              |||||||||||||||||||||||
Sbjct: 198868 ggtagggtagggtagggtagggt 198846



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 297    gggtagggtagggtagggta 316
              ||||||||||||||||||||
Sbjct: 198839 gggtagggtagggtagggta 198820
to top
>gb|AC124517.4| Mus musculus BAC clone RP23-387K15 from chromosome 13, complete
             sequence
          Length = 198825

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 84139 gggtagggtagggtagggtagggt 84162



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 297   gggtagggtagggtagggtag 317
             |||||||||||||||||||||
Sbjct: 84144 gggtagggtagggtagggtag 84164
to top
>emb|CT025605.11| Mouse DNA sequence from clone RP23-259D11 on chromosome 13, complete
              sequence
          Length = 188616

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 148262 gggtagggtagggtagggtagggt 148285



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 148257 gggtagggtagggtagggtagggt 148280



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 298    ggtagggtagggtagggtagggt 320
              |||||||||||||||||||||||
Sbjct: 148253 ggtagggtagggtagggtagggt 148275



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 297    gggtagggtagggtagggtagg 318
              ||||||||||||||||||||||
Sbjct: 148267 gggtagggtagggtagggtagg 148288
to top
>gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosome 1, complete sequence
          Length = 205642

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 30657 gggtagggtagggtagggtagggt 30680



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 298   ggtagggtagggtagggtagggt 320
             |||||||||||||||||||||||
Sbjct: 30653 ggtagggtagggtagggtagggt 30675



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 30662 gggtagggtagggtagggtagg 30683
to top
>gb|AC116051.4| Mus musculus BAC clone RP23-4L11 from 3, complete sequence
          Length = 224674

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 108511 gggtagggtagggtagggtagggt 108488



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 108506 gggtagggtagggtagggtagggt 108483



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 108501 gggtagggtagggtagggtagggt 108478



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 108496 gggtagggtagggtagggtagggt 108473



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 108491 gggtagggtagggtagggtagggt 108468



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 298    ggtagggtagggtagggtagggt 320
              |||||||||||||||||||||||
Sbjct: 108515 ggtagggtagggtagggtagggt 108493



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 297    gggtagggtagggtagggta 316
              ||||||||||||||||||||
Sbjct: 108486 gggtagggtagggtagggta 108467
to top
>gb|AC108430.11| Mus musculus chromosome 14, clone RP23-166L19, complete sequence
          Length = 204251

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 79096 gggtagggtagggtagggtagggt 79073



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 79091 gggtagggtagggtagggtagg 79070



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 79097 agggtagggtagggtagggt 79078
to top
>gb|AC131390.3| Homo sapiens chromosome 16 clone RP11-349E19, complete sequence
          Length = 199827

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 44826 gggtagggtagggtagggtagggt 44849



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 297   gggtagggtagggtagggtaggg 319
             |||||||||||||||||||||||
Sbjct: 44831 gggtagggtagggtagggtaggg 44853



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 44825 agggtagggtagggtagggt 44844
to top
>gb|DQ100078.1| Giardia intestinalis clone KJ2306 retrotransposon GilT-like gene,
            partial sequence
          Length = 1952

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1927 gggtagggtagggtagggtagggt 1950



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 1924 gtagggtagggtagggtagggt 1945



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 297  gggtagggtagggtagggtag 317
            |||||||||||||||||||||
Sbjct: 1932 gggtagggtagggtagggtag 1952



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            |||||| |||||||||||||||||
Sbjct: 1917 gggtagagtagggtagggtagggt 1940



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||| ||||||||||||
Sbjct: 1912 gggtagggtagagtagggtagggt 1935



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            |||||||||||||||| |||||||
Sbjct: 1907 gggtagggtagggtagagtagggt 1930
to top
>gb|DQ100077.1| Giardia intestinalis clone NJ3761 retrotransposon GilT-like gene,
            partial sequence
          Length = 2073

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2048 gggtagggtagggtagggtagggt 2071



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2043 gggtagggtagggtagggtagggt 2066



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2038 gggtagggtagggtagggtagggt 2061



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2033 gggtagggtagggtagggtagggt 2056



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2028 gggtagggtagggtagggtagggt 2051



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 2023 gggtagggtagggtagggtagggt 2046



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 293  gggtgggtagggtagggtagggtagggt 320
            |||| |||||||||||||||||||||||
Sbjct: 2014 gggtaggtagggtagggtagggtagggt 2041



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1994 gggtagggtagggtagggtagggt 2017



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1989 gggtagggtagggtagggtagggt 2012



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1984 gggtagggtagggtagggtagggt 2007



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1979 gggtagggtagggtagggtagggt 2002



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1974 gggtagggtagggtagggtagggt 1997



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1969 gggtagggtagggtagggtagggt 1992



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1964 gggtagggtagggtagggtagggt 1987



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1959 gggtagggtagggtagggtagggt 1982



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1954 gggtagggtagggtagggtagggt 1977



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1881 gggtagggtagggtagggtagggt 1904



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1876 gggtagggtagggtagggtagggt 1899



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1871 gggtagggtagggtagggtagggt 1894



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1866 gggtagggtagggtagggtagggt 1889



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1861 gggtagggtagggtagggtagggt 1884



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1856 gggtagggtagggtagggtagggt 1879



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1851 gggtagggtagggtagggtagggt 1874



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1846 gggtagggtagggtagggtagggt 1869



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1841 gggtagggtagggtagggtagggt 1864



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1836 gggtagggtagggtagggtagggt 1859



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1831 gggtagggtagggtagggtagggt 1854



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1826 gggtagggtagggtagggtagggt 1849



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 1821 gggtagggtagggtagggtagggt 1844



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 298  ggtagggtagggtagggtagggt 320
            |||||||||||||||||||||||
Sbjct: 1950 ggtagggtagggtagggtagggt 1972



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 297  gggtagggtagggtagggtagg 318
            ||||||||||||||||||||||
Sbjct: 1999 gggtagggtagggtagggtagg 2020



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 1926 gtagggtagggtagggtagggt 1947



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 297  gggtagggtagggtagggtagg 318
            ||||||||||||||||||||||
Sbjct: 1886 gggtagggtagggtagggtagg 1907



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 1818 gtagggtagggtagggtagggt 1839



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 297  gggtagggtagggtagggtag 317
            |||||||||||||||||||||
Sbjct: 2053 gggtagggtagggtagggtag 2073



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||| ||||||||||||||||||
Sbjct: 1944 gggtaaggtagggtagggtagggt 1967



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            |||||||||| |||||||||||||
Sbjct: 1939 gggtagggtaaggtagggtagggt 1962



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||| ||||||||
Sbjct: 1934 gggtagggtagggtaaggtagggt 1957



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 297  gggtagggtagggtagggta 316
            ||||||||||||||||||||
Sbjct: 1929 gggtagggtagggtagggta 1948



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 293  gggtgggtagggtagggtagggta 316
            |||| |||||||||||||||||||
Sbjct: 1901 gggtaggtagggtagggtagggta 1924
to top
>gb|AC161585.2| Mus musculus BAC clone RP24-506J9 from chromosome 13, complete sequence
          Length = 211181

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 104353 gggtagggtagggtagggtagggt 104376



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 104348 gggtagggtagggtagggtagggt 104371



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 298    ggtagggtagggtagggtagggt 320
              |||||||||||||||||||||||
Sbjct: 104344 ggtagggtagggtagggtagggt 104366



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 297    gggtagggtagggtagggtagg 318
              ||||||||||||||||||||||
Sbjct: 104358 gggtagggtagggtagggtagg 104379
to top
>emb|AL365361.12| Human DNA sequence from clone RP11-284N8 on chromosome 1 Contains the
             KCNA2 gene for a potassium voltage-gated channel from the
             shaker-related subfamily member 2, the KCNA3 gene for a
             potassium voltage-gated channel from the shaker-related
             subfamily member 3 and two CpG islands, complete sequence
          Length = 193182

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 23504 gggtagggtagggtagggtagggt 23481



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 298   ggtagggtagggtagggtagg 318
             |||||||||||||||||||||
Sbjct: 23478 ggtagggtagggtagggtagg 23458



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 23505 agggtagggtagggtagggt 23486



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 297   gggtagggtagggtagggta 316
             ||||||||||||||||||||
Sbjct: 23499 gggtagggtagggtagggta 23480



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||| ||||||||
Sbjct: 23494 gggtagggtagggtaaggtagggt 23471



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||| |||||||||||||
Sbjct: 23489 gggtagggtaaggtagggtagggt 23466



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||| ||||||||||||||||||
Sbjct: 23484 gggtaaggtagggtagggtagggt 23461
to top
>emb|AL035405.13|HS21O18 Human DNA sequence from clone RP1-21O18 on chromosome 1p35.1-36.23
              Contains the 3' end of a novel gene (KIAA1026), gene
              FLJ23703, a novel pseudogene, the 5' end of a novel gene
              (FLJ10199), a novel gene and a CpG island, complete
              sequence
          Length = 168853

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 159542 gggtagggtagggtagggtagggt 159519



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 159537 gggtagggtagggtagggtagggt 159514



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 159532 gggtagggtagggtagggtagggt 159509



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 159527 gggtagggtagggtagggtagggt 159504



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 299    gtagggtagggtagggtagggt 320
              ||||||||||||||||||||||
Sbjct: 159545 gtagggtagggtagggtagggt 159524



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 297    gggtagggtagggtagggtag 317
              |||||||||||||||||||||
Sbjct: 159522 gggtagggtagggtagggtag 159502
to top
>emb|AL035671.5|HS420J14 Human DNA sequence from clone RP3-420J14 on chromosome 6p24.1-24.3
              Contains an S-adenosylmethionine decarboxylase 1 (AMD1) (EC
              4.1.1.50, ADOMETDC) pseudogene and a CpG island, complete
              sequence
          Length = 145150

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 115788 gggtagggtagggtagggtagggt 115765



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 115783 gggtagggtagggtagggtagggt 115760



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 115778 gggtagggtagggtagggtagggt 115755



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 115773 gggtagggtagggtagggtagggt 115750



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 115768 gggtagggtagggtagggtagggt 115745



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 115763 gggtagggtagggtagggtagggt 115740



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 115758 gggtagggtagggtagggtagggt 115735



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 115753 gggtagggtagggtagggtagggt 115730



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 297    gggtagggtagggtagggtag 317
              |||||||||||||||||||||
Sbjct: 115748 gggtagggtagggtagggtag 115728



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 301    agggtagggtagggtagggt 320
              ||||||||||||||||||||
Sbjct: 115789 agggtagggtagggtagggt 115770
to top
>gb|AC160113.2| Mus musculus BAC clone RP24-84O12 from chromosome 9, complete sequence
          Length = 223852

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 171772 gggtagggtagggtagggtagggt 171749



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 297    gggtagggtagggtagggtagg 318
              ||||||||||||||||||||||
Sbjct: 171767 gggtagggtagggtagggtagg 171746



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 300    tagggtagggtagggtagggt 320
              |||||||||||||||||||||
Sbjct: 171774 tagggtagggtagggtagggt 171754
to top
>gb|AC124591.4| Mus musculus BAC clone RP23-136G17 from chromosome 8, complete sequence
          Length = 201039

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 140368 gggtagggtagggtagggtagggt 140391



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 140363 gggtagggtagggtagggtagggt 140386



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 140358 gggtagggtagggtagggtagggt 140381



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 297    gggtagggtagggtagggtagg 318
              ||||||||||||||||||||||
Sbjct: 140373 gggtagggtagggtagggtagg 140394



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 299    gtagggtagggtagggtagggt 320
              ||||||||||||||||||||||
Sbjct: 140355 gtagggtagggtagggtagggt 140376
to top
>gb|AC023150.5| Homo sapiens BAC clone RP11-709L9 from 4, complete sequence
          Length = 188782

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 74333 gggtagggtagggtagggtagggt 74310



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 74328 gggtagggtagggtagggtagggt 74305



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 74323 gggtagggtagggtagggtagggt 74300



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 74318 gggtagggtagggtagggtagggt 74295



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 74313 gggtagggtagggtagggtagggt 74290



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 74308 gggtagggtagggtagggtagggt 74285



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 74303 gggtagggtagggtagggtagggt 74280



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 74298 gggtagggtagggtagggtagggt 74275



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 298   ggtagggtagggtagggtagggt 320
             |||||||||||||||||||||||
Sbjct: 74337 ggtagggtagggtagggtagggt 74315



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||| ||||||||||||||||||
Sbjct: 74343 gggtacggtagggtagggtagggt 74320
to top
>gb|AC159378.8| Mus musculus 10 BAC RP23-199N18 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 202745

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 72204 gggtagggtagggtagggtagggt 72181



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 72199 gggtagggtagggtagggtagggt 72176



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 72194 gggtagggtagggtagggtagggt 72171



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 297   gggtagggtagggtagggtaggg 319
             |||||||||||||||||||||||
Sbjct: 72189 gggtagggtagggtagggtaggg 72167
to top
>gb|AC157943.2| Mus musculus BAC clone RP23-467N13 from chromosome 18, complete
             sequence
          Length = 186362

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 93917 gggtagggtagggtagggtagggt 93940



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 93912 gggtagggtagggtagggtagggt 93935



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 93907 gggtagggtagggtagggtagggt 93930



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 93922 gggtagggtagggtagggtagg 93943



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 93905 tagggtagggtagggtagggt 93925



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||||| |||||||||||
Sbjct: 93932 gggtagggtaggatagggtagggt 93955



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||| ||||||
Sbjct: 93927 gggtagggtagggtaggatagggt 93950
to top
>gb|AC159881.2| Mus musculus BAC clone RP24-493B12 from chromosome 9, complete sequence
          Length = 126762

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 47600 gggtagggtagggtagggtagggt 47577



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 47595 gggtagggtagggtagggtagggt 47572



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 47565 gggtagggtagggtagggtagggt 47542



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 47560 gggtagggtagggtagggtagggt 47537



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 47555 gggtagggtagggtagggtagggt 47532



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 297   gggtagggtagggtagggtaggg 319
             |||||||||||||||||||||||
Sbjct: 47590 gggtagggtagggtagggtaggg 47568



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 297   gggtagggtagggtagggtaggg 319
             |||||||||||||||||||||||
Sbjct: 47550 gggtagggtagggtagggtaggg 47528



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||| |||||||||||||||
Sbjct: 47610 gggtagggaagggtagggtagggt 47587



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 47601 agggtagggtagggtagggt 47582



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||||||||||| |||||
Sbjct: 47585 gggtagggtagggtagggaagggt 47562



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||| ||||||||||
Sbjct: 47580 gggtagggtagggaagggtagggt 47557



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||| |||||||||||||||
Sbjct: 47575 gggtagggaagggtagggtagggt 47552



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 47566 agggtagggtagggtagggt 47547
to top
>gb|AC090954.3| Homo sapiens chromosome 3 clone RP11-616M11 map 3p, complete sequence
          Length = 168020

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 36498 gggtagggtagggtagggtagggt 36521



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 36493 gggtagggtagggtagggtagggt 36516



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 36488 gggtagggtagggtagggtagggt 36511



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 36503 gggtagggtagggtagggtagg 36524



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 36486 tagggtagggtagggtagggt 36506
to top
>gb|AC022379.2|AC022379 Homo sapiens chromosome 3 clone 996C6 map 3p, complete sequence
          Length = 222542

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 186188 gggtagggtagggtagggtagggt 186211



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 186183 gggtagggtagggtagggtagggt 186206



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 297    gggtagggtagggtagggtagg 318
              ||||||||||||||||||||||
Sbjct: 186193 gggtagggtagggtagggtagg 186214



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 299    gtagggtagggtagggtagggt 320
              ||||||||||||||||||||||
Sbjct: 186180 gtagggtagggtagggtagggt 186201



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              |||||||||| |||||||||||||
Sbjct: 186273 gggtagggtatggtagggtagggt 186296
to top
>gb|AC159334.9| Mus musculus 10 BAC RP24-369D19 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 171460

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 53234 gggtagggtagggtagggtagggt 53257



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 53229 gggtagggtagggtagggtagggt 53252



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 53224 gggtagggtagggtagggtagggt 53247



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 53189 gggtagggtagggtagggtagggt 53212



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 53184 gggtagggtagggtagggtagggt 53207



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 53179 gggtagggtagggtagggtagggt 53202



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 53174 gggtagggtagggtagggtagggt 53197



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 53169 gggtagggtagggtagggtagggt 53192



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 53069 gggtagggtagggtagggtagggt 53092



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 53064 gggtagggtagggtagggtagggt 53087



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 53074 gggtagggtagggtagggtagg 53095



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 297   gggtagggtagggtagggtag 317
             |||||||||||||||||||||
Sbjct: 53239 gggtagggtagggtagggtag 53259



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 53222 tagggtagggtagggtagggt 53242



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 53167 tagggtagggtagggtagggt 53187



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 297   gggtagggtagggtagggta 316
             ||||||||||||||||||||
Sbjct: 53194 gggtagggtagggtagggta 53213



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||||| |||||||||||
Sbjct: 53129 gggtagggtaggatagggtagggt 53152



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||||| |||||||||||
Sbjct: 53114 gggtagggtaggatagggtagggt 53137



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||||| |||||||||||
Sbjct: 53099 gggtagggtaggatagggtagggt 53122



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||||| |||||||||||
Sbjct: 53084 gggtagggtaggatagggtagggt 53107



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||| ||||||
Sbjct: 53079 gggtagggtagggtaggatagggt 53102
to top
>gb|AC023471.4|AC023471 Homo sapiens chromosome 3 clone RP11-126L9 map 3p, complete sequence
          Length = 192973

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 51726 gggtagggtagggtagggtagggt 51749



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 51721 gggtagggtagggtagggtagggt 51744



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 51731 gggtagggtagggtagggtagg 51752



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 299   gtagggtagggtagggtagggt 320
             ||||||||||||||||||||||
Sbjct: 51718 gtagggtagggtagggtagggt 51739



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||| |||||||||||||
Sbjct: 51811 gggtagggtatggtagggtagggt 51834
to top
>gb|AC006994.4| Homo sapiens BAC clone RP11-396J8 from 2, complete sequence
          Length = 192104

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 120121 gggtagggtagggtagggtagggt 120098



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 299    gtagggtagggtagggtagggt 320
              ||||||||||||||||||||||
Sbjct: 120124 gtagggtagggtagggtagggt 120103



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||| ||||
Sbjct: 120116 gggtagggtagggtagggtggggt 120093
to top
>gb|AC017084.8| Homo sapiens BAC clone RP11-480F1 from 2, complete sequence
          Length = 73297

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 3585 gggtagggtagggtagggtagggt 3562



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||||||||
Sbjct: 3580 gggtagggtagggtagggtagggt 3557



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 297  gggtagggtagggtagggtagg 318
            ||||||||||||||||||||||
Sbjct: 3575 gggtagggtagggtagggtagg 3554



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 300  tagggtagggtagggtagggt 320
            |||||||||||||||||||||
Sbjct: 3587 tagggtagggtagggtagggt 3567



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||| ||||||||||||||||
Sbjct: 3595 gggtaggatagggtagggtagggt 3572
to top
>gb|AC095350.8| Homo sapiens 12 BAC RP11-662M24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 129055

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 119457 gggtagggtagggtagggtagggt 119480



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 119452 gggtagggtagggtagggtagggt 119475



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 119447 gggtagggtagggtagggtagggt 119470



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 119442 gggtagggtagggtagggtagggt 119465



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 297    gggtagggtagggtagggtagg 318
              ||||||||||||||||||||||
Sbjct: 119462 gggtagggtagggtagggtagg 119483



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 300    tagggtagggtagggtagggt 320
              |||||||||||||||||||||
Sbjct: 119440 tagggtagggtagggtagggt 119460
to top
>gb|AC090949.2| Homo sapiens chromosome 3 clone RP11-421B21 map 3p, complete sequence
          Length = 176751

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 30122 gggtagggtagggtagggtagggt 30099



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 30117 gggtagggtagggtagggtagggt 30094



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 30112 gggtagggtagggtagggtagggt 30089



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 30107 gggtagggtagggtagggtagggt 30084



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 30102 gggtagggtagggtagggtagggt 30079



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 30097 gggtagggtagggtagggtagggt 30074



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 30092 gggtagggtagggtagggtagggt 30069



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 30087 gggtagggtagggtagggtagg 30066



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 30124 tagggtagggtagggtagggt 30104
to top
>gb|AC102761.12| Mus musculus chromosome 8, clone RP24-227E21, complete sequence
          Length = 162108

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 21998 gggtagggtagggtagggtagggt 21975



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 21993 gggtagggtagggtagggtagg 21972



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 21999 agggtagggtagggtagggt 21980
to top
>gb|AC147637.3| Mus musculus BAC clone RP23-205M20 from 9, complete sequence
          Length = 211684

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 11540 gggtagggtagggtagggtagggt 11517



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 11487 gggtagggtagggtagggtagggt 11464



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 298   ggtagggtagggtagggtagggt 320
             |||||||||||||||||||||||
Sbjct: 11753 ggtagggtagggtagggtagggt 11731



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 298   ggtagggtagggtagggtagggt 320
             |||||||||||||||||||||||
Sbjct: 11685 ggtagggtagggtagggtagggt 11663



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 298   ggtagggtagggtagggtagggt 320
             |||||||||||||||||||||||
Sbjct: 11612 ggtagggtagggtagggtagggt 11590



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 298   ggtagggtagggtagggtagggt 320
             |||||||||||||||||||||||
Sbjct: 11544 ggtagggtagggtagggtagggt 11522



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 298   ggtagggtagggtagggtagggt 320
             |||||||||||||||||||||||
Sbjct: 11491 ggtagggtagggtagggtagggt 11469



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||| ||||
Sbjct: 11749 gggtagggtagggtagggtggggt 11726



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||| ||||
Sbjct: 11681 gggtagggtagggtagggtggggt 11658



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||| ||||
Sbjct: 11608 gggtagggtagggtagggtggggt 11585



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||| ||||
Sbjct: 11535 gggtagggtagggtagggtggggt 11512



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||| ||||
Sbjct: 11482 gggtagggtagggtagggtggggt 11459
to top
>gb|AC126931.4| Mus musculus BAC clone RP23-389M9 from 9, complete sequence
          Length = 189423

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 964 gggtagggtagggtagggtagggt 987



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 911 gggtagggtagggtagggtagggt 934



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 298 ggtagggtagggtagggtagggt 320
           |||||||||||||||||||||||
Sbjct: 960 ggtagggtagggtagggtagggt 982



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 298 ggtagggtagggtagggtagggt 320
           |||||||||||||||||||||||
Sbjct: 907 ggtagggtagggtagggtagggt 929



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 298 ggtagggtagggtagggtagggt 320
           |||||||||||||||||||||||
Sbjct: 839 ggtagggtagggtagggtagggt 861



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 298 ggtagggtagggtagggtagggt 320
           |||||||||||||||||||||||
Sbjct: 766 ggtagggtagggtagggtagggt 788



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 298 ggtagggtagggtagggtagggt 320
           |||||||||||||||||||||||
Sbjct: 698 ggtagggtagggtagggtagggt 720



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||| ||||
Sbjct: 969 gggtagggtagggtagggtggggt 992



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||| ||||
Sbjct: 916 gggtagggtagggtagggtggggt 939



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||| ||||
Sbjct: 843 gggtagggtagggtagggtggggt 866



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||| ||||
Sbjct: 770 gggtagggtagggtagggtggggt 793



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||| ||||
Sbjct: 702 gggtagggtagggtagggtggggt 725
to top
>emb|CT025537.7| Mouse DNA sequence from clone RP23-454O17 on chromosome 14, complete
             sequence
          Length = 192695

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 62918 gggtagggtagggtagggtagggt 62895



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 62913 gggtagggtagggtagggtagg 62892



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 62919 agggtagggtagggtagggt 62900
to top
>gb|AC114897.43| Mus musculus strain C57BL/6J clone rp23-158e11 map 8, complete sequence
          Length = 202175

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 141042 gggtagggtagggtagggtagggt 141065



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 141037 gggtagggtagggtagggtagggt 141060



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 141032 gggtagggtagggtagggtagggt 141055



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 297    gggtagggtagggtagggtagg 318
              ||||||||||||||||||||||
Sbjct: 141047 gggtagggtagggtagggtagg 141068



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 299    gtagggtagggtagggtagggt 320
              ||||||||||||||||||||||
Sbjct: 141029 gtagggtagggtagggtagggt 141050
to top
>gb|AC155652.25| Mus musculus 6 BAC RP24-480I7 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 121680

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 85121 gggtagggtagggtagggtagggt 85144



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 297   gggtagggtagggtagggtaggg 319
             |||||||||||||||||||||||
Sbjct: 85126 gggtagggtagggtagggtaggg 85148
to top
>emb|AL845325.10| Mouse DNA sequence from clone RP23-32O9 on chromosome 2, complete
             sequence
          Length = 129024

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 66786 gggtagggtagggtagggtagggt 66809



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 66781 gggtagggtagggtagggtagggt 66804



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 66776 gggtagggtagggtagggtagggt 66799



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 66771 gggtagggtagggtagggtagggt 66794



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 66766 gggtagggtagggtagggtagggt 66789



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 66791 gggtagggtagggtagggtagg 66812



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 66765 agggtagggtagggtagggt 66784
to top
>emb|AL929320.7| Mouse DNA sequence from clone RP24-160E2 on chromosome 4, complete
             sequence
          Length = 115895

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 96987 gggtagggtagggtagggtagggt 97010



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 96982 gggtagggtagggtagggtagggt 97005



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 96977 gggtagggtagggtagggtagggt 97000



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 96972 gggtagggtagggtagggtagggt 96995



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 96992 gggtagggtagggtagggtagg 97013



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 96970 tagggtagggtagggtagggt 96990
to top
>emb|AL929122.8| Mouse DNA sequence from clone RP23-174L3 on chromosome X, complete
             sequence
          Length = 165675

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 59972 gggtagggtagggtagggtagggt 59949



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 59967 gggtagggtagggtagggtagggt 59944



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||||||||
Sbjct: 59962 gggtagggtagggtagggtagggt 59939



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 297   gggtagggtagggtagggtag 317
             |||||||||||||||||||||
Sbjct: 59957 gggtagggtagggtagggtag 59937



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 59973 agggtagggtagggtagggt 59954
to top
>gb|AC117789.17| Mus musculus chromosome 1, clone RP24-548D18, complete sequence
          Length = 180733

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 119999 gggtagggtagggtagggtagggt 120022



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 298    ggtagggtagggtagggtagggt 320
              |||||||||||||||||||||||
Sbjct: 119995 ggtagggtagggtagggtagggt 120017



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 297    gggtagggtagggtagggtagg 318
              ||||||||||||||||||||||
Sbjct: 120004 gggtagggtagggtagggtagg 120025
to top
>gb|AC027128.5| Homo sapiens chromosome 3 clone RP11-627C1 map 3p, complete sequence
          Length = 175773

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 101855 gggtagggtagggtagggtagggt 101832



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||||||||
Sbjct: 101850 gggtagggtagggtagggtagggt 101827



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 299    gtagggtagggtagggtagggt 320
              ||||||||||||||||||||||
Sbjct: 101858 gtagggtagggtagggtagggt 101837



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 297    gggtagggtagggtagggtagg 318
              ||||||||||||||||||||||
Sbjct: 101845 gggtagggtagggtagggtagg 101824



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              |||||||||| |||||||||||||
Sbjct: 101765 gggtagggtatggtagggtagggt 101742
to top
>gb|M73428.1|GIARGSMTEL Giardia lamblia telomeric repeat region adjacent to small subunit
           ribosomal RNA gene
          Length = 646

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 619 gggtagggtagggtagggtagggt 642



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 614 gggtagggtagggtagggtagggt 637



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 609 gggtagggtagggtagggtagggt 632



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 604 gggtagggtagggtagggtagggt 627



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 599 gggtagggtagggtagggtagggt 622



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 594 gggtagggtagggtagggtagggt 617



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 589 gggtagggtagggtagggtagggt 612



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 584 gggtagggtagggtagggtagggt 607



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 579 gggtagggtagggtagggtagggt 602



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 574 gggtagggtagggtagggtagggt 597



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 569 gggtagggtagggtagggtagggt 592



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 564 gggtagggtagggtagggtagggt 587



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 559 gggtagggtagggtagggtagggt 582



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 554 gggtagggtagggtagggtagggt 577



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 549 gggtagggtagggtagggtagggt 572



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 544 gggtagggtagggtagggtagggt 567



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 539 gggtagggtagggtagggtagggt 562



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 534 gggtagggtagggtagggtagggt 557



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 529 gggtagggtagggtagggtagggt 552



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 524 gggtagggtagggtagggtagggt 547



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 519 gggtagggtagggtagggtagggt 542



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 514 gggtagggtagggtagggtagggt 537



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 509 gggtagggtagggtagggtagggt 532



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 504 gggtagggtagggtagggtagggt 527



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 499 gggtagggtagggtagggtagggt 522



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 494 gggtagggtagggtagggtagggt 517



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 489 gggtagggtagggtagggtagggt 512



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 484 gggtagggtagggtagggtagggt 507



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 479 gggtagggtagggtagggtagggt 502



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 474 gggtagggtagggtagggtagggt 497



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 469 gggtagggtagggtagggtagggt 492



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 464 gggtagggtagggtagggtagggt 487



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 459 gggtagggtagggtagggtagggt 482



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 454 gggtagggtagggtagggtagggt 477



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 449 gggtagggtagggtagggtagggt 472



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 444 gggtagggtagggtagggtagggt 467



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 439 gggtagggtagggtagggtagggt 462



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 434 gggtagggtagggtagggtagggt 457



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 429 gggtagggtagggtagggtagggt 452



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 424 gggtagggtagggtagggtagggt 447



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 419 gggtagggtagggtagggtagggt 442



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 414 gggtagggtagggtagggtagggt 437



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 409 gggtagggtagggtagggtagggt 432



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 404 gggtagggtagggtagggtagggt 427



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 399 gggtagggtagggtagggtagggt 422



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 394 gggtagggtagggtagggtagggt 417



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 389 gggtagggtagggtagggtagggt 412



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 384 gggtagggtagggtagggtagggt 407



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 379 gggtagggtagggtagggtagggt 402



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 374 gggtagggtagggtagggtagggt 397



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 369 gggtagggtagggtagggtagggt 392



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 364 gggtagggtagggtagggtagggt 387



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 359 gggtagggtagggtagggtagggt 382



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 354 gggtagggtagggtagggtagggt 377



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 349 gggtagggtagggtagggtagggt 372



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 344 gggtagggtagggtagggtagggt 367



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 339 gggtagggtagggtagggtagggt 362



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 334 gggtagggtagggtagggtagggt 357



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 329 gggtagggtagggtagggtagggt 352



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 324 gggtagggtagggtagggtagggt 347



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 319 gggtagggtagggtagggtagggt 342



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 314 gggtagggtagggtagggtagggt 337



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 309 gggtagggtagggtagggtagggt 332



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 304 gggtagggtagggtagggtagggt 327



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 299 gggtagggtagggtagggtagggt 322



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 294 gggtagggtagggtagggtagggt 317



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 289 gggtagggtagggtagggtagggt 312



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 284 gggtagggtagggtagggtagggt 307



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 279 gggtagggtagggtagggtagggt 302



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 274 gggtagggtagggtagggtagggt 297



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 269 gggtagggtagggtagggtagggt 292



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 264 gggtagggtagggtagggtagggt 287



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 259 gggtagggtagggtagggtagggt 282



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 254 gggtagggtagggtagggtagggt 277



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 249 gggtagggtagggtagggtagggt 272



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 244 gggtagggtagggtagggtagggt 267



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 239 gggtagggtagggtagggtagggt 262



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 234 gggtagggtagggtagggtagggt 257



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 229 gggtagggtagggtagggtagggt 252



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 224 gggtagggtagggtagggtagggt 247



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 219 gggtagggtagggtagggtagggt 242



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 214 gggtagggtagggtagggtagggt 237



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 209 gggtagggtagggtagggtagggt 232



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 204 gggtagggtagggtagggtagggt 227



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 199 gggtagggtagggtagggtagggt 222



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 194 gggtagggtagggtagggtagggt 217



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 189 gggtagggtagggtagggtagggt 212



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 184 gggtagggtagggtagggtagggt 207



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 179 gggtagggtagggtagggtagggt 202



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 174 gggtagggtagggtagggtagggt 197



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 169 gggtagggtagggtagggtagggt 192



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 164 gggtagggtagggtagggtagggt 187



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 159 gggtagggtagggtagggtagggt 182



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 154 gggtagggtagggtagggtagggt 177



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 149 gggtagggtagggtagggtagggt 172



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 144 gggtagggtagggtagggtagggt 167



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 139 gggtagggtagggtagggtagggt 162



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 134 gggtagggtagggtagggtagggt 157



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 129 gggtagggtagggtagggtagggt 152



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 124 gggtagggtagggtagggtagggt 147



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 119 gggtagggtagggtagggtagggt 142



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 114 gggtagggtagggtagggtagggt 137



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 109 gggtagggtagggtagggtagggt 132



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 104 gggtagggtagggtagggtagggt 127



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 99  gggtagggtagggtagggtagggt 122



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 94  gggtagggtagggtagggtagggt 117



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 65  gggtagggtagggtagggtagggt 88



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 60  gggtagggtagggtagggtagggt 83



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 55  gggtagggtagggtagggtagggt 78



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 50  gggtagggtagggtagggtagggt 73



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 45  gggtagggtagggtagggtagggt 68



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 40  gggtagggtagggtagggtagggt 63



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 297 gggtagggtagggtagggtaggg 319
           |||||||||||||||||||||||
Sbjct: 624 gggtagggtagggtagggtaggg 646



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 298 ggtagggtagggtagggtagggt 320
           |||||||||||||||||||||||
Sbjct: 36  ggtagggtagggtagggtagggt 58



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 299 gtagggtagggtagggtagggt 320
           ||||||||||||||||||||||
Sbjct: 91  gtagggtagggtagggtagggt 112



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 297 gggtagggtagggtagggta 316
           ||||||||||||||||||||
Sbjct: 70  gggtagggtagggtagggta 89
to top
>gb|M73429.1|GIARGBM Giardia lamblia telomeric repeat region adjacent to large subunit
           ribosomal RNA gene
          Length = 243

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 216 gggtagggtagggtagggtagggt 239



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 211 gggtagggtagggtagggtagggt 234



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 206 gggtagggtagggtagggtagggt 229



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 201 gggtagggtagggtagggtagggt 224



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 196 gggtagggtagggtagggtagggt 219



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 191 gggtagggtagggtagggtagggt 214



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 186 gggtagggtagggtagggtagggt 209



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 181 gggtagggtagggtagggtagggt 204



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 176 gggtagggtagggtagggtagggt 199



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 171 gggtagggtagggtagggtagggt 194



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 166 gggtagggtagggtagggtagggt 189



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 161 gggtagggtagggtagggtagggt 184



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 156 gggtagggtagggtagggtagggt 179



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 151 gggtagggtagggtagggtagggt 174



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 146 gggtagggtagggtagggtagggt 169



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 141 gggtagggtagggtagggtagggt 164



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 136 gggtagggtagggtagggtagggt 159



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 131 gggtagggtagggtagggtagggt 154



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 126 gggtagggtagggtagggtagggt 149



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 121 gggtagggtagggtagggtagggt 144



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 116 gggtagggtagggtagggtagggt 139



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 111 gggtagggtagggtagggtagggt 134



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 106 gggtagggtagggtagggtagggt 129



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 101 gggtagggtagggtagggtagggt 124



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 96  gggtagggtagggtagggtagggt 119



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 91  gggtagggtagggtagggtagggt 114



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 86  gggtagggtagggtagggtagggt 109



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 81  gggtagggtagggtagggtagggt 104



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 76  gggtagggtagggtagggtagggt 99



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 71  gggtagggtagggtagggtagggt 94



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 66  gggtagggtagggtagggtagggt 89



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 61  gggtagggtagggtagggtagggt 84



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 56  gggtagggtagggtagggtagggt 79



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 51  gggtagggtagggtagggtagggt 74



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 46  gggtagggtagggtagggtagggt 69



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 297 gggtagggtagggtagggtagggt 320
           ||||||||||||||||||||||||
Sbjct: 41  gggtagggtagggtagggtagggt 64



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 297 gggtagggtagggtagggtaggg 319
           |||||||||||||||||||||||
Sbjct: 221 gggtagggtagggtagggtaggg 243



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 agggtagggtagggtagggt 320
           ||||||||||||||||||||
Sbjct: 40  agggtagggtagggtagggt 59
to top
>gb|AC128571.4| Rattus norvegicus 6 BAC CH230-424O13 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 194127

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 299    gtagggtagggtagggtagggtc 321
              |||||||||||||||||||||||
Sbjct: 120030 gtagggtagggtagggtagggtc 120052
to top
>emb|AL590607.1|SPCPB1C11 S.pombe chromosome III BAC pB1C11
          Length = 13933

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 298  ggtagggtagggtagggtagggt 320
            |||||||||||||||||||||||
Sbjct: 1943 ggtagggtagggtagggtagggt 1921



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 297  gggtagggtagggtagggta 316
            ||||||||||||||||||||
Sbjct: 1939 gggtagggtagggtagggta 1920
to top
>emb|AJ271736.1|HSA271736 Homo sapiens Xq pseudoautosomal region; segment 2/2
          Length = 158661

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 297    gggtagggtagggtagggtaggg 319
              |||||||||||||||||||||||
Sbjct: 158095 gggtagggtagggtagggtaggg 158117



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 300    tagggtagggtagggtagggt 320
              |||||||||||||||||||||
Sbjct: 158093 tagggtagggtagggtagggt 158113
to top
>emb|CR382344.9| Zebrafish DNA sequence from clone DKEY-150D12 in linkage group 8,
             complete sequence
          Length = 182390

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 297   gggtagggtagggtagggtaggg 319
             |||||||||||||||||||||||
Sbjct: 75244 gggtagggtagggtagggtaggg 75222



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 75246 tagggtagggtagggtagggt 75226
to top
>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 298    ggtagggtagggtagggtagggt 320
              |||||||||||||||||||||||
Sbjct: 144363 ggtagggtagggtagggtagggt 144341



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||| ||||
Sbjct: 144359 gggtagggtagggtagggttgggt 144336
to top
>emb|BX465187.7| Zebrafish DNA sequence from clone DKEYP-6C7 in linkage group 20,
            complete sequence
          Length = 168640

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 298  ggtagggtagggtagggtagggt 320
            |||||||||||||||||||||||
Sbjct: 8647 ggtagggtagggtagggtagggt 8625
to top
>gb|M57752.1|HUMTARSTB3 Human telomere associated repeat sequence, complete sequence
          Length = 4408

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 297  gggtagggtagggtagggtaggg 319
            |||||||||||||||||||||||
Sbjct: 3842 gggtagggtagggtagggtaggg 3864



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 300  tagggtagggtagggtagggt 320
            |||||||||||||||||||||
Sbjct: 3840 tagggtagggtagggtagggt 3860
to top
>gb|AY731363.1| Zea mays cultivar F2834HT promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 875

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 720 ggtagggtagggtagggtaggg 699
to top
>gb|AY731362.1| Zea mays cultivar FI137TN promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 876

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 721 ggtagggtagggtagggtaggg 700
to top
>gb|AY731361.1| Zea mays cultivar KUI43 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 882

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 727 ggtagggtagggtagggtaggg 706
to top
>gb|AY731358.1| Zea mays cultivar TX601 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 887

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 719 ggtagggtagggtagggtaggg 698
to top
>gb|AY731357.1| Zea mays cultivar SC213R promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 889

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 721 ggtagggtagggtagggtaggg 700
to top
>gb|AY731356.1| Zea mays cultivar Ci187-2 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 894

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 726 ggtagggtagggtagggtaggg 705
to top
>gb|AY731355.1| Zea mays cultivar CML247 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 901

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 733 ggtagggtagggtagggtaggg 712
to top
>gb|AY731354.1| Zea mays cultivar CML91 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 847

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 679 ggtagggtagggtagggtaggg 658
to top
>gb|AY731351.1| Zea mays cultivar SG18 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 885

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 721 ggtagggtagggtagggtaggg 700
to top
>gb|AY731350.1| Zea mays cultivar SC55 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 893

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 725 ggtagggtagggtagggtaggg 704
to top
>gb|AY731348.1| Zea mays cultivar MS153 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 891

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 723 ggtagggtagggtagggtaggg 702
to top
>gb|AY731347.1| Zea mays cultivar KUI11 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 893

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 725 ggtagggtagggtagggtaggg 704
to top
>gb|AY731346.1| Zea mays cultivar H99 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 892

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 724 ggtagggtagggtagggtaggg 703
to top
>gb|AY731345.1| Zea mays cultivar F7 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 898

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 730 ggtagggtagggtagggtaggg 709
to top
>gb|AY731344.1| Zea mays cultivar T232 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 894

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 726 ggtagggtagggtagggtaggg 705
to top
>gb|AY731340.1| Zea mays cultivar NC354 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 835

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 668 ggtagggtagggtagggtaggg 647
to top
>gb|AY731339.1| Zea mays cultivar ND246 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 832

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 665 ggtagggtagggtagggtaggg 644
to top
>gb|AY731338.1| Zea mays cultivar F44 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 836

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 668 ggtagggtagggtagggtaggg 647
to top
>gb|AY731337.1| Zea mays cultivar N192 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 832

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 664 ggtagggtagggtagggtaggg 643
to top
>gb|AY731336.1| Zea mays cultivar GE37 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 833

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 665 ggtagggtagggtagggtaggg 644
to top
>gb|AY731335.1| Zea mays cultivar CMV3 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 832

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 664 ggtagggtagggtagggtaggg 643
to top
>gb|AY731334.1| Zea mays cultivar A441-5 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 837

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 669 ggtagggtagggtagggtaggg 648
to top
>gb|AY731333.1| Zea mays cultivar CM174 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 832

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 664 ggtagggtagggtagggtaggg 643
to top
>gb|AY731332.1| Zea mays cultivar B84 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 832

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 664 ggtagggtagggtagggtaggg 643
to top
>gb|AY731331.1| Zea mays cultivar A619 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 834

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 666 ggtagggtagggtagggtaggg 645
to top
>gb|AY731330.1| Zea mays cultivar B73 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 811

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 643 ggtagggtagggtagggtaggg 622
to top
>gb|AY731329.1| Zea mays cultivar B68 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 831

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 663 ggtagggtagggtagggtaggg 642
to top
>gb|AY731328.1| Zea mays cultivar B14A promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 833

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 665 ggtagggtagggtagggtaggg 644
to top
>gb|AY731324.1| Zea mays cultivar B103 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 881

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 717 ggtagggtagggtagggtaggg 696
to top
>gb|AY731322.1| Zea mays cultivar A272 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 889

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 721 ggtagggtagggtagggtaggg 700
to top
>gb|AY731321.1| Zea mays cultivar 4Co63 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 881

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 717 ggtagggtagggtagggtaggg 696
to top
>gb|AY731320.1| Zea mays cultivar B97 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 883

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 715 ggtagggtagggtagggtaggg 694
to top
>gb|AY731319.1| Zea mays cultivar W64A promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 883

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 715 ggtagggtagggtagggtaggg 694
to top
>gb|AY731318.1| Zea mays cultivar W182B promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 884

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 716 ggtagggtagggtagggtaggg 695
to top
>gb|AY731314.1| Zea mays cultivar Tzi18 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 863

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 695 ggtagggtagggtagggtaggg 674
to top
>gb|AY731313.1| Zea mays cultivar SA24 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 891

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 723 ggtagggtagggtagggtaggg 702
to top
>gb|AY731312.1| Zea mays cultivar PA91 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 881

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 726 ggtagggtagggtagggtaggg 705
to top
>gb|AY731311.1| Zea mays cultivar WF9 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 881

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 726 ggtagggtagggtagggtaggg 705
to top
>gb|AY731310.1| Zea mays cultivar A554 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 876

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 721 ggtagggtagggtagggtaggg 700
to top
>gb|AY731308.1| Zea mays cultivar NC7A promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 884

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 716 ggtagggtagggtagggtaggg 695
to top
>gb|AY731306.1| Zea mays cultivar NC350 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 866

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 698 ggtagggtagggtagggtaggg 677
to top
>gb|AY731304.1| Zea mays cultivar NC338 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 886

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 718 ggtagggtagggtagggtaggg 697
to top
>gb|AY731301.1| Zea mays cultivar NC296 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 864

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 696 ggtagggtagggtagggtaggg 675
to top
>gb|AY731300.1| Zea mays cultivar NC260 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 882

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 718 ggtagggtagggtagggtaggg 697
to top
>gb|AY731299.1| Zea mays cultivar NC250 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 881

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 717 ggtagggtagggtagggtaggg 696
to top
>gb|AY731298.1| Zea mays cultivar N28HT promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 883

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 715 ggtagggtagggtagggtaggg 694
to top
>gb|AY731297.1| Zea mays cultivar Mo20W promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 885

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 717 ggtagggtagggtagggtaggg 696
to top
>gb|AY731295.1| Zea mays cultivar GT119 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 890

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 722 ggtagggtagggtagggtaggg 701
to top
>gb|AY731294.1| Zea mays cultivar Mo6 promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 882

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 715 ggtagggtagggtagggtaggg 694
to top
>gb|AY731290.1| Zea mays cultivar IL677A promoter region (whp1) gene, complete
           sequence; and white pollen 1 chalcone synthase (whp1)
           gene, exon 1 and partial cds
          Length = 877

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 713 ggtagggtagggtagggtaggg 692
to top
>ref|XM_508643.1| PREDICTED: Pan troglodytes similar to Beta-arrestin 1 (Arrestin, beta
            1) (LOC451424), mRNA
          Length = 1773

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 446  cagtgtcatcagcctcttccat 467
            ||||||||||||||||||||||
Sbjct: 1555 cagtgtcatcagcctcttccat 1534
to top
>gb|DQ098921.1| Giardia intestinalis clone MJ3348 subtelomeric region (STR) 1
            sequence
          Length = 2227

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 299  gtagggtagggtagggtagggt 320
            ||||||||||||||||||||||
Sbjct: 2205 gtagggtagggtagggtagggt 2226



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 297  gggtagggtagggtagggta 316
            ||||||||||||||||||||
Sbjct: 2208 gggtagggtagggtagggta 2227
to top
>gb|AC164700.3| Mus musculus BAC clone RP24-548M16 from chromosome 5, complete sequence
          Length = 212172

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 299   gtagggtagggtagggtagggt 320
             ||||||||||||||||||||||
Sbjct: 67859 gtagggtagggtagggtagggt 67838



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 297   gggtagggtagggtagggtag 317
             |||||||||||||||||||||
Sbjct: 67856 gggtagggtagggtagggtag 67836



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||||||||| |||||||
Sbjct: 67851 gggtagggtagggtagagtagggt 67828



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||| ||||||||||||
Sbjct: 67846 gggtagggtagagtagggtagggt 67823
to top
>gb|AC161808.8| Mus musculus chromosome 5, clone RP24-386J15, complete sequence
          Length = 184815

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 199    acaagcacagtactgagggcct 220
              ||||||||||||||||||||||
Sbjct: 113246 acaagcacagtactgagggcct 113267
to top
>gb|AY484588.1| Musa acuminata clone MuG9, genomic sequence
          Length = 73268

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 297  gggtagggtagggtagggtagg 318
            ||||||||||||||||||||||
Sbjct: 7752 gggtagggtagggtagggtagg 7773



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 300  tagggtagggtagggtagggt 320
            |||||||||||||||||||||
Sbjct: 7750 tagggtagggtagggtagggt 7770



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 296  tgggtagggtagggtagggtagggt 320
            ||||||||||||| |||||||||||
Sbjct: 7736 tgggtagggtaggatagggtagggt 7760



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||| ||||||||||||||||
Sbjct: 7742 gggtaggatagggtagggtagggt 7765
to top
>gb|AC108755.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone
             OSJNBa0028C22, complete sequence
          Length = 154228

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 76025 gggtagggtagggtagggtagg 76046
to top
>ref|NM_020251.2| Homo sapiens arrestin, beta 1 (ARRB1), transcript variant 2, mRNA
          Length = 2180

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 446  cagtgtcatcagcctcttccat 467
            ||||||||||||||||||||||
Sbjct: 1006 cagtgtcatcagcctcttccat 985
to top
>ref|NM_004041.3| Homo sapiens arrestin, beta 1 (ARRB1), transcript variant 1, mRNA
          Length = 2204

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 446  cagtgtcatcagcctcttccat 467
            ||||||||||||||||||||||
Sbjct: 1006 cagtgtcatcagcctcttccat 985
to top
>gb|BC003636.2| Homo sapiens arrestin, beta 1, transcript variant 1, mRNA (cDNA
           clone MGC:4082 IMAGE:3604829), complete cds
          Length = 1965

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 446 cagtgtcatcagcctcttccat 467
           ||||||||||||||||||||||
Sbjct: 861 cagtgtcatcagcctcttccat 840
to top
>gb|AC127027.13| Mus musculus chromosome 5, clone RP23-236G19, complete sequence
          Length = 195654

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 199  acaagcacagtactgagggcct 220
            ||||||||||||||||||||||
Sbjct: 9411 acaagcacagtactgagggcct 9432
to top
>gb|AC125534.4| Mus musculus BAC clone RP23-460A22 from chromosome 13, complete sequence
          Length = 181040

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 299    gtagggtagggtagggtagggt 320
              ||||||||||||||||||||||
Sbjct: 118390 gtagggtagggtagggtagggt 118411



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||| ||||||||||||||
Sbjct: 118363 gggtagggttgggtagggtagggt 118386
to top
>gb|AC118613.8| Mus musculus chromosome 6, clone RP23-442E2, complete sequence
          Length = 256556

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 299    gtagggtagggtagggtagggt 320
              ||||||||||||||||||||||
Sbjct: 206225 gtagggtagggtagggtagggt 206246



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 297    gggtagggtagggtagggtag 317
              |||||||||||||||||||||
Sbjct: 206228 gggtagggtagggtagggtag 206248



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              |||||| |||||||||||||||||
Sbjct: 206218 gggtagcgtagggtagggtagggt 206241
to top
>emb|AL031905.7|HS460D19 Human DNA sequence from clone RP3-460D19 on chromosome 6p21.2-22.1
             Contains part of the gene for a novel protein (contains
             KIAA1880 and FLJ32945), complete sequence
          Length = 98864

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 294   ggtgggtagggtagggtagggt 315
             ||||||||||||||||||||||
Sbjct: 92087 ggtgggtagggtagggtagggt 92108
to top
>emb|X60204.1|ZMWHPCS Z.mays whp (white pollen) gene for chalcone synthase
          Length = 4069

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 ggtagggtagggtagggtaggg 319
           ||||||||||||||||||||||
Sbjct: 740 ggtagggtagggtagggtaggg 719
to top
>emb|CR620471.1| full-length cDNA clone CS0DI035YC13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1631

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 446 cagtgtcatcagcctcttccat 467
           ||||||||||||||||||||||
Sbjct: 813 cagtgtcatcagcctcttccat 792
to top
>emb|CR613470.1| full-length cDNA clone CS0DD005YC21 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1826

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 446 cagtgtcatcagcctcttccat 467
           ||||||||||||||||||||||
Sbjct: 840 cagtgtcatcagcctcttccat 819
to top
>emb|CR612323.1| full-length cDNA clone CS0DI058YK20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1727

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 446 cagtgtcatcagcctcttccat 467
           ||||||||||||||||||||||
Sbjct: 877 cagtgtcatcagcctcttccat 856
to top
>emb|CR604964.1| full-length cDNA clone CS0DC027YG05 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1735

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 446 cagtgtcatcagcctcttccat 467
           ||||||||||||||||||||||
Sbjct: 882 cagtgtcatcagcctcttccat 861
to top
>emb|CR604447.1| full-length cDNA clone CS0DI063YM22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1427

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 446 cagtgtcatcagcctcttccat 467
           ||||||||||||||||||||||
Sbjct: 414 cagtgtcatcagcctcttccat 393
to top
>emb|CR596009.1| full-length cDNA clone CS0DC029YB06 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1713

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 446 cagtgtcatcagcctcttccat 467
           ||||||||||||||||||||||
Sbjct: 837 cagtgtcatcagcctcttccat 816
to top
>gb|AC104298.2| Homo sapiens chromosome 3 clone RP11-96N5, complete sequence
          Length = 175317

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 95     tatacaactacatctcagactc 116
              ||||||||||||||||||||||
Sbjct: 109628 tatacaactacatctcagactc 109607
to top
>gb|DQ380826.1| Arhopala epimuta clone AEP037 microsatellite sequence
          Length = 491

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 gtagggtagggtagggtagggt 320
           ||||||||||||||||||||||
Sbjct: 259 gtagggtagggtagggtagggt 238
to top
>dbj|AB169682.1| Macaca fascicularis brain cDNA, clone: QccE-17776, similar to human
           arrestin, beta 1 (ARRB1), transcript variant 2, mRNA,
           RefSeq: NM_020251.1
          Length = 1948

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 446 cagtgtcatcagcctcttccat 467
           ||||||||||||||||||||||
Sbjct: 839 cagtgtcatcagcctcttccat 818
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 297      gggtagggtagggtagggtagg 318
                ||||||||||||||||||||||
Sbjct: 19748758 gggtagggtagggtagggtagg 19748779
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 297     gggtagggtagggtagggtagg 318
               ||||||||||||||||||||||
Sbjct: 3938583 gggtagggtagggtagggtagg 3938562
to top
>gb|AC010203.14| Homo sapiens 12 BAC RP11-175P13 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 167569

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 300   tagggtagggtagggtagggtc 321
             ||||||||||||||||||||||
Sbjct: 38802 tagggtagggtagggtagggtc 38823
to top
>dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0035I03
          Length = 153749

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 44459 gggtagggtagggtagggtagg 44438
to top
>dbj|AP006756.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0450E05
          Length = 176553

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 94444 gggtagggtagggtagggtagg 94465
to top
>gb|AC154016.2| Mus musculus 6 BAC RP24-146M9 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 159862

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 299    gtagggtagggtagggtagggt 320
              ||||||||||||||||||||||
Sbjct: 114289 gtagggtagggtagggtagggt 114268



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 297    gggtagggtagggtagggtag 317
              |||||||||||||||||||||
Sbjct: 114286 gggtagggtagggtagggtag 114266



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              |||||| |||||||||||||||||
Sbjct: 114296 gggtagcgtagggtagggtagggt 114273
to top
>gb|AC002378.1|AC002378 Human PAC clone RP3-438O4 from 22q12.1-qter, complete sequence
          Length = 77516

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 23041 gggtagggtagggtagggtagg 23020



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 23042 agggtagggtagggtagggt 23023
to top
>dbj|AK065263.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002K06, full
           insert sequence
          Length = 1940

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 297 gggtagggtagggtagggtagg 318
           ||||||||||||||||||||||
Sbjct: 52  gggtagggtagggtagggtagg 73
to top
>emb|CR405682.23| Zebrafish DNA sequence from clone DKEYP-67E6 in linkage group 12,
             complete sequence
          Length = 192457

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 297   gggtagggtagggtagggtagg 318
             ||||||||||||||||||||||
Sbjct: 74348 gggtagggtagggtagggtagg 74369



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   tagggtagggtagggtagggtcggac 325
             ||||||||||||||||||||| ||||
Sbjct: 74346 tagggtagggtagggtagggtaggac 74371



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 73766 tagggtagggtagggtagggt 73786



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||| ||||||||
Sbjct: 73773 gggtagggtagggtaaggtagggt 73796



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 297   gggtagggtagggtagggta 316
             ||||||||||||||||||||
Sbjct: 73768 gggtagggtagggtagggta 73787
to top
>dbj|AB095006.1| Triticum aestivum Wcor15 gene for chloroplast-targeted COR protein,
            complete cds
          Length = 4549

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 292  tgggtgggtagggtagggtagg 313
            ||||||||||||||||||||||
Sbjct: 2708 tgggtgggtagggtagggtagg 2687
to top
>gb|AC104548.6| Mus musculus chromosome 5, clone RP24-83N12, complete sequence
          Length = 214247

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 299   gtagggtagggtagggtagggt 320
             ||||||||||||||||||||||
Sbjct: 79764 gtagggtagggtagggtagggt 79785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 297   gggtagggtagggtagggtag 317
             |||||||||||||||||||||
Sbjct: 79767 gggtagggtagggtagggtag 79787



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||| ||||||||||||
Sbjct: 79777 gggtagggtagagtagggtagggt 79800



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             |||||||||||||||| |||||||
Sbjct: 79772 gggtagggtagggtagagtagggt 79795
to top
>gb|AF084940.1|AF084940 Homo sapiens beta-arrestin 1B mRNA, complete cds
          Length = 1277

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 446 cagtgtcatcagcctcttccat 467
           ||||||||||||||||||||||
Sbjct: 784 cagtgtcatcagcctcttccat 763
to top
>gb|AF084040.1|AF084040 Homo sapiens beta-arrestin 1A mRNA, complete cds
          Length = 1301

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 446 cagtgtcatcagcctcttccat 467
           ||||||||||||||||||||||
Sbjct: 784 cagtgtcatcagcctcttccat 763
to top
>gb|L04685.1|HUMARR1A Homo sapiens beta-arrestin 1 mRNA, 5` end
          Length = 1254

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 446 cagtgtcatcagcctcttccat 467
           ||||||||||||||||||||||
Sbjct: 784 cagtgtcatcagcctcttccat 763
to top
>gb|AC009206.21| Drosophila melanogaster clone BACR15A11, complete sequence
          Length = 195221

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 71410 tagggtagggtagggtagggt 71390



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 297   gggtagggtagggtagggta 316
             ||||||||||||||||||||
Sbjct: 71408 gggtagggtagggtagggta 71389
to top
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 431    tgacgatggccggggcagtgt 451
              |||||||||||||||||||||
Sbjct: 727866 tgacgatggccggggcagtgt 727886
to top
>gb|AC164156.2| Mus musculus BAC clone RP24-549I8 from chromosome 1, complete sequence
          Length = 173764

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 295   gtgggtagggtagggtagggt 315
             |||||||||||||||||||||
Sbjct: 56977 gtgggtagggtagggtagggt 56957
to top
>gb|AC006372.2| Homo sapiens BAC clone RP11-331D5 from 7, complete sequence
          Length = 190846

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 287    cctgctgggtgggtagggtagggtagggt 315
              ||||||||||||||||||| || ||||||
Sbjct: 166164 cctgctgggtgggtagggtgggatagggt 166192
to top
>gb|AC127231.4| Mus musculus BAC clone RP24-554M18 from chromosome 18, complete
             sequence
          Length = 140817

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 296   tgggtagggtagggtagggtagggt 320
             ||||| |||||||||||||||||||
Sbjct: 27964 tgggttgggtagggtagggtagggt 27940



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 296   tgggtagggtagggtagggtagggt 320
             |||||||||||||||||||| ||||
Sbjct: 27959 tgggtagggtagggtagggttgggt 27935
to top
>gb|DQ144902.1| Ascocalyx abietina strain FIN3-M1-T6 multiallelic marker GAAA1000
           sequence
          Length = 598

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 ggtagggtagggtagggtagg 318
           |||||||||||||||||||||
Sbjct: 259 ggtagggtagggtagggtagg 279
to top
>gb|DQ144901.1| Ascocalyx abietina strain FIN3-M1-T5 multiallelic marker GAAA1000
           sequence
          Length = 587

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 ggtagggtagggtagggtagg 318
           |||||||||||||||||||||
Sbjct: 258 ggtagggtagggtagggtagg 278
to top
>gb|DQ144900.1| Ascocalyx abietina strain FIN3-M1-T3 multiallelic marker GAAA1000
           sequence
          Length = 587

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 ggtagggtagggtagggtagg 318
           |||||||||||||||||||||
Sbjct: 258 ggtagggtagggtagggtagg 278
to top
>gb|DQ144899.1| Ascocalyx abietina strain FIN3-M1-T2 multiallelic marker GAAA1000
           sequence
          Length = 598

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 ggtagggtagggtagggtagg 318
           |||||||||||||||||||||
Sbjct: 259 ggtagggtagggtagggtagg 279
to top
>gb|DQ144898.1| Ascocalyx abietina strain FIN3-M1-T1 multiallelic marker GAAA1000
           sequence
          Length = 598

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 ggtagggtagggtagggtagg 318
           |||||||||||||||||||||
Sbjct: 259 ggtagggtagggtagggtagg 279
to top
>gb|DQ144897.1| Ascocalyx abietina strain FIN3-M1-P4 multiallelic marker GAAA1000
           sequence
          Length = 597

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 ggtagggtagggtagggtagg 318
           |||||||||||||||||||||
Sbjct: 258 ggtagggtagggtagggtagg 278
to top
>gb|DQ144896.1| Ascocalyx abietina strain FIN3-M1-P3 multiallelic marker GAAA1000
           sequence
          Length = 598

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 ggtagggtagggtagggtagg 318
           |||||||||||||||||||||
Sbjct: 259 ggtagggtagggtagggtagg 279
to top
>gb|DQ144895.1| Ascocalyx abietina strain FIN3-M1-P2 multiallelic marker GAAA1000
           sequence
          Length = 598

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 ggtagggtagggtagggtagg 318
           |||||||||||||||||||||
Sbjct: 259 ggtagggtagggtagggtagg 279
to top
>gb|DQ144894.1| Ascocalyx abietina strain FIN3-M1-P1 multiallelic marker GAAA1000
           sequence
          Length = 598

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 ggtagggtagggtagggtagg 318
           |||||||||||||||||||||
Sbjct: 259 ggtagggtagggtagggtagg 279
to top
>gb|DQ144442.1| Ascocalyx abietina clone pGAAA-1000-AU58-c microsatellite sequence
          Length = 1018

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 298 ggtagggtagggtagggtagg 318
           |||||||||||||||||||||
Sbjct: 367 ggtagggtagggtagggtagg 347
to top
>gb|DQ144441.1| Ascocalyx abietina clone pGAAA-1000-B1-c microsatellite sequence
          Length = 957

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 298 ggtagggtagggtagggtagg 318
           |||||||||||||||||||||
Sbjct: 379 ggtagggtagggtagggtagg 359
to top
>gb|AC160965.4| Mus musculus BAC clone RP24-334E4 from chromosome 1, complete
            sequence
          Length = 182270

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 295  gtgggtagggtagggtagggt 315
            |||||||||||||||||||||
Sbjct: 9847 gtgggtagggtagggtagggt 9867
to top
>gb|AC096035.6| Rattus norvegicus 4 BAC CH230-16M16 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 228433

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 297    gggtagggtagggtagggtag 317
              |||||||||||||||||||||
Sbjct: 178961 gggtagggtagggtagggtag 178941



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              |||| |||||||||||||||||||
Sbjct: 178966 gggtggggtagggtagggtagggt 178943
to top
>emb|AL670471.4| Human DNA sequence from clone RP11-290H1 on chromosome 1 Contains
           the 5' end of a novel gene, complete sequence
          Length = 57408

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 378 agatgagctgtagtagtagta 398
           |||||||||||||||||||||
Sbjct: 490 agatgagctgtagtagtagta 470
to top
>gb|AC138134.6| Mus musculus strain C57BL/6J clone rp23-382i2 map 18, complete sequence
          Length = 202316

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 296    tgggtagggtagggtagggtagggt 320
              ||||| |||||||||||||||||||
Sbjct: 174658 tgggttgggtagggtagggtagggt 174634



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 296    tgggtagggtagggtagggtagggt 320
              |||||||||||||||||||| ||||
Sbjct: 174653 tgggtagggtagggtagggttgggt 174629
to top
>emb|AL591843.14| Mouse DNA sequence from clone RP23-351I6 on chromosome 13 Contains the
             Prl gene for prolactin and the Csh1 gene for chorionic
             somatomammotropin hormone 1, complete sequence
          Length = 94890

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 297   gggtagggtagggtagggtag 317
             |||||||||||||||||||||
Sbjct: 23614 gggtagggtagggtagggtag 23634



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 23613 agggtagggtagggtagggt 23632
to top
>gb|AC093454.3| Drosophila melanogaster 3L BAC RP98-23K2 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 168479

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 4     actttttgtaaaacaaaacca 24
             |||||||||||||||||||||
Sbjct: 31385 actttttgtaaaacaaaacca 31405
to top
>gb|AC010660.6| Drosophila melanogaster 3L BAC RP98-9I16 (Roswell Park Cancer
            Institute Drosophila BAC Library) complete sequence
          Length = 186795

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 4    actttttgtaaaacaaaacca 24
            |||||||||||||||||||||
Sbjct: 6627 actttttgtaaaacaaaacca 6607
to top
>emb|CR589951.3| Human DNA sequence from clone WI2-489O20 on chromosome 1, complete
            sequence
          Length = 30997

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 378  agatgagctgtagtagtagta 398
            |||||||||||||||||||||
Sbjct: 1511 agatgagctgtagtagtagta 1531
to top
>gb|AC092627.2| Homo sapiens BAC clone RP11-271B8 from 4, complete sequence
          Length = 102899

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 85407 tagggtagggtagggtagggt 85387



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||||||| ||||
Sbjct: 85405 gggtagggtagggtagggtggggt 85382
to top
>gb|AC017026.8| Homo sapiens BAC clone RP11-269L4 from 2, complete sequence
          Length = 37049

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 300  tagggtagggtagggtagggt 320
            |||||||||||||||||||||
Sbjct: 7896 tagggtagggtagggtagggt 7916



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||||||| ||||
Sbjct: 7898 gggtagggtagggtagggtggggt 7921
to top
>gb|AE003788.5| Drosophila melanogaster chromosome 2R, section 1 of 73 of the complete
              sequence
          Length = 585533

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 300    tagggtagggtagggtagggt 320
              |||||||||||||||||||||
Sbjct: 214497 tagggtagggtagggtagggt 214517



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 297    gggtagggtagggtagggta 316
              ||||||||||||||||||||
Sbjct: 214499 gggtagggtagggtagggta 214518
to top
>gb|AE003528.3| Drosophila melanogaster chromosome 3L, section 57 of 83 of the complete
              sequence
          Length = 283815

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 4      actttttgtaaaacaaaacca 24
              |||||||||||||||||||||
Sbjct: 235006 actttttgtaaaacaaaacca 234986
to top
>gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequence
          Length = 2906179

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 452     catcagcctcttccatatgaa 472
               |||||||||||||||||||||
Sbjct: 1396474 catcagcctcttccatatgaa 1396454
to top
>gb|AC004486.1|AC004486 Homo sapiens 12q13 PAC RPCI3-432I18 (Roswell Park Cancer Institute
             Human PAC library) complete sequence
          Length = 92800

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 297   gggtagggtagggtagggtag 317
             |||||||||||||||||||||
Sbjct: 48866 gggtagggtagggtagggtag 48846
to top
>gb|AC005900.1|AC005900 Homo sapiens chromosome 17, clone hRPK.998_F_8, complete sequence
          Length = 175066

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 292    tgggtgggtagggtagggtag 312
              |||||||||||||||||||||
Sbjct: 133582 tgggtgggtagggtagggtag 133602
to top
>emb|AL929467.6| Zebrafish DNA sequence from clone CH211-148E17, complete sequence
          Length = 156801

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 300   tagggtagggtagggtagggt 320
             |||||||||||||||||||||
Sbjct: 64846 tagggtagggtagggtagggt 64826



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||||||| ||||||||
Sbjct: 64939 gggtagggtagggtaaggtagggt 64916



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 297   gggtagggtagggtagggta 316
             ||||||||||||||||||||
Sbjct: 64844 gggtagggtagggtagggta 64825
to top
>gb|AC149059.3| Mus musculus BAC clone RP23-325A2 from 18, complete sequence
          Length = 206973

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 296   tgggtagggtagggtagggtagggt 320
             ||||| |||||||||||||||||||
Sbjct: 72097 tgggttgggtagggtagggtagggt 72073



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 296   tgggtagggtagggtagggtagggt 320
             |||||||||||||||||||| ||||
Sbjct: 72092 tgggtagggtagggtagggttgggt 72068
to top
>emb|AL845447.3| Mouse DNA sequence from clone RP23-133L20 on chromosome X, complete
            sequence
          Length = 105525

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 297  gggtagggtagggtagggtagggtc 321
            |||||||||||||||||||| ||||
Sbjct: 3705 gggtagggtagggtagggtatggtc 3729



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 301  agggtagggtagggtagggt 320
            ||||||||||||||||||||
Sbjct: 3704 agggtagggtagggtagggt 3723
to top
>gb|AC155818.5| Mus musculus BAC clone RP23-397H1 from chromosome 8, complete sequence
          Length = 191112

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 45     tgatgaggtaaaagcccaacactg 68
              |||| |||||||||||||||||||
Sbjct: 167497 tgataaggtaaaagcccaacactg 167474
to top
>gb|AC165964.3| Mus musculus BAC clone RP23-334H24 from chromosome 8, complete sequence
          Length = 233538

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 45    tgatgaggtaaaagcccaacactg 68
             |||| |||||||||||||||||||
Sbjct: 47539 tgataaggtaaaagcccaacactg 47516
to top
>gb|AC109201.12| Mus musculus chromosome 15, clone RP23-18P10, complete sequence
          Length = 213493

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              |||||||| |||||||||||||||
Sbjct: 125044 gggtagggcagggtagggtagggt 125021



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 301    agggtagggtagggtagggt 320
              ||||||||||||||||||||
Sbjct: 125035 agggtagggtagggtagggt 125016



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||||||| ||||
Sbjct: 125034 gggtagggtagggtagggtggggt 125011
to top
>gb|AE014833.1| Plasmodium falciparum 3D7 chromosome 10 section 5 of 7 of the complete
              sequence
          Length = 252394

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 375    gtgagatgagctgtagtagt 394
              ||||||||||||||||||||
Sbjct: 159452 gtgagatgagctgtagtagt 159433
to top
>gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence
          Length = 2205233

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 154    gttggttgctcatcatctac 173
              ||||||||||||||||||||
Sbjct: 966242 gttggttgctcatcatctac 966223
to top
>gb|AC159454.1| Trypanosoma brucei chromosome 7 clone RPCI93-6C8, complete sequence
          Length = 150601

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   gttggttgctcatcatctac 173
             ||||||||||||||||||||
Sbjct: 73622 gttggttgctcatcatctac 73641
to top
>gb|AC159429.1| Trypanosoma brucei chromosome 7 clone RPCI93-28B13, complete sequence
          Length = 152128

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   gttggttgctcatcatctac 173
             ||||||||||||||||||||
Sbjct: 26635 gttggttgctcatcatctac 26654
to top
>gb|AC147831.2| Xenopus tropicalis clone CH216-159I14, complete sequence
          Length = 145109

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 217   gcctataaaaagtaaacccacacgatca 244
             ||||||||| |||||| |||||||||||
Sbjct: 15806 gcctataaacagtaaaaccacacgatca 15833
to top
>gb|AC161280.2| Pan troglodytes BAC clone CH251-392H4 from chromosome 7, complete
             sequence
          Length = 190939

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     ctttttgtaaaacaaaacca 24
             ||||||||||||||||||||
Sbjct: 78588 ctttttgtaaaacaaaacca 78569
to top
>gb|AC161123.3| Pan troglodytes BAC clone CH251-618D5 from chromosome 7, complete
              sequence
          Length = 190856

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      ctttttgtaaaacaaaacca 24
              ||||||||||||||||||||
Sbjct: 143510 ctttttgtaaaacaaaacca 143491
to top
>gb|AF106575.2| Caenorhabditis elegans cosmid K04F1, complete sequence
          Length = 42613

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  tagggtagggtagggtaggg 319
            ||||||||||||||||||||
Sbjct: 8816 tagggtagggtagggtaggg 8797
to top
>gb|AC140841.2| Mus musculus BAC clone RP24-470M20 from chromosome 9, complete sequence
          Length = 163348

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||| ||||||||||||||||||
Sbjct: 90888 gggtaaggtagggtagggtagggt 90865
to top
>ref|XM_542307.2| PREDICTED: Canis familiaris similar to arrestin beta 1 isoform A,
           transcript variant 1 (LOC485189), mRNA
          Length = 1460

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 448 gtgtcatcagcctcttccat 467
           ||||||||||||||||||||
Sbjct: 893 gtgtcatcagcctcttccat 874
to top
>ref|XM_844950.1| PREDICTED: Canis familiaris similar to arrestin beta 1 isoform A,
           transcript variant 2 (LOC485189), mRNA
          Length = 1408

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 448 gtgtcatcagcctcttccat 467
           ||||||||||||||||||||
Sbjct: 893 gtgtcatcagcctcttccat 874
to top
>emb|AJ965256.1| Dehalococcoides sp. CBDB1 complete genome
          Length = 1395502

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 402    aagtaaagggctacaacaccagtg 425
              ||||||| ||||||||||||||||
Sbjct: 903964 aagtaaacggctacaacaccagtg 903987
to top
>emb|Z83218.1|CEC31A11 Caenorhabditis elegans Cosmid C31A11, complete sequence
          Length = 24171

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 300   tagggtagggtagggtaggg 319
             ||||||||||||||||||||
Sbjct: 11651 tagggtagggtagggtaggg 11670
to top
>emb|CT025638.1| Pan troglodytes chromosome X clone PTB-083N09 map Xq28, complete sequence
          Length = 189430

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 292    tgggtgggtagggtagggtagggtaggg 319
              |||| ||| |||||||||||||||||||
Sbjct: 173912 tgggggggcagggtagggtagggtaggg 173939
to top
>ref|XM_814566.1| Trypanosoma cruzi strain CL Brener epsilon-adaptin
            (Tc00.1047053507023.10) partial mRNA
          Length = 3027

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 447  agtgtcatcagcctcttcca 466
            ||||||||||||||||||||
Sbjct: 1104 agtgtcatcagcctcttcca 1085
to top
>gb|AC114915.3| Mus musculus BAC clone RP23-54K21 from 2, complete sequence
          Length = 257013

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   ctgagggcctataaaaagta 230
             ||||||||||||||||||||
Sbjct: 88300 ctgagggcctataaaaagta 88281
to top
>gb|AC119803.10| Mus musculus chromosome 6, clone RP23-124H21, complete sequence
          Length = 197762

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 184    tcctccttacacagcacaag 203
              ||||||||||||||||||||
Sbjct: 160116 tcctccttacacagcacaag 160097
to top
>gb|AF099917.1| Caenorhabditis elegans cosmid F54D10, complete sequence
          Length = 32563

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 300   tagggtagggtagggtaggg 319
             ||||||||||||||||||||
Sbjct: 27725 tagggtagggtagggtaggg 27744
to top
>gb|AF016654.1| Caenorhabditis elegans cosmid C17A2, complete sequence
          Length = 24900

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 300  tagggtagggtagggtaggg 319
            ||||||||||||||||||||
Sbjct: 1262 tagggtagggtagggtaggg 1281
to top
>gb|AC012526.35| Mus musculus strain 129S6/SvEvTac clone rp21-671i11 map 16, complete
            sequence
          Length = 186272

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||| ||||||||||||
Sbjct: 5763 gggtagggtagagtagggtagggt 5740
to top
>gb|AC140026.11| Medicago truncatula clone mth2-36j24, complete sequence
          Length = 162172

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 388    tagtagtagtaagtaagtaa 407
              ||||||||||||||||||||
Sbjct: 138703 tagtagtagtaagtaagtaa 138684
to top
>emb|AL449196.1| Human DNA sequence from clone RP11-61K10 on chromosome 6 Contains part
             of the gene for a novel protein similar to FLJ13018 and
             other hypothetical proteins, complete sequence
          Length = 33136

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 248   tcaagatacacaagcctaca 267
             ||||||||||||||||||||
Sbjct: 27278 tcaagatacacaagcctaca 27259
to top
>emb|AL390965.15| Human DNA sequence from clone RP11-640E11 on chromosome 13 Contains a
             solute carrier family 25 (mitochondrial carrier; adenine
             nucleotide translocator), member 5 (SLC25A5) pseudogene,
             complete sequence
          Length = 92179

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 5     ctttttgtaaaacaaaacca 24
             ||||||||||||||||||||
Sbjct: 73898 ctttttgtaaaacaaaacca 73917
to top
>emb|AL355985.18| Human DNA sequence from clone RP11-98O17 on chromosome 9 Contains a
            putative novel pseudogene, complete sequence
          Length = 64969

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 301  agggtagggtagggtagggt 320
            ||||||||||||||||||||
Sbjct: 9002 agggtagggtagggtagggt 8983



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 297  gggtagggtagggtagggta 316
            ||||||||||||||||||||
Sbjct: 9001 gggtagggtagggtagggta 8982



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 297  gggtagggtagggtagggtagggt 320
            ||||||||||||||| ||||||||
Sbjct: 8996 gggtagggtagggtacggtagggt 8973
to top
>emb|AL157938.22| Human DNA sequence from clone RP11-544A12 on chromosome 9q34.13-34.3
              Contains the 3' end of the LAMC3 gene for laminin gamma 3,
              the gene for ionized calcium binding adaptor (IBA2), the
              NUP214 gene for nucleoporin 214kDa, a novel gene, a
              ribosomal protein L13a (RPL13A) pseudogene, the gene for a
              novel protein (FLJ00024) and four CpG islands, complete
              sequence
          Length = 197019

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 228    gtaaacccacacgatcatcatcaa 251
              ||||||||||| ||||||||||||
Sbjct: 129932 gtaaacccacaagatcatcatcaa 129909
to top
>emb|CR380951.1| Candida glabrata strain CBS138 chromosome E complete sequence
          Length = 687501

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 385    ctgtagtagtagtaagtaag 404
              ||||||||||||||||||||
Sbjct: 318577 ctgtagtagtagtaagtaag 318558
to top
>gb|AC091002.54| Mus musculus strain C57BL/6J clone rp23-7n16 map 16, complete sequence
          Length = 217939

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||| ||||||||||||
Sbjct: 134297 gggtagggtagagtagggtagggt 134320
to top
>emb|AL133090.1|HSM801366 Homo sapiens mRNA; cDNA DKFZp434E0528 (from clone DKFZp434E0528)
          Length = 3122

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 5    ctttttgtaaaacaaaacca 24
            ||||||||||||||||||||
Sbjct: 1975 ctttttgtaaaacaaaacca 1956
to top
>gb|AC079628.20| Homo sapiens 12 BAC RP11-688K16 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 114632

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 517   cctcccatagcctcctctgc 536
             ||||||||||||||||||||
Sbjct: 65824 cctcccatagcctcctctgc 65805
to top
>emb|BX649557.8| Zebrafish DNA sequence from clone DKEYP-61G11 in linkage group 3,
              complete sequence
          Length = 163934

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      tttttgtaaaacaaaaccag 25
              ||||||||||||||||||||
Sbjct: 104944 tttttgtaaaacaaaaccag 104925
to top
>gb|AC162465.3| Mus musculus 6 BAC RP24-108G5 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 203546

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 184    tcctccttacacagcacaag 203
              ||||||||||||||||||||
Sbjct: 199155 tcctccttacacagcacaag 199174
to top
>gb|AC092668.2| Homo sapiens BAC clone RP11-553F8 from 4, complete sequence
          Length = 167570

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 392   agtagtaagtaagtaaaggg 411
             ||||||||||||||||||||
Sbjct: 78799 agtagtaagtaagtaaaggg 78780
to top
>gb|AC006082.22| Mus musculus strain 129/Sv ES cell line CJ7 chromosome 16 clone
             ct7-342a4, complete sequence
          Length = 154201

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||| ||||||||||||
Sbjct: 25846 gggtagggtagagtagggtagggt 25869
to top
>gb|AC016650.6| Homo sapiens chromosome 5 clone RPCI-1_167J12, complete sequence
          Length = 184886

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 300    tagggtagggtagggtaggg 319
              ||||||||||||||||||||
Sbjct: 109958 tagggtagggtagggtaggg 109977
to top
>gb|AC091045.3| Homo sapiens chromosome 15 clone RP11-111A22 map 15q14, complete
             sequence
          Length = 171947

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 296   tgggtagggtagggtagggtaggg 319
             ||||| ||||||||||||||||||
Sbjct: 45061 tgggtcgggtagggtagggtaggg 45084
to top
>gb|AC013356.8|AC013356 Homo sapiens chromosome 15 clone RP11-64K12 map 15q14, complete sequence
          Length = 176910

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 296    tgggtagggtagggtagggtaggg 319
              ||||| ||||||||||||||||||
Sbjct: 151577 tgggtcgggtagggtagggtaggg 151600
to top
>ref|NM_174243.2| Bos taurus arrestin, beta 1 (ARRB1), mRNA
          Length = 1945

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 448 gtgtcatcagcctcttccat 467
           ||||||||||||||||||||
Sbjct: 878 gtgtcatcagcctcttccat 859
to top
>gb|AC005075.2|AC005075 Homo sapiens BAC clone CTA-219E16 from 7, complete sequence
          Length = 118334

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      ctttttgtaaaacaaaacca 24
              ||||||||||||||||||||
Sbjct: 107830 ctttttgtaaaacaaaacca 107811
to top
>gb|AC118542.20| Mus musculus strain C57BL/6J chromosome 16 clone rp23-117j21, complete
             sequence
          Length = 215057

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   gggtagggtagggtagggtagggt 320
             ||||||||||| ||||||||||||
Sbjct: 28458 gggtagggtagagtagggtagggt 28481
to top
>emb|AL954869.9| Mouse DNA sequence from clone RP23-477I13 on chromosome X, complete
              sequence
          Length = 159365

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 394    tagtaagtaagtaaagggct 413
              ||||||||||||||||||||
Sbjct: 155655 tagtaagtaagtaaagggct 155674
to top
>gb|U23515.1| Caenorhabditis elegans cosmid R144, complete sequence
          Length = 38687

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 300   tagggtagggtagggtaggg 319
             ||||||||||||||||||||
Sbjct: 27958 tagggtagggtagggtaggg 27939
to top
>emb|Z93377.1|CEF13A7 Caenorhabditis elegans Cosmid F13A7, complete sequence
          Length = 31744

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 300   tagggtagggtagggtaggg 319
             ||||||||||||||||||||
Sbjct: 11947 tagggtagggtagggtaggg 11966
to top
>gb|AC159315.4| Mus musculus BAC clone RP23-86H21 from chromosome 12, complete sequence
          Length = 233568

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 299    gtagggtagggtagggtagg 318
              ||||||||||||||||||||
Sbjct: 164487 gtagggtagggtagggtagg 164506
to top
>gb|AC153853.4| Mus musculus  BAC RP23-341J13 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 194037

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 184   tcctccttacacagcacaag 203
             ||||||||||||||||||||
Sbjct: 56865 tcctccttacacagcacaag 56884
to top
>gb|AC147266.6| Mus musculus BAC clone RP24-246F6 from 8, complete sequence
          Length = 228955

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||| ||||||||
Sbjct: 198341 gggtagggtagggtatggtagggt 198318



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              |||||||||| |||||||||||||
Sbjct: 198336 gggtagggtatggtagggtagggt 198313
to top
>gb|AC123825.5| Mus musculus BAC clone RP24-93F18 from 8, complete sequence
          Length = 236875

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              |||||||||| |||||||||||||
Sbjct: 127456 gggtagggtatggtagggtagggt 127479



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 297    gggtagggtagggtagggtagggt 320
              ||||||||||||||| ||||||||
Sbjct: 127451 gggtagggtagggtatggtagggt 127474
to top
>emb|BX005190.8| Mouse DNA sequence from clone RP23-383A22 on chromosome X, complete
             sequence
          Length = 212955

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 448   gtgtcatcagcctcttccat 467
             ||||||||||||||||||||
Sbjct: 97267 gtgtcatcagcctcttccat 97286
to top
>gb|AC140407.5| Mus musculus BAC clone RP23-142K9 from chromosome unknown, complete
             sequence
          Length = 193404

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 448   gtgtcatcagcctcttccat 467
             ||||||||||||||||||||
Sbjct: 75048 gtgtcatcagcctcttccat 75067
to top
>gb|AC171199.1| Mus musculus BAC clone RP24-469I17 from chromosome 16, complete
             sequence
          Length = 146976

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 301   agggtagggtagggtagggt 320
             ||||||||||||||||||||
Sbjct: 86614 agggtagggtagggtagggt 86633
to top
>emb|AL844844.8| Mouse DNA sequence from clone RP23-103D7 on chromosome 2, complete
             sequence
          Length = 213953

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   ctgagggcctataaaaagta 230
             ||||||||||||||||||||
Sbjct: 22561 ctgagggcctataaaaagta 22580
to top
>gb|M33601.1|BOVARRB Cow beta-arrestin mRNA, complete cds
          Length = 1945

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 448 gtgtcatcagcctcttccat 467
           ||||||||||||||||||||
Sbjct: 878 gtgtcatcagcctcttccat 859
to top
>emb|AL592042.9| Mouse DNA sequence from clone RP23-380K13 on chromosome 2, complete
             sequence
          Length = 84122

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 291   ctgggtgggtagggtagggtaggg 314
             |||||| |||||||||||||||||
Sbjct: 33568 ctgggtaggtagggtagggtaggg 33545


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,695,586
Number of Sequences: 3902068
Number of extensions: 4695586
Number of successful extensions: 95297
Number of sequences better than 10.0: 248
Number of HSP's better than 10.0 without gapping: 248
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93442
Number of HSP's gapped (non-prelim): 1603
length of query: 539
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 516
effective length of database: 17,143,297,704
effective search space: 8845941615264
effective search space used: 8845941615264
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top