>ref|XM_445211.1| Candida glabrata CBS138, CAGL0C00671g partial mRNA
          Length = 2505

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 219  cacacgcacccgcaggagca 238
            ||||||||||||||||||||
Sbjct: 2161 cacacgcacccgcaggagca 2180

>emb|CR380949.1| Candida glabrata strain CBS138 chromosome C complete sequence
          Length = 558804

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   cacacgcacccgcaggagca 238
             ||||||||||||||||||||
Sbjct: 71556 cacacgcacccgcaggagca 71575

>gb|AC006438.4| Arabidopsis thaliana chromosome 2 clone F19G14 map mi398, complete
             sequence
          Length = 91106

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 93    aaaatagcagagagaangaagct 115
             |||||||||||||||| ||||||
Sbjct: 79251 aaaatagcagagagaaggaagct 79229

>gb|AC010906.10| Homo sapiens BAC clone RP11-566O4 from 2, complete sequence
          Length = 208571

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 80     aaagacagctaccaaaatag 99
              ||||||||||||||||||||
Sbjct: 180999 aaagacagctaccaaaatag 181018


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,050,283
Number of Sequences: 3902068
Number of extensions: 1050283
Number of successful extensions: 16115
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16109
Number of HSP's gapped (non-prelim): 6
length of query: 239
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 217
effective length of database: 17,147,199,772
effective search space: 3720942350524
effective search space used: 3720942350524
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)