ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags12i18 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9 Length = 704 Score = 656 bits (331), Expect = 0.0 Identities = 384/401 (95%), Gaps = 3/401 (0%) Strand = Plus / Minus Query: 129 ggctactccttggcggcggccttcttcttgggggacttggtagcggtcttcttcttgggc 188 |||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||| Sbjct: 505 ggctactccttggcggcgaccttcttcttgggggacttggtggaggtcttcttcttgggc 446 Query: 189 gacttggtggcctccttctcggctgcggcggcggacttcttggggagcagcacggagttg 248 ||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||| Sbjct: 445 gacttgg---cctccttctcggcggcggcgggggacttcttggggagcagcacggagttg 389 Query: 249 atgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcc 308 ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| Sbjct: 388 atgttggggatcacgccaccgtgggcgatggtgacgccagcgagcagcctgccgagctcc 329 Query: 309 tggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtcc 368 |||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||| Sbjct: 328 tggtcgttgcggacagcgagcagcaggtggcgcgggatgatgcgggtcttcttgttgtcc 269 Query: 369 ttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggcg 428 ||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||| Sbjct: 268 ttggccgcgttgccggcaagctccagcacctcggcggcgaggtactcgaggacggcggcg 209 Query: 429 aggtagacgggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgc 488 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 208 aggtagacgggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgc 149 Query: 489 ccgatgcggccgacggggaactggagcccggccttaacgga 529 ||||||||||||||||||||||||||||||||||| ||||| Sbjct: 148 ccgatgcggccgacggggaactggagcccggccttcacgga 108
>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3 Length = 1153 Score = 609 bits (307), Expect = e-171 Identities = 370/391 (94%) Strand = Plus / Minus Query: 139 tggcggcggccttcttcttgggggacttggtagcggtcttcttcttgggcgacttggtgg 198 |||| |||| ||||||||||||||||||||| |||| ||||||||||||||||||||||| Sbjct: 519 tggctgcggtcttcttcttgggggacttggtggcggccttcttcttgggcgacttggtgg 460 Query: 199 cctccttctcggctgcggcggcggacttcttggggagcagcacggagttgatgttgggga 258 |||||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||| Sbjct: 459 actccttctcggcggcgccggcggccttcttggggagcagcacggagttgatgttgggga 400 Query: 259 tcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgc 318 | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 399 tgacgccgccgtgggcgatggtgacgccggcgagcagcctgcccagctcctggtcgttgc 340 Query: 319 ggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtccttggccgcgt 378 ||||||| || ||||||||||||||||||||||| | ||||||||||||||||||||||| Sbjct: 339 ggacggccagcagcaggtggcgcgggatgatgcgcgtcttcttgttgtccttggccgcgt 280 Query: 379 tgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggcgaggtagacgg 438 ||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 279 tgccggcgagctccaggacctcggcggcgaggtactcgaggacggcggcgaggtagacgg 220 Query: 439 gggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggc 498 ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| Sbjct: 219 gggcgccggagccgacggcctgcgcgtagcggcccttcttgaggtagcgcccgatgcggc 160 Query: 499 cgacggggaactggagcccggccttaacgga 529 ||||||||||||||||||||||||| ||||| Sbjct: 159 cgacggggaactggagcccggccttcacgga 129 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 137 cttggcggcggccttcttcttgggggacttggt 169 ||||| |||||||||||||||||| |||||||| Sbjct: 494 cttggtggcggccttcttcttgggcgacttggt 462
>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2 Length = 717 Score = 551 bits (278), Expect = e-154 Identities = 363/391 (92%), Gaps = 9/391 (2%) Strand = Plus / Minus Query: 139 tggcggcggccttcttcttgggggacttggtagcggtcttcttcttgggcgacttggtgg 198 |||| |||| |||||||||||||||||||| |||| ||||| |||||| ||| Sbjct: 512 tggctgcggtcttcttcttgggggacttggcggcggccttct------gcgact---tgg 462 Query: 199 cctccttctcggctgcggcggcggacttcttggggagcagcacggagttgatgttgggga 258 ||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||| Sbjct: 461 cctccttctcggcggctgcgggggacttcttggggagcagcacggagttgatgttgggga 402 Query: 259 tcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgc 318 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 401 tgacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgc 342 Query: 319 ggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtccttggccgcgt 378 ||||||| || ||||||||||||||||||||||| | ||||||||||||||||||||||| Sbjct: 341 ggacggccagcagcaggtggcgcgggatgatgcgcgtcttcttgttgtccttggccgcgt 282 Query: 379 tgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggcgaggtagacgg 438 ||||||| ||||| || ||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 281 tgccggcaagctccaggacctcggcggcgaggtactcgaggacggcggcgaggtagacgg 222 Query: 439 gggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggc 498 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 221 gggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggc 162 Query: 499 cgacggggaactggagcccggccttaacgga 529 ||||||||||||| ||||||||||| ||||| Sbjct: 161 cgacggggaactgcagcccggccttgacgga 131
>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274) Length = 2546 Score = 379 bits (191), Expect = e-102 Identities = 250/269 (92%), Gaps = 3/269 (1%) Strand = Plus / Minus Query: 131 ctactccttggcggcggccttcttcttgggggacttggtagcggtcttcttcttgggcga 190 ||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||| Sbjct: 2325 ctactccttggcggcaaccttcttcttgggggacttggtggaggtcttcttcttgggcga 2266 Query: 191 cttggtggcctccttctcggctgcggcggcggacttcttggggagcagcacggagttgat 250 ||||| ||||||||||||| ||||||| |||||||||||| ||||||||||||||||| Sbjct: 2265 cttgg---cctccttctcggcggcggcgggggacttcttgggcagcagcacggagttgat 2209 Query: 251 gttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctg 310 ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 2208 tgtggggatgacgccgccgtgggcgatggtgacgccggcaagcagcctgccgagctcctg 2149 Query: 311 gtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtcctt 370 |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| Sbjct: 2148 gtcgttgcggacggcgagcagcaggtggcgcgggatgatgcgggtcttcttgttgtcctt 2089 Query: 371 ggccgcgttgccggcgagctcaagcacct 399 ||| ||||||||||| ||||| ||||||| Sbjct: 2088 ggctgcgttgccggcaagctccagcacct 2060 Score = 246 bits (124), Expect = 6e-62 Identities = 133/136 (97%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 1968 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatg 1909 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1908 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 1849 Query: 516 ccggccttaacggacc 531 |||||||| ||||||| Sbjct: 1848 ccggccttcacggacc 1833
>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds Length = 2546 Score = 379 bits (191), Expect = e-102 Identities = 250/269 (92%), Gaps = 3/269 (1%) Strand = Plus / Minus Query: 131 ctactccttggcggcggccttcttcttgggggacttggtagcggtcttcttcttgggcga 190 ||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||| Sbjct: 2325 ctactccttggcggcaaccttcttcttgggggacttggtggaggtcttcttcttgggcga 2266 Query: 191 cttggtggcctccttctcggctgcggcggcggacttcttggggagcagcacggagttgat 250 ||||| ||||||||||||| ||||||| |||||||||||| ||||||||||||||||| Sbjct: 2265 cttgg---cctccttctcggcggcggcgggggacttcttgggcagcagcacggagttgat 2209 Query: 251 gttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctg 310 ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 2208 tgtggggatgacgccgccgtgggcgatggtgacgccggcaagcagcctgccgagctcctg 2149 Query: 311 gtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtcctt 370 |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| Sbjct: 2148 gtcgttgcggacggcgagcagcaggtggcgcgggatgatgcgggtcttcttgttgtcctt 2089 Query: 371 ggccgcgttgccggcgagctcaagcacct 399 ||| ||||||||||| ||||| ||||||| Sbjct: 2088 ggctgcgttgccggcaagctccagcacct 2060 Score = 246 bits (124), Expect = 6e-62 Identities = 133/136 (97%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 1968 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatg 1909 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1908 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 1849 Query: 516 ccggccttaacggacc 531 |||||||| ||||||| Sbjct: 1848 ccggccttcacggacc 1833
>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full insert sequence Length = 797 Score = 379 bits (191), Expect = e-102 Identities = 281/311 (90%) Strand = Plus / Minus Query: 219 gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 278 |||| |||||| ||||||||||| | ||||||||| || | |||||||||||| |||||| Sbjct: 472 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 413 Query: 279 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 338 ||||| |||||||||||| | |||||||||| ||||||||||| || || |||| ||| Sbjct: 412 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 353 Query: 339 cgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacc 398 | ||||||||| ||| ||||||||||||| |||||||| ||||||||||| |||||| Sbjct: 352 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 293 Query: 399 tctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgc 458 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 292 tctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgc 233 Query: 459 tgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccg 518 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 232 tgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcccg 173 Query: 519 gccttaacgga 529 ||||| ||||| Sbjct: 172 gccttgacgga 162
>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence Length = 719 Score = 375 bits (189), Expect = e-100 Identities = 282/313 (90%) Strand = Plus / Minus Query: 219 gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 278 |||| ||||||||| || ||||| | |||||||||||||| |||||||||||||||||| Sbjct: 497 gcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatg 438 Query: 279 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 338 |||||||||| |||||| |||||||||||| ||||||||||| ||| || |||| |||| Sbjct: 437 gtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtgg 378 Query: 339 cgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacc 398 |||||||||||||||| |||||||||||||||||| ||||||||||| ||||| |||||| Sbjct: 377 cgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagcacc 318 Query: 399 tctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgc 458 || ||||| |||||||||||||||||||| ||||||||||||||||| | |||||||||| Sbjct: 317 tcggcggccaggtactcgaggacggcggccaggtagacgggggcgcccgtgccgacgcgc 258 Query: 459 tgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccg 518 || ||||| ||||||||||| ||||| |||||||||||||||||||| ||||| |||||| Sbjct: 257 tgcgcgtaccggcccttcttcaggtaccgcccgatgcggccgacgggaaactgcagcccg 198 Query: 519 gccttaacggacc 531 ||||| ||||||| Sbjct: 197 gccttgacggacc 185
>gb|AY103710.1| Zea mays PCO123562 mRNA sequence Length = 770 Score = 375 bits (189), Expect = e-100 Identities = 282/313 (90%) Strand = Plus / Minus Query: 219 gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 278 |||| ||||||||| || ||||| | |||||||||||||| |||||||||||||||||| Sbjct: 497 gcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatg 438 Query: 279 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 338 |||||||||| |||||| |||||||||||| ||||||||||| ||| || |||| |||| Sbjct: 437 gtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtgg 378 Query: 339 cgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacc 398 |||||||||||||||| |||||||||||||||||| ||||||||||| ||||| |||||| Sbjct: 377 cgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagcacc 318 Query: 399 tctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgc 458 || ||||| |||||||||||||||||||| ||||||||||||||||| | |||||||||| Sbjct: 317 tcggcggccaggtactcgaggacggcggccaggtagacgggggcgcccgtgccgacgcgc 258 Query: 459 tgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccg 518 || ||||| ||||||||||| ||||| |||||||||||||||||||| ||||| |||||| Sbjct: 257 tgcgcgtaccggcccttcttcaggtaccgcccgatgcggccgacgggaaactgcagcccg 198 Query: 519 gccttaacggacc 531 ||||| ||||||| Sbjct: 197 gccttgacggacc 185
>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence Length = 674 Score = 359 bits (181), Expect = 6e-96 Identities = 278/309 (89%), Gaps = 1/309 (0%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| ||||| || | |||||||||||| | ||||||||||||||||||||| || Sbjct: 450 cttcttgggcagcaggaccgggttgatgttgggcaacacgccgccgtgggcgatggtcac 391 Query: 284 gccggcgagcagcctgcc-gagctcctggtcgttgcggacggcgagaagcaggtggcgcg 342 ||||| |||||||| || |||||||| ||||||||||| || || |||| |||||||| Sbjct: 390 gccggtcagcagccttcccgagctcctcgtcgttgcggatcgccagcagcacgtggcgcg 331 Query: 343 ggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctg 402 ||| |||||| | |||||||||||||||||| ||||||||||||||||| || ||||| | Sbjct: 330 ggacgatgcgcgtcttcttgttgtccttggcagcgttgccggcgagctccaggacctcag 271 Query: 403 cggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctggg 462 ||||||||||||| |||||||| ||||||||||||||||| ||| |||||||||||| | Sbjct: 270 cggcgaggtactccaggacggccgcgaggtagacgggggcaccgctgccgacgcgctgcg 211 Query: 463 cgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcct 522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 210 cgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcct 151 Query: 523 taacggacc 531 | ||||||| Sbjct: 150 tcacggacc 142
>ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 480 Score = 353 bits (178), Expect = 4e-94 Identities = 274/306 (89%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| || Sbjct: 399 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 340 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| |||||||||||| |||||| | || || || |||| ||||||||| Sbjct: 339 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 280 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| | | ||||||||||||| |||||||||| ||||||||||| |||||||| || Sbjct: 279 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggc 220 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| || Sbjct: 219 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgcgc 160 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 |||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| Sbjct: 159 gtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 100 Query: 524 aacgga 529 ||||| Sbjct: 99 gacgga 94
>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full insert sequence Length = 754 Score = 353 bits (178), Expect = 4e-94 Identities = 274/306 (89%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| || Sbjct: 489 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 430 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| |||||||||||| |||||| | || || || |||| ||||||||| Sbjct: 429 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 370 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| | | ||||||||||||| |||||||||| ||||||||||| |||||||| || Sbjct: 369 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggc 310 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 309 agcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgggc 250 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 |||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| Sbjct: 249 gtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 190 Query: 524 aacgga 529 ||||| Sbjct: 189 gacgga 184
>gb|AY103585.1| Zea mays PCO123564 mRNA sequence Length = 1953 Score = 335 bits (169), Expect = 9e-89 Identities = 274/309 (88%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| || |||||||||| ||||||||||| ||||||||||| ||||||||||| Sbjct: 610 cttcttgggcaggagcacggagtggatgttggggaggacgccgccgtgcgcgatggtgac 551 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| | |||||||||| ||||||||||| || || |||| ||||||||| Sbjct: 550 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 491 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| || |||||||| || || | ||| || ||||| || Sbjct: 490 gatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaactccagaacctcggc 431 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 |||||||||||| ||||||||||||||||||||||||||||| | ||| |||||||| || Sbjct: 430 ggcgaggtactccaggacggcggcgaggtagacgggggcgccagtgcccacgcgctgcgc 371 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| Sbjct: 370 gtaccggcccttcttgaggtagcgcccgatccggccgacggggaactgcagcccggcctt 311 Query: 524 aacggaccg 532 |||||||| Sbjct: 310 gacggaccg 302
>ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 492 Score = 329 bits (166), Expect = 5e-87 Identities = 271/306 (88%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||||||||||||||| | |||||||||||| | ||| |||||||| ||||||||||| Sbjct: 393 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 334 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| | |||||||||| ||||||||||| || || |||| ||| ||||| Sbjct: 333 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 274 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| ||| ||||||||||||| |||||||| || || ||||| |||||||| || Sbjct: 273 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 214 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| Sbjct: 213 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 154 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||||||||| | |||||||||||| ||||| ||||||||||||||||||||||||||||| Sbjct: 153 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 94 Query: 524 aacgga 529 ||||| Sbjct: 93 gacgga 88
>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full insert sequence Length = 912 Score = 329 bits (166), Expect = 5e-87 Identities = 271/306 (88%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||||||||||||||| | |||||||||||| | ||| |||||||| ||||||||||| Sbjct: 463 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 404 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| | |||||||||| ||||||||||| || || |||| ||| ||||| Sbjct: 403 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 344 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| ||| ||||||||||||| |||||||| || || ||||| |||||||| || Sbjct: 343 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 284 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| Sbjct: 283 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 224 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||||||||| | |||||||||||| ||||| ||||||||||||||||||||||||||||| Sbjct: 223 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 164 Query: 524 aacgga 529 ||||| Sbjct: 163 gacgga 158
>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full insert sequence Length = 1097 Score = 329 bits (166), Expect = 5e-87 Identities = 271/306 (88%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||||||||||||||| | |||||||||||| | ||| |||||||| ||||||||||| Sbjct: 464 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 405 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| | |||||||||| ||||||||||| || || |||| ||| ||||| Sbjct: 404 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 345 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| ||| ||||||||||||| |||||||| || || ||||| |||||||| || Sbjct: 344 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 285 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| Sbjct: 284 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 225 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||||||||| | |||||||||||| ||||| ||||||||||||||||||||||||||||| Sbjct: 224 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 165 Query: 524 aacgga 529 ||||| Sbjct: 164 gacgga 159
>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence Length = 699 Score = 319 bits (161), Expect = 5e-84 Identities = 272/309 (88%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| || |||||||||| ||||||||||| ||||| ||||| ||||||||||| Sbjct: 461 cttcttgggcaggagcacggagtggatgttggggaggacgccaccgtgcgcgatggtgac 402 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| | |||||||||| ||||||||||| || || |||| ||||||||| Sbjct: 401 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 342 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| || |||||||| || || | ||| || ||||| || Sbjct: 341 gatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaactccagaacctcggc 282 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 |||||||||||| || |||||||||||||||||||||||||| | ||| |||||||| || Sbjct: 281 ggcgaggtactccagaacggcggcgaggtagacgggggcgccagtgcccacgcgctgcgc 222 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| Sbjct: 221 gtaccggcccttcttgaggtagcgcccgatccggccgacggggaactgcagcccggcctt 162 Query: 524 aacggaccg 532 |||||||| Sbjct: 161 gacggaccg 153
>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds Length = 714 Score = 276 bits (139), Expect = 7e-71 Identities = 265/308 (86%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| ||||| || | |||||| ||||||| ||| |||||||| |||||||| || Sbjct: 467 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 408 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | | |||| | || ||||||| |||||| |||| || ||||||| ||||||||| Sbjct: 407 gccgcccaacagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 348 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 || ||||| | ||||||||||||| |||| || || ||||||||||| || ||||| || Sbjct: 347 aataatgcgagtcttcttgttgtccctggcagcattaccggcgagctccagaacctcagc 288 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 ||||||||| |||||||| ||||||||||||||||||||||||| |||||| ||| || Sbjct: 287 ggcgaggtattcgaggacagcggcgaggtagacgggggcgccggtgccgacrrnctgcgc 228 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||| Sbjct: 227 gtagcggcccttcttcaagtagcgcccgatgcggccgacggggaactggagaccggcctt 168 Query: 524 aacggacc 531 ||||||| Sbjct: 167 cacggacc 160
>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence Length = 1051 Score = 264 bits (133), Expect = 3e-67 Identities = 263/308 (85%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| ||||| || | |||||| ||||||| ||| |||||||| |||||||| || Sbjct: 486 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 427 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| | || ||||||| |||||| |||| || ||||||| ||||||||| Sbjct: 426 gccgcccagcagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 367 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 || ||||| | ||||||||||||| |||| || || || |||||||| || ||||| || Sbjct: 366 aataatgcgagtcttcttgttgtccctggcagcattaccagcgagctccagaacctcagc 307 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 ||||||||| |||||||| |||||||||||||| |||||| |||||| ||||| || Sbjct: 306 ggcgaggtattcgaggacagcggcgaggtagacnnnnncgccggtgccgacacgctgcgc 247 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| Sbjct: 246 gtagcggcccttcttcaagtagcgcccgatgcggccgacggggaactggagcccggcctt 187 Query: 524 aacggacc 531 ||||||| Sbjct: 186 cacggacc 179
>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence Length = 772 Score = 254 bits (128), Expect = 3e-64 Identities = 269/316 (85%) Strand = Plus / Minus Query: 217 cggcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcga 276 |||||| |||||||||||| || |||| ||| |||||||| | ||| |||||||| |||| Sbjct: 456 cggcggccttcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcga 397 Query: 277 tggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggt 336 ||||||| || | |||||| |||||||||||| ||||||||||| |||||| || |||| Sbjct: 396 tggtgaccccacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggt 337 Query: 337 ggcgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagca 396 |||||||||||||||||| ||||||||||| ||||||||||| || ||||| || | Sbjct: 336 ggcgcgggatgatgcgggttttcttgttgtcgcgcgccgcgttgccagccagctccagga 277 Query: 397 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgc 456 |||| |||||||||||||||||||||||||| ||| | ||||| ||||| | ||| |||| Sbjct: 276 cctcagcggcgaggtactcgaggacggcggccaggaacacgggagcgcccgtgcccacgc 217 Query: 457 gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcc 516 |||| ||||| || || ||||| ||||| || ||||||||||| |||||||| |||||| Sbjct: 216 gctgcgcgtaccgccctttcttcaggtaccgtccgatgcggcccacggggaaaaggagcc 157 Query: 517 cggccttaacggaccg 532 |||||||||| ||||| Sbjct: 156 cggccttaactgaccg 141
>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence Length = 846 Score = 248 bits (125), Expect = 2e-62 Identities = 260/305 (85%) Strand = Plus / Minus Query: 225 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 284 ||||||||||||||||| | |||||||||||| | || |||||||| |||||||||||| Sbjct: 396 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 337 Query: 285 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 344 ||||| || ||| | |||||||||| ||||||||||| || || || | ||| |||||| Sbjct: 336 ccggccagtagcttcccgagctcctcgtcgttgcggatcgccagcagtacgtgccgcggg 277 Query: 345 atgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcg 404 ||||| ||| ||||||||||||| || ||||| || || | ||| || | ||| ||| Sbjct: 276 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 217 Query: 405 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcg 464 |||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||| | Sbjct: 216 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 157 Query: 465 tagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctta 524 ||||| |||| |||||||||||| ||||| ||||| |||||||||||||| |||||||| Sbjct: 156 tagcgaccctgcttgaggtagcggccgatacggcctacggggaactggaggccggccttc 97 Query: 525 acgga 529 ||||| Sbjct: 96 acgga 92
>ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 522 Score = 240 bits (121), Expect = 4e-60 Identities = 130/133 (97%) Strand = Plus / Minus Query: 397 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgc 456 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 217 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgc 158 Query: 457 gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcc 516 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 157 gctgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcc 98 Query: 517 cggccttaacgga 529 ||||||| ||||| Sbjct: 97 cggccttgacgga 85 Score = 143 bits (72), Expect = 7e-31 Identities = 153/180 (85%) Strand = Plus / Minus Query: 219 gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 278 |||| |||||| ||||||||||| | ||||||||| || | |||||||||||| |||||| Sbjct: 446 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 387 Query: 279 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 338 ||||| |||||||||||| | |||||||||| ||||||||||| || || |||| ||| Sbjct: 386 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 327 Query: 339 cgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacc 398 | ||||||||| ||| ||||||||||||| |||||||| ||||||||||| |||||| Sbjct: 326 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 267
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 240 bits (121), Expect = 4e-60 Identities = 130/133 (97%) Strand = Plus / Minus Query: 397 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgc 456 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 707152 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgc 707093 Query: 457 gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcc 516 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 707092 gctgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcc 707033 Query: 517 cggccttaacgga 529 ||||||| ||||| Sbjct: 707032 cggccttgacgga 707020 Score = 194 bits (98), Expect = 2e-46 Identities = 125/134 (93%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| | Sbjct: 22512575 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 22512634 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||||||| Sbjct: 22512635 cgctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagc 22512694 Query: 516 ccggccttaacgga 529 |||||||| ||||| Sbjct: 22512695 ccggccttgacgga 22512708 Score = 145 bits (73), Expect = 2e-31 Identities = 154/181 (85%) Strand = Plus / Minus Query: 219 gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 278 |||| |||||| ||||||||||| | ||||||||| || | |||||||||||| |||||| Sbjct: 707409 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 707350 Query: 279 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 338 ||||| |||||||||||| | |||||||||| ||||||||||| || || |||| ||| Sbjct: 707349 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 707290 Query: 339 cgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacc 398 | ||||||||| ||| ||||||||||||| |||||||| ||||||||||| |||||| Sbjct: 707289 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 707230 Query: 399 t 399 | Sbjct: 707229 t 707229 Score = 143 bits (72), Expect = 7e-31 Identities = 150/176 (85%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||||||||||||||| | |||||||||||| | ||| |||||||| ||||||||||| Sbjct: 22512327 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 22512386 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| | |||||||||| ||||||||||| || || |||| ||| ||||| Sbjct: 22512387 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 22512446 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacct 399 |||||| ||| ||||||||||||| |||||||| || || ||||| ||||||| Sbjct: 22512447 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacct 22512502 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 136 ccttggcggcggccttcttc 155 |||||||||||||||||||| Sbjct: 5731675 ccttggcggcggccttcttc 5731656
>gb|AY104486.1| Zea mays PCO109435 mRNA sequence Length = 992 Score = 240 bits (121), Expect = 4e-60 Identities = 259/305 (84%) Strand = Plus / Minus Query: 225 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 284 ||||||||||||||||| | |||||||||||| | || |||||||| |||||||||||| Sbjct: 467 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 408 Query: 285 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 344 ||||| || ||| | |||||||||| |||||||||| || || || | ||| |||||| Sbjct: 407 ccggccagtagcttcccgagctcctcatcgttgcggatcgccagcagtacgtgtcgcggg 348 Query: 345 atgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcg 404 ||||| ||| ||||||||||||| || ||||| || || | ||| || | ||| ||| Sbjct: 347 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 288 Query: 405 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcg 464 |||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||| | Sbjct: 287 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 228 Query: 465 tagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctta 524 ||||| |||| |||||||||||| ||||| ||||| |||||||||||||| |||||||| Sbjct: 227 tagcgaccctgcttgaggtagcggccgatacggcctacggggaactggaggccggccttc 168 Query: 525 acgga 529 ||||| Sbjct: 167 acgga 163
>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0041A22, complete sequence Length = 117919 Score = 240 bits (121), Expect = 4e-60 Identities = 130/133 (97%) Strand = Plus / Minus Query: 397 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgc 456 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 52351 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgc 52292 Query: 457 gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcc 516 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 52291 gctgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcc 52232 Query: 517 cggccttaacgga 529 ||||||| ||||| Sbjct: 52231 cggccttgacgga 52219 Score = 145 bits (73), Expect = 2e-31 Identities = 154/181 (85%) Strand = Plus / Minus Query: 219 gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 278 |||| |||||| ||||||||||| | ||||||||| || | |||||||||||| |||||| Sbjct: 52608 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 52549 Query: 279 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 338 ||||| |||||||||||| | |||||||||| ||||||||||| || || |||| ||| Sbjct: 52548 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 52489 Query: 339 cgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacc 398 | ||||||||| ||| ||||||||||||| |||||||| ||||||||||| |||||| Sbjct: 52488 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 52429 Query: 399 t 399 | Sbjct: 52428 t 52428
>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence Length = 538 Score = 220 bits (111), Expect = 4e-54 Identities = 152/165 (92%), Gaps = 3/165 (1%) Strand = Plus / Plus Query: 139 tggcggcggccttcttcttgggggacttggtagcggtcttcttcttgggcgacttggtgg 198 ||||||| | |||||||||||||||||||| || |||||||||||||||||||||| Sbjct: 182 tggcggccgtcttcttcttgggggacttggcggccgtcttcttcttgggcgacttgg--- 238 Query: 199 cctccttctcggctgcggcggcggacttcttggggagcagcacggagttgatgttgggga 258 ||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||| Sbjct: 239 cctccttctcggcggcggcaggggacttcttggggagcagcacggagttgatgttgggga 298 Query: 259 tcacgccgccgtgggcgatggtgacgccggcgagcagcctgccga 303 |||| ||||||||||||||||||||||||||||||||| |||||| Sbjct: 299 tcacaccgccgtgggcgatggtgacgccggcgagcagcttgccga 343 Score = 40.1 bits (20), Expect = 7.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 137 cttggcggcggccttcttcttgggggacttgg 168 ||||||||| | |||||||||||| ||||||| Sbjct: 207 cttggcggccgtcttcttcttgggcgacttgg 238
>ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA Length = 405 Score = 214 bits (108), Expect = 2e-52 Identities = 252/300 (84%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||||||||| |||| | || ||||||||| || |||||||||| |||||||||||| Sbjct: 363 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 304 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | || ||||||| | ||||||| ||||||||| |||||||| | | ||| | ||| Sbjct: 303 ggcgccgagcaggcgcgacagctcctcgtcgttgcgcacggcgagctggatgtgcctcgg 244 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 | ||| || | ||||||||||||| |||||||| |||||||||||||| ||||| || Sbjct: 243 cacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctcaagaacctcggc 184 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct: 183 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacgcgctcggc 124 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||| ||| ||||||| |||| |||| | ||||||||||||||||||||||||||| Sbjct: 123 gtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagcccggcctt 64
>ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA Length = 823 Score = 212 bits (107), Expect = 9e-52 Identities = 191/219 (87%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| |||||||||||| |||||||||| ||||| |||||||| || | ||| Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || ||||| | | ||||||||| | |||||||| |||||||||||| Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 | | |||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309 Query: 428 gaggtagacgggggcgccggagccgacgcgctgggcgta 466 ||||||||||||||| |||| ||||||||||| |||||| Sbjct: 308 gaggtagacgggggccccggcgccgacgcgctcggcgta 270
>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full insert sequence Length = 823 Score = 212 bits (107), Expect = 9e-52 Identities = 191/219 (87%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| |||||||||||| |||||||||| ||||| |||||||| || | ||| Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || ||||| | | ||||||||| | |||||||| |||||||||||| Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 | | |||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309 Query: 428 gaggtagacgggggcgccggagccgacgcgctgggcgta 466 ||||||||||||||| |||| ||||||||||| |||||| Sbjct: 308 gaggtagacgggggccccggcgccgacgcgctcggcgta 270
>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full insert sequence Length = 824 Score = 212 bits (107), Expect = 9e-52 Identities = 191/219 (87%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| || ||||||||| |||||||||| ||||| |||||||| || |||||| Sbjct: 454 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 395 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || ||||| | | ||||||||| | ||||||| |||||||||||| Sbjct: 394 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 335 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 | | |||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| Sbjct: 334 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 275 Query: 428 gaggtagacgggggcgccggagccgacgcgctgggcgta 466 |||||||||||| ||||||| ||||||||||| |||||| Sbjct: 274 gaggtagacgggagcgccggcgccgacgcgctcggcgta 236
>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full insert sequence Length = 733 Score = 212 bits (107), Expect = 9e-52 Identities = 191/219 (87%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| || ||||||||| |||||||||| ||||| |||||||| || |||||| Sbjct: 453 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 394 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || ||||| | | ||||||||| | ||||||| |||||||||||| Sbjct: 393 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 334 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 | | |||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| Sbjct: 333 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 274 Query: 428 gaggtagacgggggcgccggagccgacgcgctgggcgta 466 |||||||||||| ||||||| ||||||||||| |||||| Sbjct: 273 gaggtagacgggagcgccggcgccgacgcgctcggcgta 235
>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full insert sequence Length = 1718 Score = 212 bits (107), Expect = 9e-52 Identities = 191/219 (87%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| |||||||||||| |||||||||| ||||| |||||||| || | ||| Sbjct: 489 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 430 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || ||||| | | ||||||||| | |||||||| |||||||||||| Sbjct: 429 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 370 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 | | |||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| Sbjct: 369 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 310 Query: 428 gaggtagacgggggcgccggagccgacgcgctgggcgta 466 ||||||||||||||| |||| ||||||||||| |||||| Sbjct: 309 gaggtagacgggggccccggcgccgacgcgctcggcgta 271
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 210 bits (106), Expect = 3e-51 Identities = 127/134 (94%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||| | Sbjct: 9471496 acctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 9471555 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 9471556 cgctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 9471615 Query: 516 ccggccttaacgga 529 |||||||| ||||| Sbjct: 9471616 ccggccttgacgga 9471629 Score = 151 bits (76), Expect = 3e-33 Identities = 115/128 (89%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 28998067 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 28998008 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| ||||| ||| |||||||||||| |||||||||||||||||||||||||| Sbjct: 28998007 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 28997948 Query: 516 ccggcctt 523 |||||||| Sbjct: 28997947 ccggcctt 28997940 Score = 151 bits (76), Expect = 3e-33 Identities = 151/176 (85%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| || Sbjct: 9471223 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9471282 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| |||||||||||| |||||| | || || || |||| ||||||||| Sbjct: 9471283 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9471342 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacct 399 |||||| | | ||||||||||||| |||||||||| ||||||||||| ||||||| Sbjct: 9471343 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 9471398 Score = 87.7 bits (44), Expect = 3e-14 Identities = 53/56 (94%) Strand = Plus / Minus Query: 474 ttcttgaggtagcgcccgatgcggccgacggggaactggagcccggccttaacgga 529 |||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| Sbjct: 2464021 ttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacgga 2463966 Score = 56.0 bits (28), Expect = 1e-04 Identities = 121/152 (79%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||||| |||||| |||||| | | |||||||||| ||||| Sbjct: 28998319 gatgttgggcagcacgccgccggcggcgatcgtgacggtgcccagcagcctgctcagctc 28998260 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || || || | | ||| ||||| | ||| | | |||||||||||| Sbjct: 28998259 ctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttgttgtc 28998200 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| ||||| ||||| ||||||| Sbjct: 28998199 cctcgccgcgttcccggccagctccagcacct 28998168 Score = 42.1 bits (21), Expect = 1.8 Identities = 39/45 (86%) Strand = Plus / Minus Query: 374 cgcgttgccggcgagctcaagcacctctgcggcgaggtactcgag 418 |||||||||||| ||||| || ||||| |||| ||||||||||| Sbjct: 3353558 cgcgttgccggccagctccaggacctcggcggttaggtactcgag 3353514
>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0002D01, from chromosome 3, complete sequence Length = 187589 Score = 210 bits (106), Expect = 3e-51 Identities = 127/134 (94%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||| | Sbjct: 168896 acctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 168955 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 168956 cgctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 169015 Query: 516 ccggccttaacgga 529 |||||||| ||||| Sbjct: 169016 ccggccttgacgga 169029 Score = 151 bits (76), Expect = 3e-33 Identities = 151/176 (85%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| || Sbjct: 168623 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 168682 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| |||||||||||| |||||| | || || || |||| ||||||||| Sbjct: 168683 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 168742 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacct 399 |||||| | | ||||||||||||| |||||||||| ||||||||||| ||||||| Sbjct: 168743 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 168798
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 210 bits (106), Expect = 3e-51 Identities = 127/134 (94%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||| | Sbjct: 9469617 acctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 9469676 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 9469677 cgctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 9469736 Query: 516 ccggccttaacgga 529 |||||||| ||||| Sbjct: 9469737 ccggccttgacgga 9469750 Score = 151 bits (76), Expect = 3e-33 Identities = 115/128 (89%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 29089489 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 29089430 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| ||||| ||| |||||||||||| |||||||||||||||||||||||||| Sbjct: 29089429 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 29089370 Query: 516 ccggcctt 523 |||||||| Sbjct: 29089369 ccggcctt 29089362 Score = 151 bits (76), Expect = 3e-33 Identities = 151/176 (85%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| || Sbjct: 9469344 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9469403 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| |||||||||||| |||||| | || || || |||| ||||||||| Sbjct: 9469404 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9469463 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacct 399 |||||| | | ||||||||||||| |||||||||| ||||||||||| ||||||| Sbjct: 9469464 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 9469519 Score = 87.7 bits (44), Expect = 3e-14 Identities = 53/56 (94%) Strand = Plus / Minus Query: 474 ttcttgaggtagcgcccgatgcggccgacggggaactggagcccggccttaacgga 529 |||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| Sbjct: 2464131 ttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacgga 2464076 Score = 56.0 bits (28), Expect = 1e-04 Identities = 121/152 (79%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||||| |||||| |||||| | | |||||||||| ||||| Sbjct: 29089741 gatgttgggcagcacgccgccggcggcgatcgtgacggtgcccagcagcctgctcagctc 29089682 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || || || | | ||| ||||| | ||| | | |||||||||||| Sbjct: 29089681 ctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttgttgtc 29089622 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| ||||| ||||| ||||||| Sbjct: 29089621 cctcgccgcgttcccggccagctccagcacct 29089590 Score = 42.1 bits (21), Expect = 1.8 Identities = 39/45 (86%) Strand = Plus / Minus Query: 374 cgcgttgccggcgagctcaagcacctctgcggcgaggtactcgag 418 |||||||||||| ||||| || ||||| |||| ||||||||||| Sbjct: 3353669 cgcgttgccggccagctccaggacctcggcggttaggtactcgag 3353625
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 210 bits (106), Expect = 3e-51 Identities = 127/134 (94%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| | Sbjct: 17416866 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 17416807 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 ||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 17416806 cgctgcgcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 17416747 Query: 516 ccggccttaacgga 529 |||||||| ||||| Sbjct: 17416746 ccggccttgacgga 17416733 Score = 151 bits (76), Expect = 3e-33 Identities = 151/176 (85%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| || Sbjct: 17417149 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 17417090 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| |||||||||||| |||||| | || || || |||| ||||||||| Sbjct: 17417089 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 17417030 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacct 399 |||||| | | ||||||||||||| |||||||||| ||||||||||| ||||||| Sbjct: 17417029 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 17416974 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 272 ggcgatggtgacgccggcgag 292 ||||||||||||||||||||| Sbjct: 23243788 ggcgatggtgacgccggcgag 23243768 Score = 40.1 bits (20), Expect = 7.2 Identities = 32/36 (88%) Strand = Plus / Minus Query: 245 gttgatgttggggatcacgccgccgtgggcgatggt 280 |||||||||||| | ||| ||||| ||||||||||| Sbjct: 43063370 gttgatgttgggcagcactccgccatgggcgatggt 43063335 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 421 cggcggcgaggtagacgggg 440 |||||||||||||||||||| Sbjct: 31905177 cggcggcgaggtagacgggg 31905196
>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0507H06 Length = 136351 Score = 210 bits (106), Expect = 3e-51 Identities = 127/134 (94%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| | Sbjct: 70258 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 70199 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 ||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 70198 cgctgcgcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 70139 Query: 516 ccggccttaacgga 529 |||||||| ||||| Sbjct: 70138 ccggccttgacgga 70125 Score = 151 bits (76), Expect = 3e-33 Identities = 151/176 (85%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| || Sbjct: 70541 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 70482 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| |||||||||||| |||||| | || || || |||| ||||||||| Sbjct: 70481 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 70422 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacct 399 |||||| | | ||||||||||||| |||||||||| ||||||||||| ||||||| Sbjct: 70421 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 70366
>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full insert sequence Length = 747 Score = 198 bits (100), Expect = 1e-47 Identities = 232/276 (84%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||||| ||||||||||||| || |||||||||||| ||||| Sbjct: 455 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 396 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || || || | | ||| | ||| | ||| ||| |||||||||||| Sbjct: 395 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 336 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 | | |||||||| || || ||||| |||||||| ||||||||||||||||||||||||| Sbjct: 335 cctcgccgcgttccccgccagctccagcacctcggcggcgaggtactcgaggacggcgga 276 Query: 428 gaggtagacgggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcg 487 |||||||||||||||||||| ||||||||||| |||||| ||| ||||||||| | Sbjct: 275 gaggtagacgggggcgccggcgccgacgcgctcggcgtacttgccggccttgaggtacct 216 Query: 488 cccgatgcggccgacggggaactggagcccggcctt 523 ||||||||||||||||||||||||| |||||||| Sbjct: 215 ggcgatgcggccgacggggaactggaggccggcctt 180
>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full insert sequence Length = 724 Score = 198 bits (100), Expect = 1e-47 Identities = 232/276 (84%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||||| |||||| |||||| | | |||||||||| ||||| Sbjct: 452 gatgttgggcagcacgccgccggcggcgatcgtgacggtgcccagcagcctgctcagctc 393 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || || || | | ||| ||||| | ||| | | |||||||||||| Sbjct: 392 ctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttgttgtc 333 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 | | |||||||| ||||| ||||| |||||||| ||||||||||||||||||||||||| Sbjct: 332 cctcgccgcgttcccggccagctccagcacctcggcggcgaggtactcgaggacggcgga 273 Query: 428 gaggtagacgggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcg 487 |||||||||||||||||||| ||||||||||| ||||| ||| |||||||||||| Sbjct: 272 gaggtagacgggggcgccggcgccgacgcgctccgcgtacttgccggccttgaggtagcg 213 Query: 488 cccgatgcggccgacggggaactggagcccggcctt 523 |||||||||||||||||||||||||||||||||| Sbjct: 212 ggcgatgcggccgacggggaactggagcccggcctt 177
>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete sequence Length = 93826 Score = 194 bits (98), Expect = 2e-46 Identities = 125/134 (93%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| | Sbjct: 7625 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 7684 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||||||| Sbjct: 7685 cgctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagc 7744 Query: 516 ccggccttaacgga 529 |||||||| ||||| Sbjct: 7745 ccggccttgacgga 7758 Score = 143 bits (72), Expect = 7e-31 Identities = 150/176 (85%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||||||||||||||| | |||||||||||| | ||| |||||||| ||||||||||| Sbjct: 7377 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 7436 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| | |||||||||| ||||||||||| || || |||| ||| ||||| Sbjct: 7437 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 7496 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacct 399 |||||| ||| ||||||||||||| |||||||| || || ||||| ||||||| Sbjct: 7497 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacct 7552
>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05, complete sequence Length = 163130 Score = 194 bits (98), Expect = 2e-46 Identities = 125/134 (93%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| | Sbjct: 101982 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 102041 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 ||||||| ||||||||| | |||||||||||| ||||| ||||||||||||||||||||| Sbjct: 102042 cgctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagc 102101 Query: 516 ccggccttaacgga 529 |||||||| ||||| Sbjct: 102102 ccggccttgacgga 102115 Score = 143 bits (72), Expect = 7e-31 Identities = 150/176 (85%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||||||||||||||| | |||||||||||| | ||| |||||||| ||||||||||| Sbjct: 101734 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 101793 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||||| |||||| | |||||||||| ||||||||||| || || |||| ||| ||||| Sbjct: 101794 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 101853 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacct 399 |||||| ||| ||||||||||||| |||||||| || || ||||| ||||||| Sbjct: 101854 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacct 101909
>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4 Length = 725 Score = 174 bits (88), Expect = 2e-40 Identities = 247/300 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||||||||| | | || ||||||||| || || |||||| |||||| ||||| Sbjct: 445 cttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtgac 386 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | ||||||| | | |||||||| |||||||||||||||||| | | ||||||||| Sbjct: 385 catgccgagcaggcgggagagctcctcgtcgttgcggacggcgagctggatgtggcgcgg 326 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 | |||||||| ||||||||||||| | |||||||| ||||| | ||| || ||||| || Sbjct: 325 cacgatgcgggtcttcttgttgtccctcgccgcgttcccggccaactccagaacctcagc 266 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 |||||| ||||| || |||||||||||||||||||||||||||| |||||| | || ||| Sbjct: 265 ggcgagatactccagcacggcggcgaggtagacgggggcgccggcgccgaccctctcggc 206 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||| ||| ||||||| | ||| |||| | ||||||||||||||||||||||||||| Sbjct: 205 gtacttgccggccttgaggaaccgcgcgatcctgccgacggggaactggagcccggcctt 146
>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-10 Length = 691 Score = 170 bits (86), Expect = 3e-39 Identities = 188/222 (84%) Strand = Plus / Minus Query: 302 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttctt 361 |||||||| |||||||||||||||||| | | ||||||||| | |||||||| |||||| Sbjct: 369 gagctcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttctt 310 Query: 362 gttgtccttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 421 ||||||| | |||||||| ||||| | ||| || ||||| |||||||| ||||| || || Sbjct: 309 gttgtccctcgccgcgttcccggccaactccagaacctcagcggcgagatactccagcac 250 Query: 422 ggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtagcggcccttcttgag 481 |||||||||||||||||||||||||| |||||| | || |||||| ||| |||||| Sbjct: 249 ggcggcgaggtagacgggggcgccggcgccgaccctctcggcgtacttgccggccttgag 190 Query: 482 gtagcgcccgatgcggccgacggggaactggagcccggcctt 523 | | ||| |||| | ||||||||||||||||||||||||||| Sbjct: 189 gaaccgcgcgatcctgccgacggggaactggagcccggcctt 148
>ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA Length = 830 Score = 167 bits (84), Expect = 5e-38 Identities = 135/152 (88%) Strand = Plus / Minus Query: 303 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttg 362 ||||||| |||||||||||||||||| | | |||||| || | ||||||| ||||||| Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380 Query: 363 ttgtccttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacg 422 |||||| | |||||||| |||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacg 320 Query: 423 gcggcgaggtagacgggggcgccggagccgac 454 |||||||||||||| |||||||||| |||||| Sbjct: 319 gcggcgaggtagaccggggcgccggcgccgac 288 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 501 acggggaactggagcccggcctt 523 ||||||||||||||||||||||| Sbjct: 241 acggggaactggagcccggcctt 219
>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full insert sequence Length = 830 Score = 167 bits (84), Expect = 5e-38 Identities = 135/152 (88%) Strand = Plus / Minus Query: 303 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttg 362 ||||||| |||||||||||||||||| | | |||||| || | ||||||| ||||||| Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380 Query: 363 ttgtccttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacg 422 |||||| | |||||||| |||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacg 320 Query: 423 gcggcgaggtagacgggggcgccggagccgac 454 |||||||||||||| |||||||||| |||||| Sbjct: 319 gcggcgaggtagaccggggcgccggcgccgac 288 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 501 acggggaactggagcccggcctt 523 ||||||||||||||||||||||| Sbjct: 241 acggggaactggagcccggcctt 219
>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0031O09, complete sequence Length = 161339 Score = 151 bits (76), Expect = 3e-33 Identities = 115/128 (89%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 38208 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 38149 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| ||||| ||| |||||||||||| |||||||||||||||||||||||||| Sbjct: 38148 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 38089 Query: 516 ccggcctt 523 |||||||| Sbjct: 38088 ccggcctt 38081 Score = 56.0 bits (28), Expect = 1e-04 Identities = 121/152 (79%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||||| |||||| |||||| | | |||||||||| ||||| Sbjct: 38460 gatgttgggcagcacgccgccggcggcgatcgtgacggtgcccagcagcctgctcagctc 38401 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || || || | | ||| ||||| | ||| | | |||||||||||| Sbjct: 38400 ctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttgttgtc 38341 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| ||||| ||||| ||||||| Sbjct: 38340 cctcgccgcgttcccggccagctccagcacct 38309
>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map near C10769, complete sequence Length = 194856 Score = 151 bits (76), Expect = 3e-33 Identities = 115/128 (89%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 141224 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 141283 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| ||||| ||| |||||||||||| |||||||||||||||||||||||||| Sbjct: 141284 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 141343 Query: 516 ccggcctt 523 |||||||| Sbjct: 141344 ccggcctt 141351 Score = 56.0 bits (28), Expect = 1e-04 Identities = 121/152 (79%) Strand = Plus / Plus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||||| |||||| |||||| | | |||||||||| ||||| Sbjct: 140972 gatgttgggcagcacgccgccggcggcgatcgtgacggtgcccagcagcctgctcagctc 141031 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || || || | | ||| ||||| | ||| | | |||||||||||| Sbjct: 141032 ctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttgttgtc 141091 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| ||||| ||||| ||||||| Sbjct: 141092 cctcgccgcgttcccggccagctccagcacct 141123
>gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic sequence, complete sequence Length = 184366 Score = 151 bits (76), Expect = 3e-33 Identities = 115/128 (89%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 181362 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 181303 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| ||||| ||| |||||||||||| |||||||||||||||||||||||||| Sbjct: 181302 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 181243 Query: 516 ccggcctt 523 |||||||| Sbjct: 181242 ccggcctt 181235 Score = 56.0 bits (28), Expect = 1e-04 Identities = 121/152 (79%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||||| |||||| |||||| | | |||||||||| ||||| Sbjct: 181614 gatgttgggcagcacgccgccggcggcgatcgtgacggtgcccagcagcctgctcagctc 181555 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || || || | | ||| ||||| | ||| | | |||||||||||| Sbjct: 181554 ctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttgttgtc 181495 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| ||||| ||||| ||||||| Sbjct: 181494 cctcgccgcgttcccggccagctccagcacct 181463
>gb|AY110108.1| Zea mays CL14299_1 mRNA sequence Length = 712 Score = 151 bits (76), Expect = 3e-33 Identities = 208/252 (82%) Strand = Plus / Plus Query: 272 ggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaag 331 |||||||||||| | |||||||| ||| ||| |||| ||||||||| |||||||| | Sbjct: 320 ggcgatggtgacagctccgagcagcttgctgagttcctcgtcgttgcgcacggcgagctg 379 Query: 332 caggtggcgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 | ||| ||||| | ||||||| |||||||||||| ||||||||||| || || || Sbjct: 380 gatgtgacgcggcacgatgcggttcttcttgttgtcgcgcgccgcgttgcccgccagttc 439 Query: 392 aagcacctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagcc 451 | ||||||||| ||||| |||||||||||||||| |||||||||||| || || ||| Sbjct: 440 caacacctctgccgcgagatactcgaggacggcggagaggtagacgggcgcaccaccgcc 499 Query: 452 gacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactg 511 |||||||| |||||| ||| ||||||||||||| |||||||||||||||||||||| Sbjct: 500 gacgcgctcggcgtacttgccggccttgaggtagcgcgcgatgcggccgacggggaactg 559 Query: 512 gagcccggcctt 523 ||||||||||| Sbjct: 560 cagcccggcctt 571
>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete cds Length = 2120 Score = 143 bits (72), Expect = 7e-31 Identities = 201/244 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || |||||||||||||| Sbjct: 1165 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatggtgac 1106 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||| ||||| || ||||||| || || Sbjct: 1105 gccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacgggg 1046 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||||| |||||||||||| ||| || |||||||| ||||| || | ||| || Sbjct: 1045 gatgatgcgggtcttcttgttgtcgcgggcggcattgccggccagctccaggatctcggc 986 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||| |||||||| || ||||| | ||||||||| ||||||| ||| || | |||||| Sbjct: 985 ggtgagatactcgagcacagcggccaagtagacgggagcgccggcgcccaccctctgggc 926 Query: 464 gtag 467 |||| Sbjct: 925 gtag 922
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 143 bits (72), Expect = 7e-31 Identities = 114/128 (89%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 20566250 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 20566191 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| |||||| ||| ||||||| |||| |||| | ||||||||||||||||||| Sbjct: 20566190 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 20566131 Query: 516 ccggcctt 523 |||||||| Sbjct: 20566130 ccggcctt 20566123 Score = 85.7 bits (43), Expect = 1e-13 Identities = 79/91 (86%) Strand = Plus / Plus Query: 397 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgc 456 |||||||||| |||||| |||||||||| |||||||||||||||| ||| | |||||||| Sbjct: 11503412 cctctgcggcaaggtacccgaggacggcagcgaggtagacgggggtgccagtgccgacgc 11503471 Query: 457 gctgggcgtagcggcccttcttgaggtagcg 487 | || |||| ||||| |||| ||||||||| Sbjct: 11503472 gttgcgcgtgccggccgttctcgaggtagcg 11503502 Score = 79.8 bits (40), Expect = 8e-12 Identities = 142/176 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||||||||| |||| | || ||||||||| || |||||||||| |||||||||||| Sbjct: 20566519 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 20566460 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | || ||||||| | ||||||| ||||||||| |||||||| | | ||| | ||| Sbjct: 20566459 ggcgccgagcaggcgcgacagctcctcgtcgttgcgcacggcgagctggatgtgcctcgg 20566400 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacct 399 | ||| || | ||||||||||||| |||||||| |||||||||||||| |||| Sbjct: 20566399 cacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctcaagaacct 20566344 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Minus Query: 161 ggacttggtagcggtcttcttcttgggcga 190 ||||||| |||||| ||||||||||||||| Sbjct: 14201382 ggacttgatagcgggcttcttcttgggcga 14201353
>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0032E15 Length = 120419 Score = 143 bits (72), Expect = 7e-31 Identities = 114/128 (89%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 70211 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 70152 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| |||||| ||| ||||||| |||| |||| | ||||||||||||||||||| Sbjct: 70151 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 70092 Query: 516 ccggcctt 523 |||||||| Sbjct: 70091 ccggcctt 70084 Score = 79.8 bits (40), Expect = 8e-12 Identities = 142/176 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||||||||| |||| | || ||||||||| || |||||||||| |||||||||||| Sbjct: 70480 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 70421 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | || ||||||| | ||||||| ||||||||| |||||||| | | ||| | ||| Sbjct: 70420 ggcgccgagcaggcgcgacagctcctcgtcgttgcgcacggcgagctggatgtgcctcgg 70361 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacct 399 | ||| || | ||||||||||||| |||||||| |||||||||||||| |||| Sbjct: 70360 cacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctcaagaacct 70305
>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1663_D06 Length = 139103 Score = 143 bits (72), Expect = 7e-31 Identities = 114/128 (89%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 40622 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 40563 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| |||||| ||| ||||||| |||| |||| | ||||||||||||||||||| Sbjct: 40562 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 40503 Query: 516 ccggcctt 523 |||||||| Sbjct: 40502 ccggcctt 40495 Score = 79.8 bits (40), Expect = 8e-12 Identities = 142/176 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||||||||| |||| | || ||||||||| || |||||||||| |||||||||||| Sbjct: 40891 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 40832 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | || ||||||| | ||||||| ||||||||| |||||||| | | ||| | ||| Sbjct: 40831 ggcgccgagcaggcgcgacagctcctcgtcgttgcgcacggcgagctggatgtgcctcgg 40772 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacct 399 | ||| || | ||||||||||||| |||||||| |||||||||||||| |||| Sbjct: 40771 cacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctcaagaacct 40716
>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone MGC:11561 IMAGE:3156946), complete cds Length = 1414 Score = 137 bits (69), Expect = 4e-29 Identities = 204/249 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 228 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| ||| Sbjct: 227 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 168 Query: 464 gtagcggcc 472 |||| |||| Sbjct: 167 gtagtggcc 159
>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence Length = 185902 Score = 137 bits (69), Expect = 4e-29 Identities = 204/249 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 149654 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 149713 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 149714 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 149773 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 149774 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 149833 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| ||| Sbjct: 149834 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 149893 Query: 464 gtagcggcc 472 |||| |||| Sbjct: 149894 gtagtggcc 149902
>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA Length = 1414 Score = 137 bits (69), Expect = 4e-29 Identities = 204/249 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 228 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| ||| Sbjct: 227 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 168 Query: 464 gtagcggcc 472 |||| |||| Sbjct: 167 gtagtggcc 159
>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA Length = 547 Score = 137 bits (69), Expect = 4e-29 Identities = 207/253 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | | ||||||||| | ||||||||| ||||||||||| || Sbjct: 389 cttcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgggcgatggtcac 330 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 ||| | |||||| || ||||||| ||||||||| ||||| || ||||||| ||||| Sbjct: 329 tccgcccagcagcttgttcagctcctcgtcgttgcgcacggccagctgcaggtgccgcgg 270 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| | || |||||||||||| ||| ||||| ||||| ||||| || | ||| || Sbjct: 269 gatgatcctggtcttcttgttgtcgcgggcggcgttcccggccagctccaggatctcagc 210 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || |||||||| || ||||| || |||||||| |||||||||| |||||| |||||||| Sbjct: 209 ggtcaggtactccagcacggccgccaggtagaccggggcgccggcgccgacacgctgggc 150 Query: 464 gtagcggcccttc 476 |||| ||||||| Sbjct: 149 gtagttgcccttc 137
>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X Length = 2166 Score = 137 bits (69), Expect = 4e-29 Identities = 204/249 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 986 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 927 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 926 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 867 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 866 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 807 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| ||| Sbjct: 806 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 747 Query: 464 gtagcggcc 472 |||| |||| Sbjct: 746 gtagtggcc 738
>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone MGC:6616 IMAGE:3490058), complete cds Length = 1367 Score = 137 bits (69), Expect = 4e-29 Identities = 204/249 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 401 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 342 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 341 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 282 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 281 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 222 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| ||| Sbjct: 221 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 162 Query: 464 gtagcggcc 472 |||| |||| Sbjct: 161 gtagtggcc 153
>gb|AY108339.1| Zea mays PCO070432 mRNA sequence Length = 811 Score = 137 bits (69), Expect = 4e-29 Identities = 132/153 (86%) Strand = Plus / Minus Query: 302 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttctt 361 |||||||| |||||||||||||||||| | | ||||||||||| |||||||| |||||| Sbjct: 395 gagctcctcgtcgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttctt 336 Query: 362 gttgtccttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 421 ||||||| |||||||| ||||| ||||| || ||||| || || || |||||||| || Sbjct: 335 gttgtcccgagccgcgttcccggcaagctcgagaacctcagcagcaagatactcgagcac 276 Query: 422 ggcggcgaggtagacgggggcgccggagccgac 454 ||| |||||||||||||||||||||| |||||| Sbjct: 275 ggcagcgaggtagacgggggcgccggcgccgac 243 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 504 gggaactggagcccggcctt 523 |||||||||||||||||||| Sbjct: 193 gggaactggagcccggcctt 174
>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA Length = 393 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 125
>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2 (LOC665433), mRNA Length = 465 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 392 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 333 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 213 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 212 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 157
>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1 (LOC665433), mRNA Length = 467 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 394 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 335 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 334 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 275 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 274 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 215 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 214 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 159
>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a novel gene, the genes for three H1, four H2a, five H2b, four H3 and four H4 histone family members, the 3' end of a variant of the Hfe gene for hemochromatosis protein (Mr2) and ten CpG islands, complete sequence Length = 184730 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 163973 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 164032 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 164033 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 164092 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 164093 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 164152 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 164153 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 164208 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 55436 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 55377 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 55376 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 55317 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 55316 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 55257 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 55256 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 55201 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 51355 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 51414 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 51415 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 51474 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 51475 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 51534 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 51535 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 51590 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 14872 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 14813 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | | |||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 14812 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 14753 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 14752 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 14693 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 14692 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 14637
>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA Length = 2493 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 225 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 224 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 169
>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the genes for H2b histone family member A, two H2a, two H4 and an H2b histone family member, a serine/threonine protein kinase pseudogene, a novel pseudogene, a novel gene (4930500C15Rik), the gene for a novel KRAB box and C2H2 Zinc Finger containing protein, a ribosomal protein L21 (RPL21) pseudogene, a TU mitochondrial translation elongation factor (tufa) pseudogene, the 5' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121 and four CpG islands, complete sequence Length = 182817 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 33283 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 33342 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 33343 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 33402 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 33403 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 33462 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 33463 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 33518 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 10993 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 10934 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 10933 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 10874 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 10873 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 10814 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 10813 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 10758
>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the 3' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121, the Prss16 gene for thymus serine protease16, three novel genes, the genes for two H2a, two H2b and one H4 histone family members, a ribosomal protein L37A (Rpl37a) pseudogene, a novel pseudogene, three genes for novel vomeronasal 1 receptor H (V1rh) family members, the gene for a novel vomeronasal 1 receptor I (V1ri) family member, six V1ri pseudogenes, a V1rh pseudogene and six CpG islands, complete sequence Length = 210845 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 59924 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 59983 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 59984 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60043 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 60044 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 60103 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 60104 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 60159 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 52549 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 52608 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 52609 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 52668 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 52669 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 52728 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 52729 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 52784
>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771 IMAGE:1263745), complete cds Length = 527 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 203 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 202 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 147
>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length enriched library, clone:I0C0045N09 product:histone 1, H2ad, full insert sequence Length = 446 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 393 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 334 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 333 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 274 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 273 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 214 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 213 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 158
>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched library, clone:I920064A15 product:histone 1, H2ad, full insert sequence Length = 445 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 212 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 211 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 156
>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds Length = 444 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 192 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 137
>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA Length = 527 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 203 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 202 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 147
>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched library, clone:9030420B16 product:histone 1, H2ac, full insert sequence Length = 2493 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 225 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 224 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 169
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 135 bits (68), Expect = 2e-28 Identities = 113/128 (88%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 20924703 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 20924762 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| |||||| ||| ||||||||| | ||||||||||||||||||||||||| Sbjct: 20924763 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 20924822 Query: 516 ccggcctt 523 |||||||| Sbjct: 20924823 ccggcctt 20924830 Score = 111 bits (56), Expect = 2e-21 Identities = 128/152 (84%) Strand = Plus / Plus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| || ||||||||| |||||||||| ||||| |||||||| || |||||| Sbjct: 14468549 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14468608 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || ||||| | | ||||||||| | ||||||| |||||||||||| Sbjct: 14468609 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14468668 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| ||||||||||| ||||||| Sbjct: 14468669 cctcgccgcgttcccggcgagctccagcacct 14468700 Score = 109 bits (55), Expect = 9e-21 Identities = 67/71 (94%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 14468900 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 14468959 Query: 456 cgctgggcgta 466 |||| |||||| Sbjct: 14468960 cgctcggcgta 14468970 Score = 71.9 bits (36), Expect = 2e-09 Identities = 123/152 (80%) Strand = Plus / Plus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||||| ||||||||||||| || |||||||||||| ||||| Sbjct: 20924457 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20924516 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || || || | | ||| | ||| | ||| ||| |||||||||||| Sbjct: 20924517 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 20924576 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| || || ||||| ||||||| Sbjct: 20924577 cctcgccgcgttccccgccagctccagcacct 20924608
>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds Length = 1390 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 680 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 625
>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds Length = 1392 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 859 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 800 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 799 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 740 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 739 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 680 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 679 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 624
>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds Length = 1390 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 680 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 625
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 135 bits (68), Expect = 2e-28 Identities = 113/128 (88%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 20850917 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 20850976 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| |||||| ||| ||||||||| | ||||||||||||||||||||||||| Sbjct: 20850977 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 20851036 Query: 516 ccggcctt 523 |||||||| Sbjct: 20851037 ccggcctt 20851044 Score = 111 bits (56), Expect = 2e-21 Identities = 128/152 (84%) Strand = Plus / Plus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| || ||||||||| |||||||||| ||||| |||||||| || |||||| Sbjct: 14422833 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14422892 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || ||||| | | ||||||||| | ||||||| |||||||||||| Sbjct: 14422893 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14422952 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| ||||||||||| ||||||| Sbjct: 14422953 cctcgccgcgttcccggcgagctccagcacct 14422984 Score = 109 bits (55), Expect = 9e-21 Identities = 67/71 (94%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 14423184 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 14423243 Query: 456 cgctgggcgta 466 |||| |||||| Sbjct: 14423244 cgctcggcgta 14423254 Score = 71.9 bits (36), Expect = 2e-09 Identities = 123/152 (80%) Strand = Plus / Plus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||||| ||||||||||||| || |||||||||||| ||||| Sbjct: 20850671 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20850730 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || || || | | ||| | ||| | ||| ||| |||||||||||| Sbjct: 20850731 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 20850790 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| || || ||||| ||||||| Sbjct: 20850791 cctcgccgcgttccccgccagctccagcacct 20850822
>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 182172 Score = 135 bits (68), Expect = 2e-28 Identities = 113/128 (88%) Strand = Plus / Plus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 10193 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 10252 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| |||||| ||| ||||||||| | ||||||||||||||||||||||||| Sbjct: 10253 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 10312 Query: 516 ccggcctt 523 |||||||| Sbjct: 10313 ccggcctt 10320 Score = 71.9 bits (36), Expect = 2e-09 Identities = 123/152 (80%) Strand = Plus / Plus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||||| ||||||||||||| || |||||||||||| ||||| Sbjct: 9947 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 10006 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || || || | | ||| | ||| | ||| ||| |||||||||||| Sbjct: 10007 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 10066 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| || || ||||| ||||||| Sbjct: 10067 cctcgccgcgttccccgccagctccagcacct 10098
>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 107819 Score = 135 bits (68), Expect = 2e-28 Identities = 113/128 (88%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 34292 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 34233 Query: 456 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 515 |||| |||||| ||| ||||||||| | ||||||||||||||||||||||||| Sbjct: 34232 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 34173 Query: 516 ccggcctt 523 |||||||| Sbjct: 34172 ccggcctt 34165 Score = 71.9 bits (36), Expect = 2e-09 Identities = 123/152 (80%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||||| ||||||||||||| || |||||||||||| ||||| Sbjct: 34538 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 34479 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || || || | | ||| | ||| | ||| ||| |||||||||||| Sbjct: 34478 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 34419 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| || || ||||| ||||||| Sbjct: 34418 cctcgccgcgttccccgccagctccagcacct 34387
>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV), and histone H2B (ch2b-IV) genes, complete cds Length = 4502 Score = 135 bits (68), Expect = 2e-28 Identities = 242/300 (80%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| || ||||||||| | ||| ||||| ||||||||| || Sbjct: 3115 cttcttgggcagcagcacggcgtggatgttgggcagcacaccgcccgaggcgatggtcac 3174 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | |||||| |||| ||||||| |||||||||| ||| || | | |||||| || Sbjct: 3175 ctcgcccagcagcttgcccagctcctcatcgttgcggatggccagctggatgtggcgagg 3234 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 | |||||| |||||||||||| ||| ||||||||||| ||||| |||||||| || Sbjct: 3235 cacaatgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagc 3294 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || |||||||| || |||||||| ||||| ||||| ||||||| |||| ||||| ||| Sbjct: 3295 ggtcaggtactccagcacggcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3354 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||| ||||||||| ||||||||| | |||||||| || |||||||| || |||||||| Sbjct: 3355 gtacttgcccttcttcaggtagcgcgcaatgcggcccacagggaactgcaggccggcctt 3414
>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II), histone H2B (ch2b-II) and histone H2A (ch2a-II) genes, complete cds Length = 3777 Score = 135 bits (68), Expect = 2e-28 Identities = 242/300 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| || ||||||||| | ||| ||||| ||||||||| || Sbjct: 3579 cttcttgggcagcagcacggcgtggatgttgggcagcacaccgcccgaggcgatggtcac 3520 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | |||||| |||| ||||||| |||||||||| ||| || | | |||||| || Sbjct: 3519 ctcgcccagcagcttgcccagctcctcatcgttgcggatggccagctggatgtggcgggg 3460 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 | ||||||| |||||||||||| ||| ||||||||||| ||||| |||||||| || Sbjct: 3459 cacgatgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagc 3400 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||||||||||| || ||||| ||||| ||||| ||||||| |||| ||||| ||| Sbjct: 3399 ggtcaggtactcgagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3340 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||| ||||||||| |||||||| | |||||||| || |||||||| || |||||||| Sbjct: 3339 gtacttgcccttcttcaggtagcgtgcaatgcggcccacagggaactgcaggccggcctt 3280
>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430002L09 product:H2A histone family, member X, full insert sequence Length = 1379 Score = 131 bits (66), Expect = 3e-27 Identities = 205/250 (82%), Gaps = 1/250 (0%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 430 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 371 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 370 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 311 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 310 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 251 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacg-ggggcgccggagccgacgcgctggg 462 | |||||||||||| || || || ||||| ||| || ||||| | ||| ||||||| || Sbjct: 250 agtgaggtactcgagcaccgctgccaggtacacgcggcgcgcctgcgcccacgcgctcgg 191 Query: 463 cgtagcggcc 472 ||||| |||| Sbjct: 190 cgtagtggcc 181
>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X Length = 1359 Score = 129 bits (65), Expect = 1e-26 Identities = 203/249 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 411 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 352 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 351 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 292 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 291 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 232 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| ||| Sbjct: 231 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 172 Query: 464 gtagcggcc 472 |||| |||| Sbjct: 171 gtagtggcc 163
>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010005I09 product:H2A histone family, member X, full insert sequence Length = 564 Score = 129 bits (65), Expect = 1e-26 Identities = 204/249 (81%), Gaps = 1/249 (0%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 427 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 368 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 367 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 308 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 307 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 248 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| ||| Sbjct: 247 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctg-gcccacgcgctcggc 189 Query: 464 gtagcggcc 472 |||| |||| Sbjct: 188 gtagtggcc 180
>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and histone H2A genes, complete cds Length = 4358 Score = 129 bits (65), Expect = 1e-26 Identities = 191/233 (81%) Strand = Plus / Minus Query: 291 agcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatg 350 |||||| |||| ||||||| ||||||||||| ||| || | | |||||| || | |||| Sbjct: 4093 agcagcttgcccagctcctcgtcgttgcggatggccagctggatgtggcggggcacgatg 4034 Query: 351 cgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcggcgagg 410 ||| |||||||||||| ||| ||||||||||| ||||| |||||||| |||| ||| Sbjct: 4033 cggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagcggtcagg 3974 Query: 411 tactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtagcgg 470 ||||| || || ||||| ||||| ||||| ||||||| |||| ||||| |||||| | Sbjct: 3973 tactccagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtacttg 3914 Query: 471 cccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 |||||||| ||||||||| | |||||||| ||||||||||| || |||||||| Sbjct: 3913 cccttcttcaggtagcgcgcaatgcggccaacggggaactgcaggccggcctt 3861
>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence Length = 209720 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 64629 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 64570 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 64569 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 64510 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 64509 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 64450 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 64449 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 64394 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 60548 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 60607 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 60608 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60667 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 60668 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 60727 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 60728 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 60783 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 101108 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 101167 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | | |||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 101168 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 101227 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 101228 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 101287 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 101288 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 101343
>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome 13 Length = 1357 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 663 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 662 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 607
>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained intron Length = 497 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 212 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 211 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 156
>emb|BX063165.1|CNS09KWH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| ||||||||||| || Sbjct: 524 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 583 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| |||||| || ||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 584 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 643 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| ||||||||| || || ||||| ||||| || || Sbjct: 644 gatgatgcgcgtcttcttgttgtcgcgggccgcgttacccgccagctcgagcacttccgc 703 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 || |||||||| | ||| ||||| || ||||||| ||||| | |||||||||| Sbjct: 704 cgccaggtactccatgaccgcggccagaaagacgggcgcgcccgctccgacgcgct 759
>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) Length = 1826 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 1308 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1249 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 1248 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1189 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 1188 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1129 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 1128 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1073
>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) Length = 1797 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 1309 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1250 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 1249 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1190 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 1189 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1130 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 1129 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1074
>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571 IMAGE:30789778), complete cds Length = 1075 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 370 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 311 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 310 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 251 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 250 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 191 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 190 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 135
>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five genes for olfactory receptors, a novel gene, the H1f5 gene for H1 histone family member 5, three genes and one pseudogene for H2a histone family members, four genes for H2b, two genes for H4, and two genes for H3 histone family members and seven CpG islands, complete sequence Length = 222823 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 142450 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142509 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 142510 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142569 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 142570 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 142629 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 142630 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 142685 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 137771 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 137712 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 137711 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137652 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 137651 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 137592 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 137591 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137536 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 174458 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 174517 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 174518 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 174577 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||| ||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 174578 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 174637 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 174638 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 174693 Score = 111 bits (56), Expect = 2e-21 Identities = 173/212 (81%) Strand = Plus / Plus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||| || |||||||| |||| | | |||||| || |||||| Sbjct: 207873 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 207932 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||||| ||| || |||||||||||||||||||||| | |||||||||||| Sbjct: 207933 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 207992 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 |||||||||||| || ||||| || | ||| || | |||||||| || ||||| || Sbjct: 207993 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 208052 Query: 428 gaggtagacgggggcgccggagccgacgcgct 459 ||||| || |||||||||| ||| ||||||| Sbjct: 208053 caggtacaccggggcgccggcgcccacgcgct 208084
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 136886 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 136945 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 136946 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137005 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 137006 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 137065 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 137066 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137121 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 142180 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142121 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 142120 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142061 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 142060 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 142013
>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847 IMAGE:5713252), complete cds Length = 492 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 390 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 331 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 330 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 271 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 270 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 211 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 210 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 155
>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730004H15 product:histone 1, H2ai, full insert sequence Length = 1396 Score = 127 bits (64), Expect = 4e-26 Identities = 194/236 (82%), Gaps = 1/236 (0%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 371 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 312 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || ||| |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 311 gc-ggccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 192 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137
>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA Length = 506 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 405 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 346 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 345 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 286 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 285 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 226 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 225 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 170
>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds Length = 447 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 192 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137
>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 Length = 2110 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 630 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 571 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 570 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 511 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 510 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 451 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 450 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 395
>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 Length = 2221 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 628 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 569 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 568 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 509 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 508 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 449 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 448 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 393
>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA Length = 705 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 294 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 293 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 238
>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA Length = 393 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125
>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone H2b-F (H2b-F) genes, complete cds Length = 2822 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 1469 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1528 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 1529 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1588 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 1589 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1648 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 1649 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1704
>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1190022L06 product:HISTONE H2A homolog [Homo sapiens], full insert sequence Length = 705 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 294 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 293 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 238
>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA Length = 393 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125
>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds Length = 1390 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625
>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds Length = 1390 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625
>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds Length = 1390 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625
>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds Length = 1381 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 677 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 622
>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence Length = 1357 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 663 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 662 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 607
>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds Length = 1387 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 677 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 622
>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 (ENSANGG00000013551), partial mRNA Length = 375 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| ||||||||||| || Sbjct: 357 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 298 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| |||||| || ||||||| ||||||||||| ||| || |||| |||||||| Sbjct: 297 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 238 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| ||||||||| || || ||||| ||||| || || Sbjct: 237 gatgatgcgcgtcttcttgttgtcgcgggccgcgttacccgccagctcgagcacttccgc 178 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 || |||||||| | ||| ||||| || |||||||| ||||| | |||||||||| Sbjct: 177 cgccaggtactccatgaccgcggccagatagacgggcgcgcccgctccgacgcgct 122
>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 (ENSANGG00000000004), mRNA Length = 630 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| ||||||||||| || Sbjct: 471 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 412 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| |||||| || ||||||| ||||||||||| ||| || |||| |||||||| Sbjct: 411 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 352 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| ||||||||| || || ||||| ||||| || || Sbjct: 351 gatgatgcgcgtcttcttgttgtcgcgggccgcgttacccgccagctcgagcacttccgc 292 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 || |||||||| | ||| ||||| || |||||||| ||||| | |||||||||| Sbjct: 291 cgccaggtactccatgaccgcggccagatagacgggcgcgcccgctccgacgcgct 236
>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA Length = 387 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125
>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene Length = 668 Score = 127 bits (64), Expect = 4e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 483 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 424 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 423 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 364 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 363 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 304 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 303 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 248
>emb|BX063164.1|CNS09KWG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 924 Score = 123 bits (62), Expect = 6e-25 Identities = 182/222 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| ||||||||||| || Sbjct: 477 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 418 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| |||||| || ||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 417 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 358 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| ||||||| | || || ||||| ||||| || || Sbjct: 357 gatgatgcgcgtcttcttgttgtcgcgggccgcgatacccgccagctcgagcacttccgc 298 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgcc 445 || |||||||| | ||| ||||| || |||||||| ||||| Sbjct: 297 cgccaggtactccatgaccgcggccagatagacgggcgcgcc 256
>gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and histone H2A variant (H2AInr) genes, complete cds Length = 2396 Score = 123 bits (62), Expect = 6e-25 Identities = 199/244 (81%), Gaps = 3/244 (1%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| |||||||||||||| Sbjct: 1584 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgggcgatggtgac 1525 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 ||| | |||||| || |||||||| ||||||||| ||||| || ||||||| || || Sbjct: 1524 tccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacgggg 1465 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||||| |||||||||| ||| || |||||||| ||||| || | ||| || Sbjct: 1464 gatgatgcggg---tcttgttgtcgcgggcggcattgccggccagctccaggatctcggc 1408 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||| |||||||| || ||||| | ||||||||| ||||||| ||| || | |||||| Sbjct: 1407 ggtgagatactcgagcacagcggccaagtagacgggagcgccggcgcccaccctctgggc 1348 Query: 464 gtag 467 |||| Sbjct: 1347 gtag 1344
>ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H2A.x (H2a/x) (LOC466864), mRNA Length = 432 Score = 121 bits (61), Expect = 2e-24 Identities = 205/253 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || |||||||| || || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 300 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| || | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 240 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 180 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 121 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 120 gtagtggcccttc 108
>gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone MGC:4759 IMAGE:3537648), complete cds Length = 1580 Score = 121 bits (61), Expect = 2e-24 Identities = 205/253 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || |||||||| || || Sbjct: 403 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 344 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 343 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 284 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| || | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 283 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 224 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 223 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 164 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 163 gtagtggcccttc 151
>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x) (LOC489372), mRNA Length = 841 Score = 121 bits (61), Expect = 2e-24 Identities = 205/253 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || || ||||| || || Sbjct: 657 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgcgcgatcgtcac 598 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 597 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 538 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 537 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 478 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 | ||||||||||| ||||| || ||||| || || ||||||| ||| || |||| ||| Sbjct: 477 cgtcaggtactcgagcacggccgccaggtacaccggcgcgccggcgcccacccgctcggc 418 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 417 gtagtggcccttc 405
>ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AFX), mRNA Length = 1651 Score = 121 bits (61), Expect = 2e-24 Identities = 205/253 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || |||||||| || || Sbjct: 433 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 374 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 373 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 314 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| || | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 313 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 254 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 253 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 194 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 193 gtagtggcccttc 181
>emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X Length = 1585 Score = 121 bits (61), Expect = 2e-24 Identities = 205/253 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || |||||||| || || Sbjct: 433 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 374 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 373 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 314 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| || | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 313 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 254 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 253 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 194 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 193 gtagtggcccttc 181
>gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone MGC:4703 IMAGE:3534359), complete cds Length = 1616 Score = 121 bits (61), Expect = 2e-24 Identities = 205/253 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || |||||||| || || Sbjct: 398 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 339 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 338 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 279 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| || | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 278 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 219 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 218 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 159 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 158 gtagtggcccttc 146
>emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 1373 Score = 121 bits (61), Expect = 2e-24 Identities = 205/253 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || |||||||| || || Sbjct: 415 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 356 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 355 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 296 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| || | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 295 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 236 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 235 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 176 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 175 gtagtggcccttc 163
>gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX) gene, complete cds Length = 5462 Score = 121 bits (61), Expect = 2e-24 Identities = 205/253 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || |||||||| || || Sbjct: 2431 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 2372 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 2371 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 2312 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| || | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 2311 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 2252 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 2251 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 2192 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 2191 gtagtggcccttc 2179
>gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone MGC:19656 IMAGE:3139343), complete cds Length = 1589 Score = 121 bits (61), Expect = 2e-24 Identities = 205/253 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || |||||||| || || Sbjct: 413 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 354 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 353 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 294 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| || | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 293 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 234 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 233 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 174 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 173 gtagtggcccttc 161
>gb|AY104828.1| Zea mays PCO072413 mRNA sequence Length = 741 Score = 121 bits (61), Expect = 2e-24 Identities = 157/189 (83%) Strand = Plus / Minus Query: 335 gtggcgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaag 394 ||||||||| | ||||||| ||||||||||||| | || ||||| ||||| || || || Sbjct: 309 gtggcgcggcacaatgcgggtcttcttgttgtccctcgcggcgttcccggcaagttcgag 250 Query: 395 cacctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgac 454 ||||| || ||||||||||||||||||||||||||||| ||||||||||||| |||||| Sbjct: 249 aacctcagccgcgaggtactcgaggacggcggcgaggtacacgggggcgccggcgccgac 190 Query: 455 gcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggag 514 ||||| ||||| |||| ||||||| | | | || | |||||||||||||||||| Sbjct: 189 gcgctccgcgtacttgcccgccttgaggaacctggcaatcctgccgacggggaactggag 130 Query: 515 cccggcctt 523 |||||||| Sbjct: 129 tccggcctt 121
>dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:CTD-2589C9, complete sequences Length = 46239 Score = 121 bits (61), Expect = 2e-24 Identities = 205/253 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || |||||||| || || Sbjct: 9807 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 9866 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 9867 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 9926 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| || | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 9927 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 9986 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 9987 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 10046 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 10047 gtagtggcccttc 10059
>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700), mRNA Length = 393 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| ||||| |||| | ||||||||| | ||||| || || |||||||| || Sbjct: 360 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||||| ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | ||||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 180 agtcaggtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 125
>emb|BX009846.1|CNS08FRE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 357 Score = 119 bits (60), Expect = 1e-23 Identities = 159/192 (82%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| ||||||||||| || Sbjct: 117 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 176 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| |||||| || ||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 177 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 236 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| ||||||||| || || ||||| ||||| || || Sbjct: 237 gatgatgcgcgtcttcttgttgtcgcgggccgcgttacccgccagctcgagcacttccgc 296 Query: 404 ggcgaggtactc 415 || |||||||| Sbjct: 297 cgccaggtactc 308
>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA Length = 393 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||| ||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 240 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 125
>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds Length = 1390 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 884 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 825 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | | |||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 824 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 765 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 764 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 705 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 704 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 649
>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds Length = 1201 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 894 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 835 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 834 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 775 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||| ||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 774 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 715 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 714 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 659
>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA Length = 393 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | | |||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125
>gb|AY104826.1| Zea mays PCO099353 mRNA sequence Length = 793 Score = 119 bits (60), Expect = 1e-23 Identities = 138/164 (84%) Strand = Plus / Minus Query: 303 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttg 362 ||||||| ||||||||| |||||||| | | ||| ||||| | |||||||| ||||||| Sbjct: 383 agctcctcgtcgttgcgcacggcgagctggatgtgacgcggcacgatgcgggtcttcttg 324 Query: 363 ttgtccttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacg 422 || ||| | || ||||| || || ||||| || ||||| |||||||||||||||||||| Sbjct: 323 ttatccctcgctgcgttcccagcaagctccaggacctcagcggcgaggtactcgaggaca 264 Query: 423 gcggcgaggtagacgggggcgccggagccgacgcgctgggcgta 466 || ||||||||||| |||||||||| ||| ||||||| |||||| Sbjct: 263 gctgcgaggtagacaggggcgccggcgcccacgcgctcggcgta 220
>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence Length = 567 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || ||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 363 gcggcccagcagcttgttgagctccacgtcgttgcggatggccagctgcaggtggcgcgg 304 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 303 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 244 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 243 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 188
>ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone H2A.x (H2a/x) (LOC500987), mRNA Length = 1569 Score = 117 bits (59), Expect = 4e-23 Identities = 197/243 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 639 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatagtcac 580 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| || || ||||||||||||| Sbjct: 579 gccgcccagcagcttgttgagctcctcgtcgttgcggatagccagctgcaggtggcgcgg 520 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||| ||||| | ||||||||||||| ||||||||||| || ||||| || | ||| || Sbjct: 519 gataatgcgcgtcttcttgttgtcccgagccgcgttgcccgccagctccaggatctcggc 460 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 | |||||||||||| || || || ||||| ||||| ||||| | ||| ||||||| ||| Sbjct: 459 agtgaggtactcgagcaccgccgccaggtacacgggcgcgcctgcgcccacgcgctcggc 400 Query: 464 gta 466 ||| Sbjct: 399 gta 397
>gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds Length = 643 Score = 115 bits (58), Expect = 2e-22 Identities = 145/174 (83%) Strand = Plus / Minus Query: 356 cttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactc 415 |||||| |||||| | |||||||| ||||| | ||| | ||||| || ||||||||||| Sbjct: 282 cttcttattgtccctcgccgcgtttccggccaactccaatacctcagcagcgaggtactc 223 Query: 416 gaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtagcggccctt 475 | |||||||||||||||||| || || |||| |||||| ||||| ||||| | |||||| Sbjct: 222 caagacggcggcgaggtagaccggagctccggtgccgacacgctgagcgtacctgccctt 163 Query: 476 cttgaggtagcgcccgatgcggccgacggggaactggagcccggccttaacgga 529 ||| | ||| || |||| ||||| ||||||||||||||||||||||| ||||| Sbjct: 162 cttcaagtatcggccgagacggccaacggggaactggagcccggccttgacgga 109
>emb|BX040864.1|CNS093P0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC11DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 115 bits (58), Expect = 2e-22 Identities = 181/222 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| ||||||||||| || Sbjct: 470 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 411 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| |||||| || ||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 410 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 351 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| ||||||| || || ||||| ||||| || || Sbjct: 350 gatgatgcgcgtcttcttgttgtcgcgggccgcgagacccgccagctcgagcacttccgc 291 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgcc 445 || |||||||| | ||| ||||| || |||||||| ||||| Sbjct: 290 cgccaggtactccatgaccgcggccagatagacgggcgcgcc 249
>emb|BX016452.1|CNS08KUW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 594 Score = 115 bits (58), Expect = 2e-22 Identities = 175/214 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| ||||||||||| || Sbjct: 74 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 133 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| |||||| || ||||||| ||||||||||| ||| | ||||||||||||| Sbjct: 134 cccggacagcagcttgttcagctcctcgtcgttgcggatggccaactgcaggtggcgcgg 193 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| ||||||||| || || ||||| ||||| || || Sbjct: 194 gatgatgcgcgtcttcttgttgtcgcgggccgcgttacccgccagctcgagcacttccgc 253 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacg 437 || |||||||| | ||| ||||| || |||||| Sbjct: 254 cgccaggtactccatgaccgcggccagatagacg 287
>gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent histone H2A mRNA, complete cds Length = 466 Score = 115 bits (58), Expect = 2e-22 Identities = 196/242 (80%) Strand = Plus / Minus Query: 226 tcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacgc 285 ||||||| |||||||||| | ||||||||| | || || || |||||||||||||| | Sbjct: 379 tcttgggcagcagcacggcctggatgttgggcaggacccccccctgggcgatggtgactc 320 Query: 286 cggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggga 345 || | |||||| || |||||||| ||||||||| ||||| || ||||||| || |||| Sbjct: 319 cgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacggggga 260 Query: 346 tgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcgg 405 ||||||| | |||||||||||| ||| || |||||||| ||||| || | ||| |||| Sbjct: 259 tgatgcgagtcttcttgttgtcgcgggcggcattgccggccagctccaggatctcggcgg 200 Query: 406 cgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcgt 465 ||| |||||||| || ||||| | ||||||||| ||||||| ||| || | |||||||| Sbjct: 199 tgagatactcgagcacagcggccaagtagacgggagcgccggcgcccaccctctgggcgt 140 Query: 466 ag 467 || Sbjct: 139 ag 138
>emb|CR457079.1| Homo sapiens full open reading frame cDNA clone RZPDo834A117D for gene H2AFX, H2A histone family, member X; complete cds, incl. stopcodon Length = 432 Score = 113 bits (57), Expect = 6e-22 Identities = 204/253 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||| || |||||||| || || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 300 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 |||||| | | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 240 gatgattagcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 180 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 121 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 120 gtagtggcccttc 108
>gb|AY104637.1| Zea mays PCO070433 mRNA sequence Length = 767 Score = 113 bits (57), Expect = 6e-22 Identities = 129/153 (84%) Strand = Plus / Minus Query: 302 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttctt 361 |||||| | |||||||||||||||||| | | ||||||||| | |||||||| |||||| Sbjct: 395 gagctcttcgtcgttgcggacggcgagctggatgtggcgcggtacgatgcgggtcttctt 336 Query: 362 gttgtccttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 421 |||||| ||||| |||||||| |||||||| ||||| || || || |||||||| || Sbjct: 335 gttgtcacgtgccgcattgccggccagctcaagaacctcagcagcaagatactcgagcac 276 Query: 422 ggcggcgaggtagacgggggcgccggagccgac 454 ||| ||||||||||| |||||||||| |||||| Sbjct: 275 ggcagcgaggtagacaggggcgccggcgccgac 243
>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds Length = 2132 Score = 113 bits (57), Expect = 6e-22 Identities = 183/225 (81%) Strand = Plus / Plus Query: 221 ggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggt 280 |||||||||||| ||||| |||| || |||||||| | ||| |||||| || ||||| Sbjct: 468 ggacttcttgggcagcagaacggcgtgaatgttgggcagcacaccgccggacgcaatggt 527 Query: 281 gacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcg 340 ||| || | |||||| |||| ||||||| ||||||||||| |||||| | | |||||| Sbjct: 528 cacgtcgcccagcagcttgcccagctcctcgtcgttgcggatggcgagctggatgtggcg 587 Query: 341 cgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctc 400 ||||| ||||||| |||||||||||| |||||||||||| || ||||| || ||||| Sbjct: 588 cgggacgatgcggttcttcttgttgtcgcgggccgcgttgccagccagctccagaacctc 647 Query: 401 tgcggcgaggtactcgaggacggcggcgaggtagacgggggcgcc 445 || | |||||||| || || ||||| ||||||||||||||||| Sbjct: 648 agcagtcaggtactccagcacagcggccaggtagacgggggcgcc 692
>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165 IMAGE:3355200), complete cds Length = 897 Score = 111 bits (56), Expect = 2e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| ||||| |||| | ||||||||| | ||||| || || |||||||| || Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||||| ||||| || | ||| || Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 223 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | | ||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 222 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 167
>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456 IMAGE:6671338), complete cds Length = 889 Score = 111 bits (56), Expect = 2e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| ||||| |||| | ||||||||| | ||||| || || |||||||| || Sbjct: 392 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 333 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||||| ||||| || | ||| || Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 213 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | | ||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 212 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 157
>gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds Length = 635 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 356 cttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactc 415 |||||||||||| | |||||||| ||||| | ||| | ||||||||||| |||||||| Sbjct: 267 cttcttgttgtctctcgccgcgtttccggccaactccaatacctctgcggctaggtactc 208 Query: 416 gaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtagcggccctt 475 |||||||||||| |||||||| || || |||| ||||| ||||| ||||| | |||||| Sbjct: 207 gaggacggcggcaaggtagaccggagctccggtaccgacacgctgagcgtacctgccctt 148 Query: 476 cttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||| | ||| || |||| || ||||||||||||||||| |||||||| Sbjct: 147 cttcaagtatcggccgagacgaccgacggggaactggaggccggcctt 100
>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA Length = 496 Score = 111 bits (56), Expect = 2e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| ||||| |||| | ||||||||| | ||||| || || |||||||| || Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||||| ||||| || | ||| || Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 223 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | | ||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 222 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 167
>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488308), mRNA Length = 456 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 363 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 304 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 303 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 256 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| || |||||||||||||||||| Sbjct: 153 gcggcccaccgggaactggagcccggcc 126
>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC611496), mRNA Length = 393 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488291), mRNA Length = 387 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193
>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289), mRNA Length = 393 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccactgggaactggagcccggcc 63
>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488278), mRNA Length = 576 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488272), mRNA Length = 393 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132), mRNA Length = 393 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193
>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488270), mRNA Length = 462 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 429 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 370 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 369 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 310 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 309 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 262 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| || |||||||||||||||||| Sbjct: 159 gcggcccaccgggaactggagcccggcc 132
>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488262), mRNA Length = 393 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082), mRNA Length = 393 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193
>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488254), mRNA Length = 417 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 384 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 325 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 324 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 265 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 264 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 217 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| || |||||||||||||||||| Sbjct: 114 gcggcccaccgggaactggagcccggcc 87
>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251), mRNA Length = 396 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193
>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l), transcript variant 2 (LOC488268), mRNA Length = 402 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193
>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l), transcript variant 1 (LOC488268), mRNA Length = 393 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193
>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203), mRNA Length = 393 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193
>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3, complete sequence Length = 151563 Score = 111 bits (56), Expect = 2e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| ||||| |||| | ||||||||| | ||||| || || |||||||| || Sbjct: 100907 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 100848 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 100847 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 100788 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||||| ||||| || | ||| || Sbjct: 100787 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 100728 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | | ||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 100727 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 100672
>emb|BX019683.1|CNS08NCN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA3AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 111 bits (56), Expect = 2e-21 Identities = 122/144 (84%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| ||||||||||| || Sbjct: 481 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 422 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| |||||| || ||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 421 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 362 Query: 344 gatgatgcgggacttcttgttgtc 367 ||||||||| | |||||||||||| Sbjct: 361 gatgatgcgcgtcttcttgttgtc 338
>emb|BX016451.1|CNS08KUV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 556 Score = 111 bits (56), Expect = 2e-21 Identities = 122/144 (84%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| ||||||||||| || Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 345 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| |||||| || ||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 344 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285 Query: 344 gatgatgcgggacttcttgttgtc 367 ||||||||| | |||||||||||| Sbjct: 284 gatgatgcgcgtcttcttgttgtc 261
>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 Length = 3210 Score = 111 bits (56), Expect = 2e-21 Identities = 140/168 (83%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 1933 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1874 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 1873 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1814 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 1813 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 1766
>gb|AY849374.1| Emiliania huxleyi histone H2A mRNA, complete cds Length = 680 Score = 111 bits (56), Expect = 2e-21 Identities = 203/252 (80%) Strand = Plus / Minus Query: 221 ggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggt 280 ||||||||| || || ||||| |||| ||||||||||| |||||||| || |||| ||| Sbjct: 357 ggacttcttcggcaggagcaccgagtggatgttggggaggacgccgccctgcgcgacggt 298 Query: 281 gacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcg 340 |||||| |||| | | || |||||||| ||||||||| || ||||| | ||| || Sbjct: 297 cacgccgccgaggaacttgttgagctcctcgtcgttgcgcaccgcgagggtgatgtgccg 238 Query: 341 cgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctc 400 || |||||||| |||||||||||||| || |||||||| |||||||| |||||||| Sbjct: 237 gggaatgatgcgcgacttcttgttgtcgcgcgcggcgttgcccgcgagctcgagcacctc 178 Query: 401 tgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctg 460 || || | |||||||||||||||||| |||||||| || || || | ||||| |||| Sbjct: 177 ggccgccatgtactcgaggacggcggccaggtagaccggcgctcccgcgccgatgcgcga 118 Query: 461 ggcgtagcggcc 472 |||||||||||| Sbjct: 117 ggcgtagcggcc 106
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 111 bits (56), Expect = 2e-21 Identities = 128/152 (84%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| |||||||||||| |||||||||| ||||| |||||||| || | ||| Sbjct: 21537003 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 21536944 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || ||||| | | ||||||||| | |||||||| |||||||||||| Sbjct: 21536943 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 21536884 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| ||||||||||| ||||||| Sbjct: 21536883 cctcgccgcgttcccggcgagctcgagcacct 21536852 Score = 109 bits (55), Expect = 9e-21 Identities = 67/71 (94%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||| Sbjct: 21536579 acctcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacg 21536520 Query: 456 cgctgggcgta 466 |||| |||||| Sbjct: 21536519 cgctcggcgta 21536509 Score = 93.7 bits (47), Expect = 6e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgac 454 ||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||| Sbjct: 21539259 acctcagcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 21539201 Score = 81.8 bits (41), Expect = 2e-12 Identities = 83/97 (85%) Strand = Plus / Minus Query: 303 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttg 362 ||||||| |||||||||||||||||| | | |||||| || | ||||||| ||||||| Sbjct: 21539587 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 21539528 Query: 363 ttgtccttggccgcgttgccggcgagctcaagcacct 399 |||||| | |||||||| |||||||||||||| |||| Sbjct: 21539527 ttgtccctcgccgcgttcccggcgagctcaagaacct 21539491 Score = 79.8 bits (40), Expect = 8e-12 Identities = 52/56 (92%) Strand = Plus / Plus Query: 474 ttcttgaggtagcgcccgatgcggccgacggggaactggagcccggccttaacgga 529 |||||||||||||||||||| |||| |||||| ||||||||||||||||| ||||| Sbjct: 22313886 ttcttgaggtagcgcccgatacggctgacgggcaactggagcccggccttgacgga 22313941 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 501 acggggaactggagcccggcctt 523 ||||||||||||||||||||||| Sbjct: 21539154 acggggaactggagcccggcctt 21539132
>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA Length = 393 Score = 111 bits (56), Expect = 2e-21 Identities = 173/212 (81%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||| || |||||||| |||| | | |||||| || |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||||| ||| || |||||||||||||||||||||| | |||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 |||||||||||| || ||||| || | ||| || | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 428 gaggtagacgggggcgccggagccgacgcgct 459 ||||| || |||||||||| ||| ||||||| Sbjct: 156 caggtacaccggggcgccggcgcccacgcgct 125
>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted) (Hist1h2an_predicted), mRNA Length = 546 Score = 111 bits (56), Expect = 2e-21 Identities = 182/224 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | | ||||||||| | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgtgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | ||||||||||||| | || |||||||| || ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtccctcgctgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137
>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds Length = 1390 Score = 111 bits (56), Expect = 2e-21 Identities = 173/212 (81%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||| || |||||||| |||| | | |||||| || |||||| Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||||| ||| || |||||||||||||||||||||| | |||||||||||| Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 |||||||||||| || ||||| || | ||| || | |||||||| || ||||| || Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 657 Query: 428 gaggtagacgggggcgccggagccgacgcgct 459 ||||| || |||||||||| ||| ||||||| Sbjct: 656 caggtacaccggggcgccggcgcccacgcgct 625
>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1582_D10 Length = 103475 Score = 111 bits (56), Expect = 2e-21 Identities = 128/152 (84%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| |||||||||||| |||||||||| ||||| |||||||| || | ||| Sbjct: 74787 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 74728 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || ||||| | | ||||||||| | |||||||| |||||||||||| Sbjct: 74727 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 74668 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| ||||||||||| ||||||| Sbjct: 74667 cctcgccgcgttcccggcgagctcgagcacct 74636 Score = 109 bits (55), Expect = 9e-21 Identities = 67/71 (94%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||| Sbjct: 74363 acctcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacg 74304 Query: 456 cgctgggcgta 466 |||| |||||| Sbjct: 74303 cgctcggcgta 74293 Score = 93.7 bits (47), Expect = 6e-16 Identities = 56/59 (94%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgac 454 ||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||| Sbjct: 77043 acctcagcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 76985 Score = 81.8 bits (41), Expect = 2e-12 Identities = 83/97 (85%) Strand = Plus / Minus Query: 303 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttg 362 ||||||| |||||||||||||||||| | | |||||| || | ||||||| ||||||| Sbjct: 77371 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 77312 Query: 363 ttgtccttggccgcgttgccggcgagctcaagcacct 399 |||||| | |||||||| |||||||||||||| |||| Sbjct: 77311 ttgtccctcgccgcgttcccggcgagctcaagaacct 77275 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 501 acggggaactggagcccggcctt 523 ||||||||||||||||||||||| Sbjct: 76938 acggggaactggagcccggcctt 76916
>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118101 Score = 111 bits (56), Expect = 2e-21 Identities = 128/152 (84%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| || ||||||||| |||||||||| ||||| |||||||| || |||||| Sbjct: 48743 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 48684 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||| || ||||| | | ||||||||| | ||||||| |||||||||||| Sbjct: 48683 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 48624 Query: 368 cttggccgcgttgccggcgagctcaagcacct 399 | | |||||||| ||||||||||| ||||||| Sbjct: 48623 cctcgccgcgttcccggcgagctccagcacct 48592 Score = 109 bits (55), Expect = 9e-21 Identities = 67/71 (94%) Strand = Plus / Minus Query: 396 acctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacg 455 ||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 48392 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 48333 Query: 456 cgctgggcgta 466 |||| |||||| Sbjct: 48332 cgctcggcgta 48322
>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence Length = 531 Score = 111 bits (56), Expect = 2e-21 Identities = 182/224 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 387 cttcttgggcagcagcacggcctggatgttgggcacgacgccgccctgcgcgatggtcac 328 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 327 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 268 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| | ||||| || | ||| || Sbjct: 267 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgccctccagctccaggatctcggc 208 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 207 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 164
>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III), histone H2B (ch2b-III) and histone H2A (ch2a-III) genes, complete cds Length = 4582 Score = 111 bits (56), Expect = 2e-21 Identities = 239/300 (79%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| || ||||||||| | ||| ||||| |||||| || || Sbjct: 3458 cttcttgggcagcagcacggcgtggatgttgggcagcacaccgcccgaggcgatcgtcac 3399 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | |||||| |||| ||||||| || ||||||| ||| || | | |||||| || Sbjct: 3398 ctcgcccagcagcttgcccagctcctcatcattgcggatggccagctggatgtggcgggg 3339 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 | ||| ||| |||||||||||| ||| ||||||||||| ||||| |||||||| || Sbjct: 3338 cacgatacggttcttcttgttgtcgcgggcggcgttgccggccagctctagcacctcagc 3279 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || |||||||| || || ||||| ||||| ||||| ||||||| |||| ||||| ||| Sbjct: 3278 ggtcaggtactccagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3219 Query: 464 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcctt 523 ||| ||||||||| ||||||||| | |||||||| || |||||||| || |||||||| Sbjct: 3218 gtacttgcccttcttcaggtagcgcgcaatgcggcccacagggaactgcaggccggcctt 3159
>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds Length = 929 Score = 111 bits (56), Expect = 2e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 523 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 464 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 463 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 404 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 403 gatgatgcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcggc 344 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || || || || ||||| || |||||||||| ||| ||||||| Sbjct: 343 cgtcaggtactccagcacagccgccaggtacaccggggcgccggcgcccacgcgct 288
>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds Length = 1173 Score = 111 bits (56), Expect = 2e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| ||||| |||| | ||||||||| | ||||| || || |||||||| || Sbjct: 752 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 693 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 692 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 633 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||||| ||||| || | ||| || Sbjct: 632 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 573 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | | ||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 572 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 517
>gb|BT016168.1| Zea mays clone Contig1 mRNA sequence Length = 676 Score = 105 bits (53), Expect = 1e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 335 gtggcgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaag 394 ||||||||| | ||| ||| ||||||||||||| || ||||| ||||| ||||| || Sbjct: 350 gtggcgcggcacgatacggttcttcttgttgtcccgagcagcgttcccggccagctccag 291 Query: 395 cacctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgac 454 |||||| |||||||| |||||||| ||||||| |||||| |||||||| |||| |||||| Sbjct: 290 cacctcggcggcgagatactcgagaacggcggagaggtacacgggggccccggcgccgac 231 Query: 455 gcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggag 514 ||||| || || || ||||||||| ||| ||||||| |||||||||||||| || Sbjct: 230 gcgctccgcatacttcccggccttgaggtaccgcgcgatgcgaccgacggggaactgaag 171 Query: 515 cccggcctt 523 ||| ||||| Sbjct: 170 cccagcctt 162
>ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX (Histone H2A.X) (H2a/x) (LOC531733), mRNA Length = 1724 Score = 105 bits (53), Expect = 1e-19 Identities = 203/253 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||| || |||||||||| | ||||||||| | ||||| || |||||||| || || Sbjct: 849 cttcttaggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 790 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 789 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 730 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||| || || | |||||||||||| |||||| ||||| || ||||| || | ||| || Sbjct: 729 gattatccgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 670 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 463 || |||||||||||| || || || |||||||| || ||||||| ||| || | || ||| Sbjct: 669 ggtgaggtactcgagtaccgccgccaggtagaccggcgcgccggcgcccaccctctcggc 610 Query: 464 gtagcggcccttc 476 |||| |||||||| Sbjct: 609 gtagtggcccttc 597
>gb|AF517874.1| Griffithsia japonica isolate Gj10 histone protein mRNA, partial cds Length = 628 Score = 105 bits (53), Expect = 1e-19 Identities = 173/213 (81%) Strand = Plus / Minus Query: 311 gtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtcctt 370 |||||| ||||||||||| | | |||||| |||||||| |||||||||||||| || Sbjct: 347 gtcgttacggacggcgagctggatgtggcgggggatgatacgggacttcttgttatcgcg 288 Query: 371 ggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggcgag 430 ||| ||||||||||||||||| |||||||| || | | |||||| | ||||||||| | Sbjct: 287 ggcggcgttgccggcgagctcgagcacctcggccgtcaagtactccatgacggcggccat 228 Query: 431 gtagacgggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgccc 490 || || |||||||||| ||| ||||| | |||||||| |||||| |||| |||| | Sbjct: 227 atacacaggggcgccggcgcccacgcggtcggcgtagccgcccttgcggaggaagcggtc 168 Query: 491 gatgcggccgacggggaactggagcccggcctt 523 ||| || ||||| |||||||| ||||||||||| Sbjct: 167 gatacgaccgaccgggaactgcagcccggcctt 135
>emb|X94693.1|TAH2A254 T.aestivum histone H2A gene Length = 2241 Score = 105 bits (53), Expect = 1e-19 Identities = 68/73 (93%) Strand = Plus / Minus Query: 394 gcacctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccga 453 ||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |||| Sbjct: 1295 gcacctcagcggcgaggtactcaaggacggcggcgaggtagacgggggcgccggctccga 1236 Query: 454 cgcgctgggcgta 466 |||||| |||||| Sbjct: 1235 cgcgctcggcgta 1223 Score = 79.8 bits (40), Expect = 8e-12 Identities = 118/144 (81%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| ||||| |||||| |||||||||| ||||| |||||| | || ||||| Sbjct: 1707 gatgttgggcatcacaccgccgctggcgatggtggcgccgccgagcaacttggtcagctc 1648 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||| ||||| |||||||| | | ||||||||| | ||| |||| |||||||||||| Sbjct: 1647 ctcgtcattgcgcacggcgagctggatgtggcgcggcacgatacgggtcttcttgttgtc 1588 Query: 368 cttggccgcgttgccggcgagctc 391 | |||| ||||| ||||| ||||| Sbjct: 1587 cctggcggcgtttccggccagctc 1564
>gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, complete cds Length = 2241 Score = 105 bits (53), Expect = 1e-19 Identities = 68/73 (93%) Strand = Plus / Minus Query: 394 gcacctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccga 453 ||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |||| Sbjct: 1295 gcacctcagcggcgaggtactcaaggacggcggcgaggtagacgggggcgccggctccga 1236 Query: 454 cgcgctgggcgta 466 |||||| |||||| Sbjct: 1235 cgcgctcggcgta 1223 Score = 79.8 bits (40), Expect = 8e-12 Identities = 118/144 (81%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| ||||| |||||| |||||||||| ||||| |||||| | || ||||| Sbjct: 1707 gatgttgggcatcacaccgccgctggcgatggtggcgccgccgagcaacttggtcagctc 1648 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||| ||||| |||||||| | | ||||||||| | ||| |||| |||||||||||| Sbjct: 1647 ctcgtcattgcgcacggcgagctggatgtggcgcggcacgatacgggtcttcttgttgtc 1588 Query: 368 cttggccgcgttgccggcgagctc 391 | |||| ||||| ||||| ||||| Sbjct: 1587 cctggcggcgtttccggccagctc 1564
>gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family member X (H2AX) mRNA, partial cds Length = 300 Score = 105 bits (53), Expect = 1e-19 Identities = 185/229 (80%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | ||||| || |||||||| || |||||| | |||||| || |||||| Sbjct: 297 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 238 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||||| ||| || |||||||||| ||||| || || | |||||||||||| Sbjct: 237 ctcgtcgttgcggatggccagctgcaggtggcgggggattatccgcgtcttcttgttgtc 178 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 |||||||||||| || ||||| || | ||| |||| |||||||||||| || || || Sbjct: 177 gcgggccgcgttgcccgccagctccaggatctcagcggtgaggtactcgagtaccgccgc 118 Query: 428 gaggtagacgggggcgccggagccgacgcgctgggcgtagcggcccttc 476 |||||||| || ||||||| ||| || | || ||||||| |||||||| Sbjct: 117 caggtagaccggcgcgccggcgcccaccctctcggcgtagtggcccttc 69
>gb|AY105006.1| Zea mays PCO108932 mRNA sequence Length = 841 Score = 105 bits (53), Expect = 1e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 335 gtggcgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaag 394 ||||||||| | ||| ||| ||||||||||||| || ||||| ||||| ||||| || Sbjct: 338 gtggcgcggcacgatacggttcttcttgttgtcccgagcagcgttcccggccagctccag 279 Query: 395 cacctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgac 454 |||||| |||||||| |||||||| ||||||| |||||| |||||||| |||| |||||| Sbjct: 278 cacctcggcggcgagatactcgagaacggcggagaggtacacgggggccccggcgccgac 219 Query: 455 gcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggag 514 ||||| || || || ||||||||| ||| ||||||| |||||||||||||| || Sbjct: 218 gcgctccgcatacttcccggccttgaggtaccgcgcgatgcgaccgacggggaactgaag 159 Query: 515 cccggcctt 523 ||| ||||| Sbjct: 158 cccagcctt 150
>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA, complete sequence Length = 786 Score = 103 bits (52), Expect = 6e-19 Identities = 190/236 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| || ||||| || || Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| |||||| |||||||||| || Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 264 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || || ||||||| ||| ||||||| Sbjct: 263 cgtcaggtactccagcacggccgccaggtacaccggcgcgccggcgcccacgcgct 208 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 173 gcggcccacggggaactgcagcccggcc 146
>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA, complete sequence Length = 786 Score = 103 bits (52), Expect = 6e-19 Identities = 190/236 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| || ||||| || || Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| |||||| |||||||||| || Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 264 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || || ||||||| ||| ||||||| Sbjct: 263 cgtcaggtactccagcacggccgccaggtacaccggcgcgccggcgcccacgcgct 208 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 173 gcggcccacggggaactgcagcccggcc 146
>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA Length = 393 Score = 103 bits (52), Expect = 6e-19 Identities = 139/168 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 |||||| ||||||||||||| | ||||||||| | |||||||| || ||||||||||| Sbjct: 360 cttcttagggagcagcacggcctggatgttgggcaggacgccgccctgagcgatggtgac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||| ||| ||||| Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaagtgacgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||||| ||||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgggtcttcttgttgtcccgggccgcgttgcccgccagctc 193
>gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds Length = 763 Score = 103 bits (52), Expect = 6e-19 Identities = 172/212 (81%) Strand = Plus / Plus Query: 225 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 284 ||||||||||||||||| || | ||||||||| | || ||||| |||||||||||||| Sbjct: 290 ttcttggggagcagcacagactggatgttgggcagaaccccgccctgggcgatggtgacc 349 Query: 285 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 344 || ||||||| || |||||||| ||||||||| |||||||| ||||||| | ||| Sbjct: 350 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 409 Query: 345 atgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcg 404 |||||||| | ||||||||| ||| ||| ||||||||||| | ||| || | ||| ||| Sbjct: 410 atgatgcgagtcttcttgttatcccgggcagcgttgccggccaactccaggatctcggcg 469 Query: 405 gcgaggtactcgaggacggcggcgaggtagac 436 | || |||||||| || ||||| |||||||| Sbjct: 470 gtcagatactcgagcaccgcggccaggtagac 501
>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299), mRNA Length = 387 Score = 103 bits (52), Expect = 6e-19 Identities = 139/168 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||||||||| Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297), mRNA Length = 393 Score = 103 bits (52), Expect = 6e-19 Identities = 139/168 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||||||||| Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193
>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129), mRNA Length = 393 Score = 103 bits (52), Expect = 6e-19 Identities = 181/224 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | | |||||| || | |||||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcaccgcctggatgtttggcagaacgccgccctgtgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | ||||||||||||| | || |||||||| || ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtccctcgctgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137
>gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, complete sequence Length = 571 Score = 103 bits (52), Expect = 6e-19 Identities = 190/236 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||| | |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 427 cttcttgagcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 368 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| || |||||||| ||||||||||| ||| || ||||||||| ||| Sbjct: 367 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcacgg 308 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | ||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 307 gatgatgcgcgttttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 248 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgct 459 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 247 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 192
>emb|X14730.1|CMHIST2A Duck H2A histone gene Length = 845 Score = 101 bits (51), Expect = 2e-18 Identities = 180/223 (80%) Strand = Plus / Minus Query: 225 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 284 |||||||| |||||||||| | ||||||||| | ||| ||||| || ||||||||||| Sbjct: 509 ttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtgacc 450 Query: 285 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 344 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| ||| Sbjct: 449 ttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcggggg 390 Query: 345 atgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcg 404 |||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 389 atgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctctaggatctcggcc 330 Query: 405 gcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 329 gttaggtactccagtacggccgccaggtacaccggggcgccgg 287 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 240 gcggcccacggggaactgcagcccggcc 213
>emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA Length = 775 Score = 97.6 bits (49), Expect = 4e-17 Identities = 173/213 (81%), Gaps = 1/213 (0%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | | ||||||||| | ||||||||| || |||||||| || Sbjct: 398 cttcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgagcgatggtcac 339 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | |||||| || |||||||| ||||||||| || || || |||||||||| || Sbjct: 338 tcctcccagcagcttgttgagctcctcgtcgttgcgcaccgccagctgcaggtggcgggg 279 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||||| ||||||||||| ||| ||||||||||| ||||| || | ||| || Sbjct: 278 gatgatgcggg-tttcttgttgtcgcgggcagcgttgccggccagctccaggatctcggc 220 Query: 404 ggcgaggtactcgaggacggcggcgaggtagac 436 || |||||||| || |||||||| |||||||| Sbjct: 219 ggtcaggtactccagcacggcggccaggtagac 187 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 495 cggccgacggggaactggagcccggcc 521 ||||||||||||||||||||||||||| Sbjct: 128 cggccgacggggaactggagcccggcc 102
>emb|BX008487.1|CNS08EPN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA13DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 408 Score = 97.6 bits (49), Expect = 4e-17 Identities = 122/145 (84%), Gaps = 1/145 (0%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| ||||||||||| || Sbjct: 231 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 172 Query: 284 g-ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcg 342 |||| |||||| || ||||||| ||||||||||| ||| || |||||||||||| Sbjct: 171 ctccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcg 112 Query: 343 ggatgatgcgggacttcttgttgtc 367 |||||||||| | |||||||||||| Sbjct: 111 ggatgatgcgcgtcttcttgttgtc 87
>ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020 (ENSANGG00000023190), partial mRNA Length = 297 Score = 97.6 bits (49), Expect = 4e-17 Identities = 189/235 (80%), Gaps = 3/235 (1%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||||||||| ||||||||||| || Sbjct: 279 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 220 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 |||| |||||| || ||||||| ||||||||||| ||| || |||| |||||||| Sbjct: 219 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 160 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | | |||||||| ||||||||| || || ||||| ||||| || || Sbjct: 159 gatgatgcg---cgttttgttgtcgcgggccgcgttacccgccagctcgagcacttccgc 103 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgc 458 || |||||||| | ||| ||||| || |||||||| ||||| | ||||||||| Sbjct: 102 cgccaggtactccatgaccgcggccagatagacgggcgcgcccgctccgacgcgc 48
>gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:7205580, complete cds Length = 799 Score = 95.6 bits (48), Expect = 1e-16 Identities = 171/212 (80%) Strand = Plus / Minus Query: 225 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 284 ||||||||||||||||| || | ||||||||| | || ||||| |||||||||||||| Sbjct: 371 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 312 Query: 285 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 344 || ||||||| || |||||||| ||||||||| |||||||| ||||||| | ||| Sbjct: 311 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 252 Query: 345 atgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcg 404 ||||| || | ||||||||| ||| ||| ||||||||||| | ||| || | ||| ||| Sbjct: 251 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 192 Query: 405 gcgaggtactcgaggacggcggcgaggtagac 436 | || |||||||| || ||||| |||||||| Sbjct: 191 gtcagatactcgagcaccgcggcaaggtagac 160
>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895), mRNA Length = 390 Score = 95.6 bits (48), Expect = 1e-16 Identities = 180/224 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891), mRNA Length = 390 Score = 95.6 bits (48), Expect = 1e-16 Identities = 180/224 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427885), mRNA Length = 918 Score = 95.6 bits (48), Expect = 1e-16 Identities = 180/224 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427881), mRNA Length = 534 Score = 95.6 bits (48), Expect = 1e-16 Identities = 180/224 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 504 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 445 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 444 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 385 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 384 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 325 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 324 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 281 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 234 gcggcccacggggaactgcagcccggcc 207
>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA Length = 1220 Score = 95.6 bits (48), Expect = 1e-16 Identities = 180/224 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 1190 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 1131 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 1130 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 1071 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 1070 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1011 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 1010 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 967 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 920 gcggcccacggggaactgcagcccggcc 893
>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene (LOC417952), mRNA Length = 1374 Score = 95.6 bits (48), Expect = 1e-16 Identities = 180/224 (80%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 730 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 789 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 790 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 849 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 850 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 909 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 910 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 953 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 1000 gcggcccacggggaactgcagcccggcc 1027
>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J (LOC632401), mRNA Length = 1833 Score = 95.6 bits (48), Expect = 1e-16 Identities = 138/168 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||| ||||| | |||||||| || |||||||| || Sbjct: 456 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 397 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 396 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 337 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | ||||||||||||| | ||||||||||| || ||||| Sbjct: 336 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 289
>emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 349 Score = 95.6 bits (48), Expect = 1e-16 Identities = 102/120 (85%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | ||||||||| ||||||||||| || |||| |||||| || ||||| Sbjct: 141 gatgttgggcagcacgccgccctgggcgatggtcaccccggacagcagcttgttcagctc 82 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||||| ||| || |||||||||||||||||||||| | |||||||||||| Sbjct: 81 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 22
>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3 and H4 Length = 8592 Score = 95.6 bits (48), Expect = 1e-16 Identities = 171/212 (80%) Strand = Plus / Minus Query: 225 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 284 ||||||||||||||||| || | ||||||||| | || ||||| |||||||||||||| Sbjct: 4730 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 4671 Query: 285 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 344 || ||||||| || |||||||| ||||||||| |||||||| ||||||| | ||| Sbjct: 4670 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 4611 Query: 345 atgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcg 404 ||||| || | ||||||||| ||| ||| ||||||||||| | ||| || | ||| ||| Sbjct: 4610 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 4551 Query: 405 gcgaggtactcgaggacggcggcgaggtagac 436 | || |||||||| || ||||| |||||||| Sbjct: 4550 gtcagatactcgagcaccgcggcaaggtagac 4519
>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene Length = 8384 Score = 95.6 bits (48), Expect = 1e-16 Identities = 180/224 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 5291 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 5232 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 5231 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 5172 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 5171 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 5112 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 5111 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 5068 Score = 87.7 bits (44), Expect = 3e-14 Identities = 179/224 (79%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| || || || |||||||| || Sbjct: 2153 cttcttgggcagcagcacggcctggatgttgggcagcaccccaccctgcgcgatggtcac 2212 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 2213 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 2272 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 2273 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 2332 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 2333 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 2376 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 5021 gcggcccacggggaactgcagcccggcc 4994 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 2423 gcggcccacggggaactgcagcccggcc 2450
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 95.6 bits (48), Expect = 1e-16 Identities = 54/56 (96%) Strand = Plus / Minus Query: 474 ttcttgaggtagcgcccgatgcggccgacggggaactggagcccggccttaacgga 529 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| Sbjct: 7800552 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacgga 7800497
>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962), mRNA Length = 437 Score = 95.6 bits (48), Expect = 1e-16 Identities = 108/128 (84%) Strand = Plus / Minus Query: 264 ccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacg 323 ||||| || |||||||| |||| | | |||||| || |||||||| ||||||||||| | Sbjct: 334 ccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcggatg 275 Query: 324 gcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtccttggccgcgttgccg 383 || || |||||||||||||||||||||| | ||||||||||||| | ||||||||||| Sbjct: 274 gccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtccctcgccgcgttgccc 215 Query: 384 gcgagctc 391 || ||||| Sbjct: 214 gccagctc 207
>dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0431E05 Length = 146091 Score = 95.6 bits (48), Expect = 1e-16 Identities = 54/56 (96%) Strand = Plus / Minus Query: 474 ttcttgaggtagcgcccgatgcggccgacggggaactggagcccggccttaacgga 529 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| Sbjct: 14934 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacgga 14879
>dbj|AP004651.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0091G06 Length = 161851 Score = 95.6 bits (48), Expect = 1e-16 Identities = 54/56 (96%) Strand = Plus / Minus Query: 474 ttcttgaggtagcgcccgatgcggccgacggggaactggagcccggccttaacgga 529 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| Sbjct: 113050 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacgga 112995
>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone MGC:36202 IMAGE:5055276), complete cds Length = 550 Score = 95.6 bits (48), Expect = 1e-16 Identities = 138/168 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||| ||||| | |||||||| || |||||||| || Sbjct: 412 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 353 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 352 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 293 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | ||||||||||||| | ||||||||||| || ||||| Sbjct: 292 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 245
>dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, complete cds Length = 1028 Score = 95.6 bits (48), Expect = 1e-16 Identities = 180/224 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 691 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 632 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 631 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 572 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 571 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 512 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 511 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 468 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 421 gcggcccacggggaactgcagcccggcc 394
>gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, complete cds Length = 740 Score = 95.6 bits (48), Expect = 1e-16 Identities = 180/224 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 538 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 479 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 478 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 419 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 418 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 359 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 358 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 315 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 268 gcggcccacggggaactgcagcccggcc 241
>gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, complete cds Length = 743 Score = 95.6 bits (48), Expect = 1e-16 Identities = 180/224 (80%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 383 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 324 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 323 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 264 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 263 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 204 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 203 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 160 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 113 gcggcccacggggaactgcagcccggcc 86
>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and histone H3 gene, 3' end, gene cluster X1h3 Length = 8608 Score = 95.6 bits (48), Expect = 1e-16 Identities = 171/212 (80%) Strand = Plus / Minus Query: 225 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 284 ||||||||||||||||| || | ||||||||| | || ||||| |||||||||||||| Sbjct: 4747 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 4688 Query: 285 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 344 || ||||||| || |||||||| ||||||||| |||||||| ||||||| | ||| Sbjct: 4687 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 4628 Query: 345 atgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcg 404 ||||| || | ||||||||| ||| ||| ||||||||||| | ||| || | ||| ||| Sbjct: 4627 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 4568 Query: 405 gcgaggtactcgaggacggcggcgaggtagac 436 | || |||||||| || ||||| |||||||| Sbjct: 4567 gtcagatactcgagcaccgcggcaaggtagac 4536
>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks Length = 1564 Score = 95.6 bits (48), Expect = 1e-16 Identities = 180/224 (80%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 286 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 345 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 346 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 405 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 406 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctccaggatctcggc 465 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 466 cgtcaggtactccagcacggccgctaggtacaccggggcgccgg 509
>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488304), mRNA Length = 588 Score = 93.7 bits (47), Expect = 6e-16 Identities = 110/131 (83%) Strand = Plus / Minus Query: 261 acgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcgg 320 |||||||| || |||||||| |||| | | |||||| || |||||||| |||||||||| Sbjct: 470 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 411 Query: 321 acggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtccttggccgcgttg 380 | ||| || |||||||||||||||||||||| | |||||||||||| |||||||||| Sbjct: 410 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 351 Query: 381 ccggcgagctc 391 || || ||||| Sbjct: 350 cccgccagctc 340 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| || |||||||||||||||||| Sbjct: 237 gcggcccaccgggaactggagcccggcc 210
>ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616790), mRNA Length = 413 Score = 91.7 bits (46), Expect = 2e-15 Identities = 79/90 (87%) Strand = Plus / Minus Query: 302 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttctt 361 |||||||| ||||||||||| ||| || ||||||| |||||||||||||||| |||||| Sbjct: 302 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgggtcttctt 243 Query: 362 gttgtccttggccgcgttgccggcgagctc 391 ||||||| |||||||||||| || ||||| Sbjct: 242 gttgtcccgggccgcgttgcccgccagctc 213 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 495 cggccgacggggaactggagcccggcc 521 ||||| ||||||||||||||||||||| Sbjct: 109 cggcctacggggaactggagcccggcc 83
>gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, complete cds Length = 1401 Score = 89.7 bits (45), Expect = 9e-15 Identities = 108/129 (83%) Strand = Plus / Plus Query: 331 gcaggtggcgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagct 390 |||||||||||||||||||||| | |||||||||||| |||||||||||| || |||| Sbjct: 17 gcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 76 Query: 391 caagcacctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagc 450 | || | ||| || | |||||||| || ||||| || |||||||| |||||||||| || Sbjct: 77 ccaggatctcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgc 136 Query: 451 cgacgcgct 459 | ||||||| Sbjct: 137 ccacgcgct 145
>gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds Length = 375 Score = 89.7 bits (45), Expect = 9e-15 Identities = 117/141 (82%) Strand = Plus / Minus Query: 302 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttctt 361 |||||||| |||||||||||| || || | || ||||| |||||||| | | |||||| Sbjct: 279 gagctcctcgtcgttgcggacagccagctgaagatggcgggggatgatcctgctcttctt 220 Query: 362 gttgtccttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 421 |||||| ||| ||||||||||||||||| || | ||| |||| ||||||||||||||| Sbjct: 219 gttgtcgcgggcggcgttgccggcgagctcgaggatctcagcggtgaggtactcgaggac 160 Query: 422 ggcggcgaggtagacgggggc 442 ||| |||||||| || ||||| Sbjct: 159 ggctgcgaggtacactggggc 139
>ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA Length = 390 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgtgcgatcgtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193
>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA Length = 578 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 403 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 344 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 343 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 284 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 283 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 236
>gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone MGC:82198 IMAGE:3402168), complete cds Length = 1591 Score = 87.7 bits (44), Expect = 3e-14 Identities = 170/212 (80%) Strand = Plus / Minus Query: 225 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 284 |||||||| ||||||||||| | ||||||||| | || ||||| || ||||| ||||| Sbjct: 367 ttcttgggcagcagcacggactggatgttgggcaggaccccgccctgagcgatagtgact 308 Query: 285 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 344 || ||||||| || |||||||| |||||||| || ||||| ||||||| | ||| Sbjct: 307 cctccgagcagtttgttgagctcctcatcgttgcgcacagcgagctgcaggtgcctgggg 248 Query: 345 atgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgcg 404 |||||||||| ||||||||| ||| ||| ||||||||||| | ||| || | ||| ||| Sbjct: 247 atgatgcgggtcttcttgttatcccgggcagcgttgccggccaactccaggatctcagcg 188 Query: 405 gcgaggtactcgaggacggcggcgaggtagac 436 | ||||||||||| || |||||||| ||||| Sbjct: 187 gtcaggtactcgagcactgcggcgagatagac 156
>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 Length = 2972 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 387 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 328 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 327 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 268 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 267 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 220
>ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427893), mRNA Length = 390 Score = 87.7 bits (44), Expect = 3e-14 Identities = 179/224 (79%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| || || || |||||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccaccctgcgcgatggtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1 (LOC417953), mRNA Length = 2271 Score = 87.7 bits (44), Expect = 3e-14 Identities = 179/224 (79%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | | ||||||||| | ||| ||||| || |||||||| || Sbjct: 1171 cttcttgggcagcagcacagcctggatgttgggcagcaccccgccctgcgcgatggtcac 1230 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 1231 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 1290 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctcaagcacctctgc 403 ||||||||| | |||||||||||| |||||||||||| || ||||| || | ||| || Sbjct: 1291 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1350 Query: 404 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccgg 447 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 1351 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 1394 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 1441 gcggcccacggggaactgcagcccggcc 1468
>gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone IMAGE:3582122), partial cds Length = 543 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 387 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 328 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 327 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 268 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 267 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 220
>ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616611), mRNA Length = 393 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||| | | ||||||||| | |||||||| || ||||||||||| Sbjct: 360 cttcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgagcgatggtgac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||| ||||| Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||| || |||| ||||||||||||| |||||||||||| || ||||| Sbjct: 240 gataatacgggtcttcttgttgtcccgggccgcgttgcccgccagctc 193
>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA Length = 1754 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||| ||||| | |||||||| || |||||||| || Sbjct: 377 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 318 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | | |||||| || |||||||| ||||||||||| ||| || ||||||| || || Sbjct: 317 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 258 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | ||||||||||||| | ||||||||||| || ||||| Sbjct: 257 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 210
>ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA Length = 390 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgtgcgatcgtcac 301 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193
>ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC670497), mRNA Length = 3003 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 366 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 307 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 306 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 247 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 246 gatgatgcgagtcttcttgttgtcgcgggccgcgttgcccgccagctc 199
>ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC667728), mRNA Length = 3054 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 417 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 358 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 357 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 298 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 297 gatgatgcgagtcttcttgttgtcgcgggccgcgttgcccgccagctc 250
>ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC677006), mRNA Length = 2991 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 354 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 295 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 294 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 235 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 234 gatgatgcgagtcttcttgttgtcgcgggccgcgttgcccgccagctc 187
>ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A histone family, member J isoform 2 (LOC486669), mRNA Length = 598 Score = 87.7 bits (44), Expect = 3e-14 Identities = 119/144 (82%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||||||||| Sbjct: 438 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtgac 379 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | |||||| || |||||||| ||||||||||| |||||| ||||||||||||| Sbjct: 378 tttccccagcagcttgttgagctcctcgtcgttgcggatggcgagttgcaggtggcgcgg 319 Query: 344 gatgatgcgggacttcttgttgtc 367 |||||| | || |||||||||||| Sbjct: 318 gatgatcctggtcttcttgttgtc 295
>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA Length = 2956 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 387 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 328 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 327 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 268 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 267 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 220
>gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds Length = 819 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 386 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 327 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 326 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 267 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 266 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 219
>ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone 2, H2ac (LOC483174), mRNA Length = 485 Score = 87.7 bits (44), Expect = 3e-14 Identities = 161/200 (80%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||| |||||||||||||| | | |||||| || |||||| Sbjct: 393 gatgttgggcaggacgccgccctgggcgatggtgaccttgcccagcagcttgttgagctc 334 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||||| ||| || |||||||||| |||||||| || | |||||||||||| Sbjct: 333 ctcgtcgttgcggatggccagctgcaggtggcgggggatgatacgcgtcttcttgttgtc 274 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 |||||||||||| || ||||| || | ||| || | |||||||| || ||||| || Sbjct: 273 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 214 Query: 428 gaggtagacgggggcgccgg 447 | ||||||||| ||||||| Sbjct: 213 catgtagacgggagcgccgg 194
>ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone H2A.o (H2A/o) (H2A.2) (H2a-615) (LOC608631), mRNA Length = 534 Score = 87.7 bits (44), Expect = 3e-14 Identities = 161/200 (80%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||| |||||||||||||| | | |||||| || |||||| Sbjct: 371 gatgttgggcaggacgccgccctgggcgatggtgaccttgcccagcagcttgttgagctc 312 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||||| ||| || |||||||||| |||||||| || | |||||||||||| Sbjct: 311 ctcgtcgttgcggatggccagctgcaggtggcgggggatgatacgcgtcttcttgttgtc 252 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 |||||||||||| || ||||| || | ||| || | |||||||| || ||||| || Sbjct: 251 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 192 Query: 428 gaggtagacgggggcgccgg 447 | ||||||||| ||||||| Sbjct: 191 catgtagacgggagcgccgg 172
>ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone H2A.o (H2A/o) (H2A.2) (H2a-615) (LOC483168), mRNA Length = 534 Score = 87.7 bits (44), Expect = 3e-14 Identities = 161/200 (80%) Strand = Plus / Minus Query: 248 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 307 ||||||||| | |||||||| |||||||||||||| | | |||||| || |||||| Sbjct: 371 gatgttgggcaggacgccgccctgggcgatggtgaccttgcccagcagcttgttgagctc 312 Query: 308 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggacttcttgttgtc 367 || ||||||||||| ||| || |||||||||| |||||||| || | |||||||||||| Sbjct: 311 ctcgtcgttgcggatggccagctgcaggtggcgggggatgatacgcgtcttcttgttgtc 252 Query: 368 cttggccgcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 427 |||||||||||| || ||||| || | ||| || | |||||||| || ||||| || Sbjct: 251 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 192 Query: 428 gaggtagacgggggcgccgg 447 | ||||||||| ||||||| Sbjct: 191 catgtagacgggagcgccgg 172
>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence Length = 205659 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Plus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||| ||||| | |||||||| || |||||||| || Sbjct: 108584 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 108643 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | | |||||| || |||||||| ||||||||||| ||| || ||||||| || || Sbjct: 108644 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 108703 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | ||||||||||||| | ||||||||||| || ||||| Sbjct: 108704 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 108751
>gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, complete cds Length = 1680 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 568 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgtgcgatcgtcac 509 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 508 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 449 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 448 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 401 Score = 58.0 bits (29), Expect = 3e-05 Identities = 53/61 (86%) Strand = Plus / Plus Query: 331 gcaggtggcgcgggatgatgcgggacttcttgttgtccttggccgcgttgccggcgagct 390 |||| ||||||||||||||||| | |||||||||||| |||||||||||| || |||| Sbjct: 885 gcagatggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 944 Query: 391 c 391 | Sbjct: 945 c 945
>emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A (partial) Length = 523 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 323 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 322 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 262 gatgatgcgagtcttcttgttgtcgcgggccgcgttgcccgccagctc 215
>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes Length = 3098 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 1217 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 1158 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 1157 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1098 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 1097 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 1050
>emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones Length = 1653 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || |||||||| || Sbjct: 1496 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1437 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 || | | |||||| | |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 1436 gcggcccagcagcttattgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1377 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||| ||||| | ||||||||| ||| | ||||| ||||| || ||||| Sbjct: 1376 gataatgcgcgtcttcttgttatccctcgccgcattgcccgccagctc 1329
>emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking regions Length = 843 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | ||| ||||| || |||||||| || Sbjct: 693 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 634 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || |||||||||| || Sbjct: 633 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 574 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 573 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctc 526 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 494 gcggccgacggggaactggagcccggcc 521 |||||| ||||||||||| ||||||||| Sbjct: 423 gcggcccacggggaactgcagcccggcc 396
>dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700048I17 product:histone gene complex 2, full insert sequence Length = 578 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 403 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 344 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 343 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 284 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 283 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 236
>dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932439K17 product:histone gene complex 2, full insert sequence Length = 2876 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 218 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 159 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 158 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 99 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 98 gatgatgcgagtcttcttgttgtcgcgggccgcgttgcccgccagctc 51
>dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610031H01 product:histone gene complex 2, full insert sequence Length = 545 Score = 87.7 bits (44), Expect = 3e-14 Identities = 137/168 (81%) Strand = Plus / Minus Query: 224 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 283 ||||||||| |||||||||| | ||||||||| | |||||||| || ||||| || || Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatcgtcac 345 Query: 284 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 343 | | |||||| || |||||||| ||||||||||| ||| || ||||||||||||| Sbjct: 344 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285 Query: 344 gatgatgcgggacttcttgttgtccttggccgcgttgccggcgagctc 391 ||||||||| | |||||||||||| |||||||||||| || ||||| Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 237 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,406,838 Number of Sequences: 3902068 Number of extensions: 3406838 Number of successful extensions: 78186 Number of sequences better than 10.0: 744 Number of HSP's better than 10.0 without gapping: 751 Number of HSP's successfully gapped in prelim test: 5 Number of HSP's that attempted gapping in prelim test: 73733 Number of HSP's gapped (non-prelim): 4360 length of query: 534 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 511 effective length of database: 17,143,297,704 effective search space: 8760225126744 effective search space used: 8760225126744 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
