ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags12g23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl... 46 0.18
2ref|XM_470969.1| Oryza sativa (japonica cultivar-group), predic... 42 2.8
3gb|AC123075.5| Mus musculus BAC clone RP23-181C16 from chromosom... 42 2.8
4ref|XM_802067.1| Trypanosoma cruzi strain CL Brener hypothetical... 42 2.8
5ref|XM_806678.1| Trypanosoma cruzi strain CL Brener hypothetical... 42 2.8
6emb|AL731585.5| Oryza sativa genomic DNA, chromosome 4, BAC clon... 42 2.8
7emb|AL662935.3|OSJN00146 Oryza sativa genomic DNA, chromosome 4,... 42 2.8
8gb|AC025254.14| Homo sapiens 12 BAC RP11-1041F24 (Roswell Park C... 42 2.8
9dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.8
10gb|AC096651.1| Homo sapiens BAC clone RP11-16J15 from 4, complet... 42 2.8
11emb|AL935175.6| Mouse DNA sequence from clone RP23-397E13 on chr... 42 2.8
12emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chro... 42 2.8

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 46.1 bits (23), Expect = 0.18
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 734    tgataggcagtggagttgatgcc 756
              |||||||||||||||||||||||
Sbjct: 443991 tgataggcagtggagttgatgcc 444013



to top

>ref|XM_470969.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 5220

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 352  acattctcatgcaaagcttca 372
            |||||||||||||||||||||
Sbjct: 5039 acattctcatgcaaagcttca 5019



to top

>gb|AC123075.5| Mus musculus BAC clone RP23-181C16 from chromosome 3, complete sequence
          Length = 198063

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 449    ttggtgtttctatttcagttt 469
              |||||||||||||||||||||
Sbjct: 167879 ttggtgtttctatttcagttt 167899



to top

>ref|XM_802067.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053504151.39) partial mRNA
          Length = 2094

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 138 tgcaatgtccatagcaaccaa 158
           |||||||||||||||||||||
Sbjct: 165 tgcaatgtccatagcaaccaa 185



to top

>ref|XM_806678.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053509461.30) partial mRNA
          Length = 2094

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 138 tgcaatgtccatagcaaccaa 158
           |||||||||||||||||||||
Sbjct: 165 tgcaatgtccatagcaaccaa 185



to top

>emb|AL731585.5| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0009K15,
             complete sequence
          Length = 185021

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 352   acattctcatgcaaagcttca 372
             |||||||||||||||||||||
Sbjct: 90534 acattctcatgcaaagcttca 90514



to top

>emb|AL662935.3|OSJN00146 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0094O15,
             complete sequence
          Length = 144778

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 352   acattctcatgcaaagcttca 372
             |||||||||||||||||||||
Sbjct: 86662 acattctcatgcaaagcttca 86682



to top

>gb|AC025254.14| Homo sapiens 12 BAC RP11-1041F24 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 160867

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 460   atttcagtttgcacatctctaatta 484
             |||||||||||||||| ||||||||
Sbjct: 81692 atttcagtttgcacatttctaatta 81668



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 352      acattctcatgcaaagcttca 372
                |||||||||||||||||||||
Sbjct: 11769078 acattctcatgcaaagcttca 11769058



 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 352    acattctcatgcaaagcttca 372
              |||||||||||||||||||||
Sbjct: 290842 acattctcatgcaaagcttca 290862



to top

>gb|AC096651.1| Homo sapiens BAC clone RP11-16J15 from 4, complete sequence
          Length = 158661

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 685   gcatcatgctctgtcaccttt 705
             |||||||||||||||||||||
Sbjct: 42623 gcatcatgctctgtcaccttt 42643



to top

>emb|AL935175.6| Mouse DNA sequence from clone RP23-397E13 on chromosome 2, complete
             sequence
          Length = 158592

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   cctggacattctcatgcaaag 247
             |||||||||||||||||||||
Sbjct: 62906 cctggacattctcatgcaaag 62886



to top

>emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chromosome 4, complete
              sequence
          Length = 249534

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 595    tgagaagcttcatgctctgccacct 619
              |||||||||||| ||||||||||||
Sbjct: 126850 tgagaagcttcaagctctgccacct 126874


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,525,037
Number of Sequences: 3902068
Number of extensions: 7525037
Number of successful extensions: 138009
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 137860
Number of HSP's gapped (non-prelim): 149
length of query: 804
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 781
effective length of database: 17,143,297,704
effective search space: 13388915506824
effective search space used: 13388915506824
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)
to top