ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags12f08 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK066310.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013063E15, full insert sequence Length = 3170 Score = 248 bits (125), Expect = 2e-62 Identities = 361/437 (82%), Gaps = 12/437 (2%) Strand = Plus / Minus Query: 171 catcatatattccacctcttatcagatggattgtgaggaacagcaac-gc-----tgctc 224 |||||||||| ||| ||| ||||||||| |||| ||||||||| ||| || |||| Sbjct: 2848 catcatatatgccatctcctatcagatgaattgggaggaacaggaacagcaccattgctt 2789 Query: 225 ttcacattttgctgagcctgggaagatgaccgttgcatgcgaggagatgtctcgttttta 284 |||||||| |||||||| ||||| ||||| ||||||||||||||||||| || | ||| Sbjct: 2788 ttcacattctgctgagcttgggatgatgatcgttgcatgcgaggagatgaatcttgctta 2729 Query: 285 ccgtttgtgatgggcaaagaatgcctcttcctcgggttgttgtcttgcacgtctgggctt 344 ||||| || ||||||||||| ||||| ||||| || |||||||||||||| || |||||| Sbjct: 2728 ccgttagtcatgggcaaagagtgccttttccttggattgttgtcttgcacatccgggctt 2669 Query: 345 aacttcggggataga---gcggccgcctttgctcttgcagattctgtgaactgcatgtaa 401 ||||| || |||| | || | |||||||| |||||||||||||| |||||||| ||| Sbjct: 2668 aactttggtgatacactagcagatgcctttgcccttgcagattctgtaaactgcatataa 2609 Query: 402 cttggcaatggagtgctgttgctcatgcgaggttcttgatcagcgttttcagacttggca 461 ||||||||||||||||||||||| |||||||||||||||||| | | ||||| || | Sbjct: 2608 cttggcaatggagtgctgttgcttatgcgaggttcttgatcaacatgatcagattt---a 2552 Query: 462 accttgcctgagctctctctcttcgcatgcttataatcctttgacaggttatccgtgctg 521 ||||||||||||||||||| | || || | | |||||||||||||| |||||| ||||| Sbjct: 2551 accttgcctgagctctctcgcctcccaagtctgtaatcctttgacagattatccatgctg 2492 Query: 522 cttcggccgactgaattgctgctgggactagtcagggaccttctgcttgcatgagacttc 581 || || || || |||| |||||| |||||||| || || || ||||| |||||||||| Sbjct: 2491 ctccgtcccacagaatcgctgcttggactagttagtgatctcttgcttacatgagacttg 2432 Query: 582 gattttttgctcttgct 598 | ||||||||||||| Sbjct: 2431 ggccttttgctcttgct 2415
>ref|XM_474230.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2682 Score = 246 bits (124), Expect = 7e-62 Identities = 329/396 (83%), Gaps = 6/396 (1%) Strand = Plus / Minus Query: 206 aggaacagcaacgctgctcttcacattttgctgagcctgggaagatgaccgttgcatgcg 265 |||||||||| | |||| |||||||| |||||||| ||||| ||||| ||||||||||| Sbjct: 2643 aggaacagcaccattgcttttcacattctgctgagcttgggatgatgatcgttgcatgcg 2584 Query: 266 aggagatgtctcgtttttaccgtttgtgatgggcaaagaatgcctcttcctcgggttgtt 325 |||||||| || | |||||||| || ||||||||||| ||||| ||||| || ||||| Sbjct: 2583 aggagatgaatcttgcttaccgttagtcatgggcaaagagtgccttttccttggattgtt 2524 Query: 326 gtcttgcacgtctgggcttaacttcggggataga---gcggccgcctttgctcttgcaga 382 ||||||||| || ||||||||||| || |||| | || | |||||||| |||||||| Sbjct: 2523 gtcttgcacatccgggcttaactttggtgatacactagcagatgcctttgcccttgcaga 2464 Query: 383 ttctgtgaactgcatgtaacttggcaatggagtgctgttgctcatgcgaggttcttgatc 442 |||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 2463 ttctgtaaactgcatataacttggcaatggagtgctgttgcttatgcgaggttcttgatc 2404 Query: 443 agcgttttcagacttggcaaccttgcctgagctctctctcttcgcatgcttataatcctt 502 | | | ||||| || |||||||||||||||||||| | || || | | |||||||| Sbjct: 2403 aacatgatcagattt---aaccttgcctgagctctctcgcctcccaagtctgtaatcctt 2347 Query: 503 tgacaggttatccgtgctgcttcggccgactgaattgctgctgggactagtcagggacct 562 |||||| |||||| ||||||| || || || |||| |||||| |||||||| || || || Sbjct: 2346 tgacagattatccatgctgctccgtcccacagaatcgctgcttggactagttagtgatct 2287 Query: 563 tctgcttgcatgagacttcgattttttgctcttgct 598 ||||| |||||||||| | ||||||||||||| Sbjct: 2286 cttgcttacatgagacttgggccttttgctcttgct 2251
>emb|AL606999.3|OSJN00127 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K01, complete sequence Length = 163448 Score = 246 bits (124), Expect = 7e-62 Identities = 329/396 (83%), Gaps = 6/396 (1%) Strand = Plus / Minus Query: 206 aggaacagcaacgctgctcttcacattttgctgagcctgggaagatgaccgttgcatgcg 265 |||||||||| | |||| |||||||| |||||||| ||||| ||||| ||||||||||| Sbjct: 90590 aggaacagcaccattgcttttcacattctgctgagcttgggatgatgatcgttgcatgcg 90531 Query: 266 aggagatgtctcgtttttaccgtttgtgatgggcaaagaatgcctcttcctcgggttgtt 325 |||||||| || | |||||||| || ||||||||||| ||||| ||||| || ||||| Sbjct: 90530 aggagatgaatcttgcttaccgttagtcatgggcaaagagtgccttttccttggattgtt 90471 Query: 326 gtcttgcacgtctgggcttaacttcggggataga---gcggccgcctttgctcttgcaga 382 ||||||||| || ||||||||||| || |||| | || | |||||||| |||||||| Sbjct: 90470 gtcttgcacatccgggcttaactttggtgatacactagcagatgcctttgcccttgcaga 90411 Query: 383 ttctgtgaactgcatgtaacttggcaatggagtgctgttgctcatgcgaggttcttgatc 442 |||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 90410 ttctgtaaactgcatataacttggcaatggagtgctgttgcttatgcgaggttcttgatc 90351 Query: 443 agcgttttcagacttggcaaccttgcctgagctctctctcttcgcatgcttataatcctt 502 | | | ||||| || |||||||||||||||||||| | || || | | |||||||| Sbjct: 90350 aacatgatcagattt---aaccttgcctgagctctctcgcctcccaagtctgtaatcctt 90294 Query: 503 tgacaggttatccgtgctgcttcggccgactgaattgctgctgggactagtcagggacct 562 |||||| |||||| ||||||| || || || |||| |||||| |||||||| || || || Sbjct: 90293 tgacagattatccatgctgctccgtcccacagaatcgctgcttggactagttagtgatct 90234 Query: 563 tctgcttgcatgagacttcgattttttgctcttgct 598 ||||| |||||||||| | ||||||||||||| Sbjct: 90233 cttgcttacatgagacttgggccttttgctcttgct 90198
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 246 bits (124), Expect = 7e-62 Identities = 329/396 (83%), Gaps = 6/396 (1%) Strand = Plus / Minus Query: 206 aggaacagcaacgctgctcttcacattttgctgagcctgggaagatgaccgttgcatgcg 265 |||||||||| | |||| |||||||| |||||||| ||||| ||||| ||||||||||| Sbjct: 33878691 aggaacagcaccattgcttttcacattctgctgagcttgggatgatgatcgttgcatgcg 33878632 Query: 266 aggagatgtctcgtttttaccgtttgtgatgggcaaagaatgcctcttcctcgggttgtt 325 |||||||| || | |||||||| || ||||||||||| ||||| ||||| || ||||| Sbjct: 33878631 aggagatgaatcttgcttaccgttagtcatgggcaaagagtgccttttccttggattgtt 33878572 Query: 326 gtcttgcacgtctgggcttaacttcggggataga---gcggccgcctttgctcttgcaga 382 ||||||||| || ||||||||||| || |||| | || | |||||||| |||||||| Sbjct: 33878571 gtcttgcacatccgggcttaactttggtgatacactagcagatgcctttgcccttgcaga 33878512 Query: 383 ttctgtgaactgcatgtaacttggcaatggagtgctgttgctcatgcgaggttcttgatc 442 |||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 33878511 ttctgtaaactgcatataacttggcaatggagtgctgttgcttatgcgaggttcttgatc 33878452 Query: 443 agcgttttcagacttggcaaccttgcctgagctctctctcttcgcatgcttataatcctt 502 | | | ||||| || |||||||||||||||||||| | || || | | |||||||| Sbjct: 33878451 aacatgatcagattt---aaccttgcctgagctctctcgcctcccaagtctgtaatcctt 33878395 Query: 503 tgacaggttatccgtgctgcttcggccgactgaattgctgctgggactagtcagggacct 562 |||||| |||||| ||||||| || || || |||| |||||| |||||||| || || || Sbjct: 33878394 tgacagattatccatgctgctccgtcccacagaatcgctgcttggactagttagtgatct 33878335 Query: 563 tctgcttgcatgagacttcgattttttgctcttgct 598 ||||| |||||||||| | ||||||||||||| Sbjct: 33878334 cttgcttacatgagacttgggccttttgctcttgct 33878299
>gb|AY111989.1| Zea mays CL13024_1 mRNA sequence Length = 531 Score = 67.9 bits (34), Expect = 4e-08 Identities = 96/116 (82%), Gaps = 3/116 (2%) Strand = Plus / Plus Query: 294 atgggcaaagaatgcctcttcctcgggttgttgtcttgcacgtctgggcttaacttcggg 353 |||||||| || ||||| ||||| |||||| |||| ||||| |||||||| | ||||||| Sbjct: 406 atgggcaacgagtgccttttccttgggttgctgtcctgcacatctgggctcatcttcggg 465 Query: 354 gatagagcggccgcctttgctcttgcagattctgtgaactgcatgtaacttggcaa 409 || | | |||||| ||||||||||||||||| || |||||||| |||||||| Sbjct: 466 gac---gacgacgccttggctcttgcagattctgtaaattgcatgtagcttggcaa 518
>ref|XM_754956.1| Ustilago maydis 521 hypothetical protein (UM03902.1) partial mRNA Length = 2403 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 |||||||||||||||||||||||| Sbjct: 2169 ttgctcttgctcttgctcttgttg 2146
>gb|AC164555.2| Mus musculus BAC clone RP23-346G13 from chromosome 17, complete sequence Length = 211631 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttgtt 610 ||||||||||||||||||||||| Sbjct: 150280 ttgctcttgctcttgctcttgtt 150302 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 585 tttttgctcttgctcttgctcttg 608 |||||| ||||||||||||||||| Sbjct: 150271 tttttgttcttgctcttgctcttg 150294
>gb|AC092494.2| Drosophila melanogaster clone BACR23I18, complete sequence Length = 172029 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 585 tttttgctcttgctcttgctctt 607 ||||||||||||||||||||||| Sbjct: 105191 tttttgctcttgctcttgctctt 105213
>gb|AC011251.6| Drosophila melanogaster clone BACR09F10, complete sequence Length = 173988 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 585 tttttgctcttgctcttgctctt 607 ||||||||||||||||||||||| Sbjct: 145303 tttttgctcttgctcttgctctt 145325
>ref|XM_705679.1| Candida albicans SC5314 hypothetical protein (CaO19.11187), mRNA Length = 1263 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgtt 610 ||||||||||||||||||||||| Sbjct: 861 ttgctcttgctcttgctcttgtt 839
>gb|AC132602.2| Mus musculus BAC clone RP23-477C13 from chromosome 14, complete sequence Length = 194038 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctcttg 608 ||||||||||||||||||||||| Sbjct: 111005 ttttgctcttgctcttgctcttg 110983
>gb|AC131115.3| Mus musculus BAC clone RP24-235C16 from chromosome 8, complete sequence Length = 166486 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctcttg 608 ||||||||||||||||||||||| Sbjct: 136439 ttttgctcttgctcttgctcttg 136417 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 136431 ttgctcttgctcttgctcttg 136411
>ref|XM_385863.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05687.1) partial mRNA Length = 2382 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgtt 610 ||||||||||||||||||||||| Sbjct: 2303 ttgctcttgctcttgctcttgtt 2281
>gb|AC125049.3| Mus musculus BAC clone RP23-367C15 from chromosome 9, complete sequence Length = 211511 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctcttg 608 ||||||||||||||||||||||| Sbjct: 27796 ttttgctcttgctcttgctcttg 27774
>ref|XM_705660.1| Candida albicans SC5314 hypothetical protein (CaO19.3703) partial mRNA Length = 1263 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgtt 610 ||||||||||||||||||||||| Sbjct: 861 ttgctcttgctcttgctcttgtt 839
>emb|AL646044.13| Mouse DNA sequence from clone RP23-269O5 on chromosome 11, complete sequence Length = 197473 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgtt 610 ||||||||||||||||||||||| Sbjct: 36630 ttgctcttgctcttgctcttgtt 36608 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36690 ttgctcttgctcttgctcttg 36670 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36684 ttgctcttgctcttgctcttg 36664 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36678 ttgctcttgctcttgctcttg 36658 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36648 ttgctcttgctcttgctcttg 36628 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36642 ttgctcttgctcttgctcttg 36622 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36636 ttgctcttgctcttgctcttg 36616 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 36653 tgctcttgctcttgctcttg 36634
>gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 177941 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 586 ttttgctcttgctcttgctcttg 608 ||||||||||||||||||||||| Sbjct: 41448 ttttgctcttgctcttgctcttg 41470
>gb|AC157517.2| Mus musculus BAC clone RP24-69C11 from chromosome 9, complete sequence Length = 189253 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgtt 610 ||||||||||||||||||||||| Sbjct: 53010 ttgctcttgctcttgctcttgtt 52988 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 53046 ttgctcttgctcttgctcttg 53026 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 53040 ttgctcttgctcttgctcttg 53020 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 53034 ttgctcttgctcttgctcttg 53014 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 53028 ttgctcttgctcttgctcttg 53008 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 53022 ttgctcttgctcttgctcttg 53002 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 53016 ttgctcttgctcttgctcttg 52996
>gb|AC154260.2| Mus musculus BAC clone RP24-225C5 from 17, complete sequence Length = 187652 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgtt 610 ||||||||||||||||||||||| Sbjct: 185830 ttgctcttgctcttgctcttgtt 185808 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 585 tttttgctcttgctcttgctcttg 608 |||||| ||||||||||||||||| Sbjct: 185839 tttttgttcttgctcttgctcttg 185816
>gb|AE003568.4| Drosophila melanogaster chromosome X, section 71 of 74 of the complete sequence Length = 315815 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 585 tttttgctcttgctcttgctctt 607 ||||||||||||||||||||||| Sbjct: 245283 tttttgctcttgctcttgctctt 245305
>gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 of 74 of the complete sequence Length = 299943 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 586 ttttgctcttgctcttgctcttg 608 ||||||||||||||||||||||| Sbjct: 83335 ttttgctcttgctcttgctcttg 83357
>emb|AL731548.13| Mouse DNA sequence from clone RP23-71M18 on chromosome X, complete sequence Length = 218612 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctcttg 608 ||||||||||||||||||||||| Sbjct: 208516 ttttgctcttgctcttgctcttg 208494
>emb|AL929443.4| Mouse DNA sequence from clone RP23-467A7 on chromosome 2, complete sequence Length = 189821 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgtt 610 ||||||||||||||||||||||| Sbjct: 93034 ttgctcttgctcttgctcttgtt 93012 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 93046 ttgctcttgctcttgctcttg 93026 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 93040 ttgctcttgctcttgctcttg 93020
>gb|AC104283.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1607_F09, complete sequence Length = 95755 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 146 ggcacctcgtcgatgtgctgccatcc 171 ||||||||||||||||||||| |||| Sbjct: 29872 ggcacctcgtcgatgtgctgcaatcc 29847
>gb|DQ145251.1| Drosophila miranda neo-Y Mmp2 gene, partial sequence Length = 1130 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Plus Query: 586 ttttgctcttgctcttgctctt 607 |||||||||||||||||||||| Sbjct: 815 ttttgctcttgctcttgctctt 836
>gb|AC091220.3| Drosophila melanogaster 3L BAC RP98-7E7 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179838 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 587 tttgctcttgctcttgctcttg 608 |||||||||||||||||||||| Sbjct: 127782 tttgctcttgctcttgctcttg 127761
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 146 ggcacctcgtcgatgtgctgccatcc 171 ||||||||||||||||||||| |||| Sbjct: 2462850 ggcacctcgtcgatgtgctgcaatcc 2462825
>ref|XM_232590.2| PREDICTED: Rattus norvegicus hypothetical LOC297763 (LOC297763), mRNA Length = 990 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgt 609 |||||||||||||||||||||| Sbjct: 693 ttgctcttgctcttgctcttgt 672 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgt 609 |||||||||||||||||||||| Sbjct: 591 ttgctcttgctcttgctcttgt 570 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 705 ttgctcttgctcttgctcttg 685 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 699 ttgctcttgctcttgctcttg 679 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 609 ttgctcttgctcttgctcttg 589 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 603 ttgctcttgctcttgctcttg 583 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 597 ttgctcttgctcttgctcttg 577
>ref|XM_226738.3| PREDICTED: Rattus norvegicus B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB (predicted) (Bdp1_predicted), mRNA Length = 7838 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 587 tttgctcttgctcttgctcttg 608 |||||||||||||||||||||| Sbjct: 1444 tttgctcttgctcttgctcttg 1423
>dbj|AK106538.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-108-C10, full insert sequence Length = 2109 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Plus Query: 146 ggcacctcgtcgatgtgctgccatcc 171 ||||||||||||||||||||| |||| Sbjct: 1789 ggcacctcgtcgatgtgctgcaatcc 1814
>emb|BX539332.13| Zebrafish DNA sequence from clone RP71-23D18 in linkage group 22, complete sequence Length = 176625 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgt 609 |||||||||||||||||||||| Sbjct: 145693 ttgctcttgctcttgctcttgt 145672
>emb|AL929032.10| Zebrafish DNA sequence from clone DKEY-4C23 in linkage group 22, complete sequence Length = 236775 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgt 609 |||||||||||||||||||||| Sbjct: 16861 ttgctcttgctcttgctcttgt 16840
>gb|AE003550.4| Drosophila melanogaster chromosome 3L, section 35 of 83 of the complete sequence Length = 304975 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 587 tttgctcttgctcttgctcttg 608 |||||||||||||||||||||| Sbjct: 26564 tttgctcttgctcttgctcttg 26543
>emb|BX248330.6| Zebrafish DNA sequence from clone CH211-278E17 in linkage group 22, complete sequence Length = 189880 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgt 609 |||||||||||||||||||||| Sbjct: 84302 ttgctcttgctcttgctcttgt 84281
>gb|AC105976.13| Mus musculus chromosome 5, clone RP24-315H14, complete sequence Length = 188130 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 18508 ttgctcttgctcttgctcttg 18528
>gb|AC108914.8| Mus musculus chromosome 1, clone RP23-435E15, complete sequence Length = 212494 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 9348 ttgctcttgctcttgctcttg 9328
>gb|AC102749.10| Mus musculus chromosome 5, clone RP24-478I4, complete sequence Length = 173437 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 118467 ttgctcttgctcttgctcttg 118447
>gb|AC092716.7| Mus musculus chromosome 5, clone RP23-14J20, complete sequence Length = 215382 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 97730 ttgctcttgctcttgctcttg 97710
>ref|XM_642481.1| Dictyostelium discoideum hypothetical protein (DDB0202229), partial mRNA Length = 867 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 534 ttgctcttgctcttgctcttg 514 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 528 ttgctcttgctcttgctcttg 508 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 522 ttgctcttgctcttgctcttg 502 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 516 ttgctcttgctcttgctcttg 496 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 510 ttgctcttgctcttgctcttg 490 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 504 ttgctcttgctcttgctcttg 484 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 498 ttgctcttgctcttgctcttg 478 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 492 ttgctcttgctcttgctcttg 472 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 486 ttgctcttgctcttgctcttg 466
>gb|AC154479.2| Mus musculus BAC clone RP24-135I6 from chromosome 9, complete sequence Length = 153964 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctct 606 ||||||||||||||||||||| Sbjct: 85261 ttttgctcttgctcttgctct 85241
>ref|XM_483049.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1299 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 718 ttgctcttgctcttgctcttg 698 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 723 tgctcttgctcttgctcttg 704
>ref|XM_507274.1| PREDICTED Oryza sativa (japonica cultivar-group), P0481F05.17 mRNA Length = 1386 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 707 ttgctcttgctcttgctcttg 687 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 712 tgctcttgctcttgctcttg 693
>ref|XM_467553.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1545 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 152 ttgctcttgctcttgctcttg 172
>gb|AC115070.9| Mus musculus chromosome 5, clone RP24-406N3, complete sequence Length = 148789 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 56488 ttgctcttgctcttgctcttg 56508
>gb|AC134426.20| Mus musculus chromosome 1, clone RP24-342A12, complete sequence Length = 196208 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 51186 ttgctcttgctcttgctcttg 51166 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 51180 ttgctcttgctcttgctcttg 51160 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 51174 ttgctcttgctcttgctcttg 51154
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 202217 ttgctcttgctcttgctcttg 202197
>gb|AY376688.1| Crinipellis perniciosa mitochondrion, complete genome Length = 109103 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 105041 ttgctcttgctcttgctcttg 105061 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 96465 ttgctcttgctcttgctcttg 96485 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 96459 ttgctcttgctcttgctcttg 96479 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 96453 ttgctcttgctcttgctcttg 96473 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 96447 ttgctcttgctcttgctcttg 96467 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 96441 ttgctcttgctcttgctcttg 96461 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 67906 ttgctcttgctcttgctcttg 67926 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 67900 ttgctcttgctcttgctcttg 67920 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 67894 ttgctcttgctcttgctcttg 67914 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 67888 ttgctcttgctcttgctcttg 67908 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 67882 ttgctcttgctcttgctcttg 67902
>gb|AC107760.9| Mus musculus chromosome 15, clone RP23-189K4, complete sequence Length = 178900 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 171486 ttgctcttgctcttgctcttg 171466
>gb|AC133103.5| Mus musculus BAC clone RP23-226J10 from chromosome 1, complete sequence Length = 241735 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 137490 ttgctcttgctcttgctcttg 137470 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 137484 ttgctcttgctcttgctcttg 137464 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 137478 ttgctcttgctcttgctcttg 137458 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 137472 ttgctcttgctcttgctcttg 137452 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 137466 ttgctcttgctcttgctcttg 137446 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 137460 ttgctcttgctcttgctcttg 137440 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 135115 ttgctcttgctcttgctcttg 135095 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 135109 ttgctcttgctcttgctcttg 135089
>gb|AC127171.54| Mus musculus strain C57BL/6J clone rp23-202i7 map 10, complete sequence Length = 194193 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 17885 ttgctcttgctcttgctcttg 17905 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 17879 ttgctcttgctcttgctcttg 17899 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 8121 ttgctcttgctcttgctcttg 8141
>gb|AC119986.7| Mus musculus chromosome 14, clone RP24-502B4, complete sequence Length = 170418 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 586 ttttgctcttgctcttgctct 606 ||||||||||||||||||||| Sbjct: 163370 ttttgctcttgctcttgctct 163390
>gb|AC136710.8| Mus musculus chromosome 19, clone RP23-35B13, complete sequence Length = 206056 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19397 ttgctcttgctcttgctcttg 19377 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19391 ttgctcttgctcttgctcttg 19371 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19385 ttgctcttgctcttgctcttg 19365 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19379 ttgctcttgctcttgctcttg 19359 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19373 ttgctcttgctcttgctcttg 19353 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19367 ttgctcttgctcttgctcttg 19347 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19361 ttgctcttgctcttgctcttg 19341 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19355 ttgctcttgctcttgctcttg 19335 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19349 ttgctcttgctcttgctcttg 19329 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19343 ttgctcttgctcttgctcttg 19323 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19315 ttgctcttgctcttgctcttg 19295 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 19285 ttgctcttgctcttgctcttg 19265 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 19337 ttgctcttgctcttgctctt 19318 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 19309 ttgctcttgctcttgctctt 19290
>gb|AC133179.3| Mus musculus BAC clone RP24-134P14 from chromosome 14, complete sequence Length = 160216 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 25316 ttgctcttgctcttgctcttg 25336 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 25310 ttgctcttgctcttgctcttg 25330 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 25304 ttgctcttgctcttgctcttg 25324 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 25298 ttgctcttgctcttgctcttg 25318 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 25292 ttgctcttgctcttgctcttg 25312 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 25286 ttgctcttgctcttgctcttg 25306 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 25280 ttgctcttgctcttgctcttg 25300 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 25274 ttgctcttgctcttgctcttg 25294 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 25322 ttgctcttgctcttgctctt 25341
>gb|AC183538.4| Pan troglodytes BAC clone CH251-395P17 from chromosome x, complete sequence Length = 186120 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 185786 ttgctcttgctcttgctcttg 185766
>ref|XM_955589.1| Neurospora crassa OR74A hypothetical protein (NCU08958.1) partial mRNA Length = 225 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 173 ttgctcttgctcttgctcttg 193 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 167 ttgctcttgctcttgctcttg 187 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 161 ttgctcttgctcttgctcttg 181 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 155 ttgctcttgctcttgctcttg 175 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 149 ttgctcttgctcttgctcttg 169 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 143 ttgctcttgctcttgctcttg 163 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 137 ttgctcttgctcttgctcttg 157 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 131 ttgctcttgctcttgctcttg 151 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 125 ttgctcttgctcttgctcttg 145 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 119 ttgctcttgctcttgctcttg 139 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 113 ttgctcttgctcttgctcttg 133 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 107 ttgctcttgctcttgctcttg 127 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 101 ttgctcttgctcttgctcttg 121 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 95 ttgctcttgctcttgctcttg 115 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 89 ttgctcttgctcttgctcttg 109 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 83 ttgctcttgctcttgctcttg 103 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 77 ttgctcttgctcttgctcttg 97 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 71 ttgctcttgctcttgctcttg 91 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 65 ttgctcttgctcttgctcttg 85 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 59 ttgctcttgctcttgctcttg 79 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 53 ttgctcttgctcttgctcttg 73 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 179 ttgctcttgctcttgctctt 198
>ref|XM_331349.1| Neurospora crassa OR74A hypothetical protein (NCU08958.1) partial mRNA Length = 225 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 173 ttgctcttgctcttgctcttg 193 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 167 ttgctcttgctcttgctcttg 187 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 161 ttgctcttgctcttgctcttg 181 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 155 ttgctcttgctcttgctcttg 175 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 149 ttgctcttgctcttgctcttg 169 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 143 ttgctcttgctcttgctcttg 163 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 137 ttgctcttgctcttgctcttg 157 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 131 ttgctcttgctcttgctcttg 151 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 125 ttgctcttgctcttgctcttg 145 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 119 ttgctcttgctcttgctcttg 139 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 113 ttgctcttgctcttgctcttg 133 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 107 ttgctcttgctcttgctcttg 127 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 101 ttgctcttgctcttgctcttg 121 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 95 ttgctcttgctcttgctcttg 115 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 89 ttgctcttgctcttgctcttg 109 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 83 ttgctcttgctcttgctcttg 103 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 77 ttgctcttgctcttgctcttg 97 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 71 ttgctcttgctcttgctcttg 91 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 65 ttgctcttgctcttgctcttg 85 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 59 ttgctcttgctcttgctcttg 79 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 53 ttgctcttgctcttgctcttg 73 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 179 ttgctcttgctcttgctctt 198
>ref|XM_713754.1| Candida albicans SC5314 putative ubiquitin-specific protease (CaO19_6260), mRNA Length = 4119 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 590 gctcttgctcttgctcttgtt 610 ||||||||||||||||||||| Sbjct: 3730 gctcttgctcttgctcttgtt 3710
>ref|XM_712823.1| Candida albicans SC5314 putative transporter/sensor (CaO19_3225), mRNA Length = 3069 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 3000 ttgctcttgctcttgctcttg 2980
>ref|XM_712757.1| Candida albicans SC5314 putative transporter/sensor (CaO19_10735), mRNA Length = 3069 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 3000 ttgctcttgctcttgctcttg 2980
>gb|AC164002.4| Mus musculus chromosome 3, clone RP24-114A9, complete sequence Length = 198340 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 10250 ttgctcttgctcttgctcttg 10270 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 10244 ttgctcttgctcttgctcttg 10264 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 10238 ttgctcttgctcttgctcttg 10258 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 10232 ttgctcttgctcttgctcttg 10252
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 34133847 ttgctcttgctcttgctcttg 34133867 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 34133842 tgctcttgctcttgctcttg 34133861
>gb|AC139512.20| Mus musculus chromosome 6, clone RP24-540G13, complete sequence Length = 179236 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 159214 ttgctcttgctcttgctcttg 159194 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 159208 ttgctcttgctcttgctcttg 159188
>gb|AY459388.1| Pan paniscus LDOC1 gene, complete cds Length = 57900 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 33761 ttgctcttgctcttgctcttg 33781
>gb|AC107865.7| Mus musculus chromosome 1, clone RP23-389C9, complete sequence Length = 204959 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 195585 ttgctcttgctcttgctcttg 195565
>gb|AC115736.11| Mus musculus chromosome 3, clone RP23-473D1, complete sequence Length = 180545 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 39263 ttgctcttgctcttgctcttg 39283 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 39258 tgctcttgctcttgctcttg 39277
>ref|XM_752215.1| Ustilago maydis 521 hypothetical protein (UM01161.1) partial mRNA Length = 7950 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 7287 ttgctcttgctcttgctcttg 7267 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 7281 ttgctcttgctcttgctcttg 7261 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 7275 ttgctcttgctcttgctcttg 7255
>ref|XM_754682.1| Ustilago maydis 521 hypothetical protein (UM03628.1) partial mRNA Length = 2805 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 2355 ttgctcttgctcttgctcttg 2375 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 2361 ttgctcttgctcttgctctt 2380
>ref|XM_742794.1| Aspergillus fumigatus Af293 hypothetical protein (Afu6g01905) partial mRNA Length = 810 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 299 ttgctcttgctcttgctcttg 279
>emb|CT009527.5| Mouse DNA sequence from clone RP23-25D11 on chromosome 13, complete sequence Length = 226804 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36388 ttgctcttgctcttgctcttg 36368
>ref|XM_750790.1| Aspergillus fumigatus Af293 hypothetical protein (Afu2g15480) partial mRNA Length = 1431 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 705 ttgctcttgctcttgctcttg 685 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||||||||||| |||| Sbjct: 699 ttgctcttgctcttgctctggttg 676
>ref|XM_567624.1| Cryptococcus neoformans var. neoformans JEC21 endocytosis-related protein (CNK00600) partial mRNA Length = 4870 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 2832 ttgctcttgctcttgctcttg 2812
>gb|AC112676.8| Mus musculus chromosome 9, clone RP23-174F7, complete sequence Length = 230293 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 164606 ttgctcttgctcttgctcttg 164626
>gb|AC132598.3| Mus musculus BAC clone RP24-196M16 from chromosome 17, complete sequence Length = 162858 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 141047 ttgctcttgctcttgctcttg 141027
>gb|AC125400.4| Mus musculus BAC clone RP24-380E10 from chromosome 10, complete sequence Length = 154681 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 47045 ttgctcttgctcttgctcttg 47065
>gb|AC122511.5| Mus musculus BAC clone RP24-446A8 from chromosome 6, complete sequence Length = 157847 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 127336 ttgctcttgctcttgctcttg 127316
>gb|AC123558.5| Mus musculus BAC clone RP23-336N16 from chromosome 5, complete sequence Length = 211763 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 45895 ttgctcttgctcttgctcttg 45875
>gb|AC125529.4| Mus musculus BAC clone RP23-366O3 from chromosome 17, complete sequence Length = 215469 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 14795 ttgctcttgctcttgctcttg 14775
>gb|AC127568.4| Mus musculus BAC clone RP24-215P13 from chromosome 10, complete sequence Length = 206192 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 57944 ttgctcttgctcttgctcttg 57964
>gb|AC128669.4| Mus musculus BAC clone RP24-115D21 from chromosome 17, complete sequence Length = 169571 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 127761 ttgctcttgctcttgctcttg 127781 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 127755 ttgctcttgctcttgctcttg 127775
>gb|AC121881.3| Mus musculus BAC clone RP24-134L8 from chromosome 8, complete sequence Length = 184359 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 144209 ttgctcttgctcttgctcttg 144189 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 144203 ttgctcttgctcttgctcttg 144183 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 144197 ttgctcttgctcttgctcttg 144177 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 144191 ttgctcttgctcttgctctt 144172
>gb|AC121923.3| Mus musculus BAC clone RP24-198O18 from chromosome 8, complete sequence Length = 172772 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85649 ttgctcttgctcttgctcttg 85629 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85643 ttgctcttgctcttgctcttg 85623 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85637 ttgctcttgctcttgctcttg 85617 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85631 ttgctcttgctcttgctcttg 85611 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85625 ttgctcttgctcttgctcttg 85605 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85619 ttgctcttgctcttgctcttg 85599 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85613 ttgctcttgctcttgctcttg 85593 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85607 ttgctcttgctcttgctcttg 85587 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85601 ttgctcttgctcttgctcttg 85581 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85595 ttgctcttgctcttgctcttg 85575 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85589 ttgctcttgctcttgctcttg 85569 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 85583 ttgctcttgctcttgctcttg 85563
>emb|BX908796.11| Zebrafish DNA sequence from clone CH211-198E20 in linkage group 15, complete sequence Length = 204627 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 159136 ttgctcttgctcttgctcttg 159116 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 122638 ttgctcttgctcttgctcttg 122618
>gb|AC122841.4| Mus musculus BAC clone RP23-194E5 from 3, complete sequence Length = 200088 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 163661 ttgctcttgctcttgctcttg 163641
>gb|AC124551.4| Mus musculus BAC clone RP23-217K11 from 16, complete sequence Length = 199985 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 184464 ttgctcttgctcttgctcttg 184444 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 184458 ttgctcttgctcttgctcttg 184438
>gb|AC122276.4| Mus musculus BAC clone RP23-230D23 from 6, complete sequence Length = 169437 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 152588 ttgctcttgctcttgctcttg 152608 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 152582 ttgctcttgctcttgctcttg 152602
>gb|AC107794.13| Mus musculus chromosome 6, clone RP23-473P21, complete sequence Length = 183349 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 125262 ttgctcttgctcttgctcttg 125242 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 125256 ttgctcttgctcttgctcttg 125236 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 124369 ttgctcttgctcttgctcttg 124389 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 124363 ttgctcttgctcttgctcttg 124383 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 124357 ttgctcttgctcttgctcttg 124377
>emb|AL391724.7| Human DNA sequence from clone RP11-350A18 on chromosome 13 Contains a novel gene, complete sequence Length = 141628 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 117192 ttgctcttgctcttgctcttg 117212
>gb|AC124822.10| Mus musculus chromosome 3, clone RP24-217O18, complete sequence Length = 168065 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 99748 ttgctcttgctcttgctcttg 99728 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 99742 ttgctcttgctcttgctcttg 99722 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 99736 ttgctcttgctcttgctcttg 99716 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 99730 ttgctcttgctcttgctcttg 99710
>emb|CR380954.1| Candida glabrata strain CBS138 chromosome H complete sequence Length = 1050361 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 835067 ttgctcttgctcttgctcttg 835047
>gb|AC161593.2| Mus musculus BAC clone RP24-187P11 from chromosome 9, complete sequence Length = 155445 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 586 ttttgctcttgctcttgctct 606 ||||||||||||||||||||| Sbjct: 42709 ttttgctcttgctcttgctct 42729 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 586 ttttgctcttgctcttgctct 606 ||||||||||||||||||||| Sbjct: 40232 ttttgctcttgctcttgctct 40252
>gb|AC159336.13| Mus musculus 10 BAC RP24-430N21 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 180454 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 123469 ttgctcttgctcttgctcttg 123489 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 123463 ttgctcttgctcttgctcttg 123483 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 123457 ttgctcttgctcttgctcttg 123477
>emb|BX294148.1| Pirellula sp. strain 1 complete genome; segment 16/24 Length = 294850 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 35684 ttgctcttgctcttgctcttg 35664 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 35678 ttgctcttgctcttgctcttg 35658 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 35672 ttgctcttgctcttgctcttg 35652 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 35666 ttgctcttgctcttgctcttg 35646 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 35660 ttgctcttgctcttgctcttg 35640 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 35654 ttgctcttgctcttgctcttg 35634 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 35648 ttgctcttgctcttgctcttg 35628 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 35642 ttgctcttgctcttgctcttg 35622 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 35636 ttgctcttgctcttgctcttg 35616 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 35689 tgctcttgctcttgctcttg 35670
>emb|AL929353.1|PFA929353 Plasmodium falciparum strain 3D7, chromosome 5, segment 3/4 Length = 343050 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 162828 ttgctcttgctcttgctcttg 162848 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 162834 ttgctcttgctcttgctctt 162853 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 162823 tgctcttgctcttgctcttg 162842
>emb|AL161595.2|ATCHRIV91 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 91 Length = 198151 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 59651 ttgctcttgctcttgctcttg 59671
>emb|AL078620.2|ATF23K16 Arabidopsis thaliana DNA chromosome 4, BAC clone F23K16 (ESSA project) Length = 129047 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 34437 ttgctcttgctcttgctcttg 34457
>gb|AC162880.4| Mus musculus chromosome 1, clone RP24-275N11, complete sequence Length = 164201 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 143406 ttgctcttgctcttgctcttg 143386 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 143400 ttgctcttgctcttgctcttg 143380 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 143394 ttgctcttgctcttgctcttg 143374
>emb|AL954353.14| Mouse DNA sequence from clone RP23-156D8 on chromosome 11 Contains a pseudogene similar to part of striatin (calmodulin binding protein) (Strn), complete sequence Length = 188920 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 173479 ttgctcttgctcttgctcttg 173459
>emb|AL806526.4| Mouse DNA sequence from clone RP23-123F24 on chromosome 11 Contains a novel gene and a ribosomal protein S20 (Rps20) pseudogene, complete sequence Length = 128168 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 111618 ttgctcttgctcttgctcttg 111638 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 111612 ttgctcttgctcttgctcttg 111632
>gb|AC068797.29| Homo sapiens 12 BAC RP1-81P11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 136257 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 472 agctctctctcttcgcatgct 492 ||||||||||||||||||||| Sbjct: 29535 agctctctctcttcgcatgct 29555
>emb|AL928592.13| Mouse DNA sequence from clone RP24-168J7 on chromosome 4 Contains a novel pseudogene and a novel gene, complete sequence Length = 126611 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 102851 ttgctcttgctcttgctcttg 102831 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 100335 ttgctcttgctcttgctcttg 100315
>emb|AL845340.11| Mouse DNA sequence from clone RP23-169D3 on chromosome 4 Contains a novel gene and a CpG island, complete sequence Length = 193243 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 104516 ttgctcttgctcttgctcttg 104496 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 104510 ttgctcttgctcttgctcttg 104490
>gb|AY722691.1| Arachis hypogaea 2S protein 2 mRNA, complete cds Length = 581 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 266 ttgctcttgctcttgctcttg 246
>gb|AC163900.3| Mus musculus BAC clone RP23-151K15 from chromosome 12, complete sequence Length = 200606 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199813 ttgctcttgctcttgctcttg 199793 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199807 ttgctcttgctcttgctcttg 199787 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199801 ttgctcttgctcttgctcttg 199781 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199795 ttgctcttgctcttgctcttg 199775 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199789 ttgctcttgctcttgctcttg 199769 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199783 ttgctcttgctcttgctcttg 199763 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199777 ttgctcttgctcttgctcttg 199757 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199771 ttgctcttgctcttgctcttg 199751 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199765 ttgctcttgctcttgctcttg 199745 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199759 ttgctcttgctcttgctcttg 199739 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199753 ttgctcttgctcttgctcttg 199733 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199747 ttgctcttgctcttgctcttg 199727 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 199741 ttgctcttgctcttgctcttg 199721
>dbj|AB234611.1| Salmonella enterica subsp. enterica serovar Abortusequi ssrA gene for tmRNA, orf325, orf189, orf285, orf99, orf103, orf160, orf259, fljA gene for repressor of fliC, partial sequence and partial and complete cds Length = 7129 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 620 ttgctcttgctcttgctcttg 600 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 614 ttgctcttgctcttgctcttg 594 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 608 ttgctcttgctcttgctcttg 588 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||||||||| |||||| Sbjct: 602 ttgctcttgctcttgctgttgttg 579
>dbj|AK128977.1| Mus musculus cDNA fis, clone TRACH3016614, moderately similar to Peptidyl-prolyl cis-trans isomerase B precursor (EC 5.2.1.8) Length = 3314 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 2331 ttgctcttgctcttgctcttg 2351
>gb|AC153852.9| Mus musculus 10 BAC RP23-136F8 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 222518 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 16300 ttgctcttgctcttgctcttg 16320 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 16294 ttgctcttgctcttgctcttg 16314 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 16288 ttgctcttgctcttgctcttg 16308
>gb|AC091937.2| Homo sapiens chromosome 5 clone RP11-327L20, complete sequence Length = 119906 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 8269 ttgctcttgctcttgctcttg 8249
>gb|AC091895.2| Homo sapiens chromosome 5 clone RP11-143A12, complete sequence Length = 127329 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 48233 ttgctcttgctcttgctcttg 48253
>emb|BX323053.6| Zebrafish DNA sequence from clone DKEYP-53E9 in linkage group 12, complete sequence Length = 92153 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36318 ttgctcttgctcttgctcttg 36338 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36312 ttgctcttgctcttgctcttg 36332
>gb|AC162927.3| Mus musculus BAC clone RP23-269E12 from chromosome 9, complete sequence Length = 213948 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 31806 ttgctcttgctcttgctcttg 31786
>emb|BX255965.12| Zebrafish DNA sequence from clone CH211-270C19, complete sequence Length = 148298 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 agcaacgctgctcttcacatt 232 ||||||||||||||||||||| Sbjct: 4974 agcaacgctgctcttcacatt 4994
>gb|AC154731.2| Mus musculus BAC clone RP23-121M22 from chromosome 14, complete sequence Length = 215346 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 103789 ttgctcttgctcttgctcttg 103769 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 103783 ttgctcttgctcttgctcttg 103763 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 103777 ttgctcttgctcttgctcttg 103757 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 103771 ttgctcttgctcttgctcttg 103751
>gb|AC156801.2| Mus musculus BAC clone RP23-142F22 from chromosome 9, complete sequence Length = 197974 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 131852 ttgctcttgctcttgctcttg 131872 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 131846 ttgctcttgctcttgctcttg 131866 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 131840 ttgctcttgctcttgctcttg 131860 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 131834 ttgctcttgctcttgctcttg 131854 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 131858 ttgctcttgctcttgctctt 131877
>gb|AC160560.2| Mus musculus BAC clone RP23-357O18 from chromosome 9, complete sequence Length = 213978 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctct 606 ||||||||||||||||||||| Sbjct: 132366 ttttgctcttgctcttgctct 132346
>gb|AC161452.4| Mus musculus BAC clone RP23-411L11 from chromosome 16, complete sequence Length = 203922 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 163834 ttgctcttgctcttgctcttg 163814 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 163828 ttgctcttgctcttgctcttg 163808
>gb|AC118192.13| Mus musculus chromosome 1, clone RP23-200C17, complete sequence Length = 187935 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 70448 ttgctcttgctcttgctcttg 70468 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 67127 ttgctcttgctcttgctcttg 67147
>gb|AC160409.6| Mus musculus 10 BAC RP23-184O11 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 209766 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 9808 ttgctcttgctcttgctcttg 9788
>emb|CR377898.1| Pinus pinaster SSR, clone PPB3D07 Length = 505 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 412 ttgctcttgctcttgctcttg 392
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 15135765 ttgctcttgctcttgctcttg 15135745
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 24033868 ttgctcttgctcttgctcttg 24033888 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 18233153 ttgctcttgctcttgctcttg 18233173 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 24033863 tgctcttgctcttgctcttg 24033882
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 34224319 ttgctcttgctcttgctcttg 34224339 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 34224314 tgctcttgctcttgctcttg 34224333
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 30124615 ttgctcttgctcttgctcttg 30124635
>gb|AC007853.4|AC007853 Drosophila melanogaster, chromosome 3R, region 96B-96C, BAC clone BACR03L02, complete sequence Length = 162921 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 13698 ttgctcttgctcttgctcttg 13678
>gb|AC008206.10|AC008206 Drosophila melanogaster, chromosome 3R, region 96B-96B, BAC clone BACR03I15, complete sequence Length = 181132 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 77030 ttgctcttgctcttgctcttg 77010
>gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic sequence, complete sequence Length = 163828 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 97659 ttgctcttgctcttgctcttg 97679 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 97654 tgctcttgctcttgctcttg 97673
>gb|AC122920.4| Mus musculus BAC clone RP23-33J11 from chromosome 8, complete sequence Length = 229472 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 18847 ttgctcttgctcttgctcttg 18867 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 18841 ttgctcttgctcttgctcttg 18861 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 18835 ttgctcttgctcttgctcttg 18855 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 16475 ttgctcttgctcttgctcttg 16495 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 16469 ttgctcttgctcttgctcttg 16489 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 18853 ttgctcttgctcttgctctt 18872
>gb|AC125041.2| Mus musculus BAC clone RP23-337J19 from chromosome 12, complete sequence Length = 202288 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76964 ttgctcttgctcttgctcttg 76944 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76958 ttgctcttgctcttgctcttg 76938 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76952 ttgctcttgctcttgctcttg 76932 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76946 ttgctcttgctcttgctcttg 76926 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76940 ttgctcttgctcttgctcttg 76920 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76934 ttgctcttgctcttgctcttg 76914 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76928 ttgctcttgctcttgctcttg 76908 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76922 ttgctcttgctcttgctcttg 76902 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76916 ttgctcttgctcttgctcttg 76896 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76910 ttgctcttgctcttgctcttg 76890 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76904 ttgctcttgctcttgctcttg 76884 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76898 ttgctcttgctcttgctcttg 76878 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 76892 ttgctcttgctcttgctcttg 76872
>gb|AC132605.3| Mus musculus BAC clone RP24-90M10 from chromosome 14, complete sequence Length = 170855 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctct 606 ||||||||||||||||||||| Sbjct: 159424 ttttgctcttgctcttgctct 159404
>dbj|AP004376.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0481F05 Length = 139739 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 61268 ttgctcttgctcttgctcttg 61288 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 61263 tgctcttgctcttgctcttg 61282
>dbj|AP005113.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0685G12 Length = 149155 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 104212 ttgctcttgctcttgctcttg 104232
>emb|BX005404.7| Zebrafish DNA sequence from clone DKEY-21I14 in linkage group 15, complete sequence Length = 229643 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 208417 ttgctcttgctcttgctcttg 208437
>dbj|AP004689.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0434E03 Length = 142414 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 55465 ttgctcttgctcttgctcttg 55485
>dbj|AK103676.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033136B19, full insert sequence Length = 1300 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 718 ttgctcttgctcttgctcttg 698 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 723 tgctcttgctcttgctcttg 704
>dbj|AK100155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019E12, full insert sequence Length = 1603 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 541 ttgctcttgctcttgctcttg 521 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 546 tgctcttgctcttgctcttg 527
>gb|AC157016.3| Mus musculus 10 BAC RP24-505M19 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 168538 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 5177 ttgctcttgctcttgctcttg 5157
>gb|AC155928.2| Mus musculus BAC clone RP24-70N20 from 9, complete sequence Length = 239304 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 8609 ttgctcttgctcttgctcttg 8629
>dbj|AK064030.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-B07, full insert sequence Length = 1386 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 707 ttgctcttgctcttgctcttg 687 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 712 tgctcttgctcttgctcttg 693
>gb|AC123759.7| Mus musculus chromosome 3, clone RP24-303I14, complete sequence Length = 189387 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 69482 ttgctcttgctcttgctcttg 69462 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 66909 ttgctcttgctcttgctcttg 66889
>emb|Z74286.1|SCYDL238C S.cerevisiae chromosome IV reading frame ORF YDL238c Length = 1881 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 339 ttgctcttgctcttgctcttg 359
>gb|AE003750.2| Drosophila melanogaster chromosome 3R, section 88 of 118 of the complete sequence Length = 227219 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36217 ttgctcttgctcttgctcttg 36197
>gb|AC129557.10| Mus musculus chromosome 19, clone RP24-245F23, complete sequence Length = 174415 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 338 ttgctcttgctcttgctcttg 358 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 308 ttgctcttgctcttgctcttg 328 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 280 ttgctcttgctcttgctcttg 300 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 274 ttgctcttgctcttgctcttg 294 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 268 ttgctcttgctcttgctcttg 288 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 262 ttgctcttgctcttgctcttg 282 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 256 ttgctcttgctcttgctcttg 276 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 250 ttgctcttgctcttgctcttg 270 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 244 ttgctcttgctcttgctcttg 264 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 238 ttgctcttgctcttgctcttg 258 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 232 ttgctcttgctcttgctcttg 252 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 226 ttgctcttgctcttgctcttg 246 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 314 ttgctcttgctcttgctctt 333 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 286 ttgctcttgctcttgctctt 305
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 2087580 ttgctcttgctcttgctcttg 2087600
>gb|DQ331052.1| Synthetic construct Saccharomyces cerevisiae clone FLH144593.01X GUD1 gene, complete sequence Length = 1470 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 1341 ttgctcttgctcttgctcttg 1321
>emb|BX294008.8| Mouse DNA sequence from clone RP23-28K9 on chromosome X, complete sequence Length = 136485 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36156 ttgctcttgctcttgctcttg 36176 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36150 ttgctcttgctcttgctcttg 36170 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36144 ttgctcttgctcttgctcttg 36164 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36138 ttgctcttgctcttgctcttg 36158 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36132 ttgctcttgctcttgctcttg 36152
>emb|CT009706.20| Mouse DNA sequence from clone RP23-131H17 on chromosome 9, complete sequence Length = 215322 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 136234 ttgctcttgctcttgctcttg 136214
>gb|AC164438.3| Mus musculus BAC clone RP23-62L19 from chromosome 9, complete sequence Length = 205793 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 586 ttttgctcttgctcttgctct 606 ||||||||||||||||||||| Sbjct: 189032 ttttgctcttgctcttgctct 189052 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 586 ttttgctcttgctcttgctct 606 ||||||||||||||||||||| Sbjct: 186555 ttttgctcttgctcttgctct 186575
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 15090042 ttgctcttgctcttgctcttg 15090022
>emb|AL732384.1|CNS08C8X Leptosphaeria maculans : genomic region surrounding the avirulence gene AvrLm1; putative centromeric or peri-centromeric region clone A3 of library Lm3HLP1 from strain v23.1.3 of Mat- Leptosphaeria maculans Length = 75030 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 74594 ttgctcttgctcttgctcttg 74614 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 74588 ttgctcttgctcttgctcttg 74608 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 74582 ttgctcttgctcttgctcttg 74602 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 74576 ttgctcttgctcttgctcttg 74596 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 74570 ttgctcttgctcttgctcttg 74590 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 74564 ttgctcttgctcttgctcttg 74584 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 74558 ttgctcttgctcttgctcttg 74578 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 74552 ttgctcttgctcttgctcttg 74572 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 74546 ttgctcttgctcttgctcttg 74566 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 74540 ttgctcttgctcttgctcttg 74560
>emb|AL732383.1|CNS08C8W Leptosphaeria maculans : genomic region surrounding the avirulence gene AvrLm1; putative centromeric or peri-centromeric region clone A2 of library Lm3HLP1 from strain v23.1.3 of Mat- Leptosphaeria maculans Length = 61757 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 55315 ttgctcttgctcttgctcttg 55295 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 55309 ttgctcttgctcttgctcttg 55289 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 55303 ttgctcttgctcttgctcttg 55283 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 55297 ttgctcttgctcttgctcttg 55277 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 55291 ttgctcttgctcttgctcttg 55271 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 55285 ttgctcttgctcttgctcttg 55265 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 55279 ttgctcttgctcttgctcttg 55259 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 55273 ttgctcttgctcttgctcttg 55253 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 55267 ttgctcttgctcttgctcttg 55247 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 55261 ttgctcttgctcttgctcttg 55241
>emb|AL844876.4|CNS08CAZ Oryza sativa chromosome 12, . BAC OSJNBa0063F10 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 153687 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 120159 ttgctcttgctcttgctcttg 120179
>emb|AL713938.2|CNS07YPK Oryza sativa chromosome 12, . BAC OJ1372_C12 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 113071 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 75182 ttgctcttgctcttgctcttg 75162
>gb|AC140238.3| Mus musculus BAC clone RP24-279O7 from 3, complete sequence Length = 174633 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 131760 ttgctcttgctcttgctcttg 131780
>gb|AC132431.3| Mus musculus BAC clone RP23-211M23 from 6, complete sequence Length = 207155 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 128959 ttgctcttgctcttgctcttg 128939
>gb|AC141328.4| Mus musculus BAC clone RP23-204P22 from 6, complete sequence Length = 194430 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 174278 ttgctcttgctcttgctcttg 174298
>gb|AC125380.4| Mus musculus BAC clone RP23-204N23 from 1, complete sequence Length = 214005 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 103737 ttgctcttgctcttgctcttg 103757 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 103731 ttgctcttgctcttgctcttg 103751 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 103725 ttgctcttgctcttgctcttg 103745 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 103719 ttgctcttgctcttgctcttg 103739 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 103713 ttgctcttgctcttgctcttg 103733
>gb|AC129597.5| Mus musculus BAC clone RP23-262I17 from 13, complete sequence Length = 195537 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 102004 ttgctcttgctcttgctcttg 101984 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 98477 ttgctcttgctcttgctcttg 98457
>gb|AC151997.2| Mus musculus BAC clone RP23-138O21 from 8, complete sequence Length = 201556 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 86062 ttgctcttgctcttgctcttg 86082 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 86056 ttgctcttgctcttgctcttg 86076 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 86050 ttgctcttgctcttgctcttg 86070 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 86044 ttgctcttgctcttgctcttg 86064 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 86038 ttgctcttgctcttgctcttg 86058 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 86032 ttgctcttgctcttgctcttg 86052
>emb|AL807832.6| Mouse DNA sequence from clone RP23-198D21 on chromosome 2, complete sequence Length = 192480 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36868 ttgctcttgctcttgctcttg 36888
>emb|AL954771.5| Zebrafish DNA sequence from clone CH211-220B15 in linkage group 21, complete sequence Length = 197721 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 155498 ttgctcttgctcttgctcttg 155518
>gb|AC158169.2| Mus musculus BAC clone RP23-210A16 from chromosome 5, complete sequence Length = 223006 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 56218 ttgctcttgctcttgctcttg 56198
>emb|AL626773.18| Mouse DNA sequence from clone RP23-273M9 on chromosome 4, complete sequence Length = 193852 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 126877 ttgctcttgctcttgctcttg 126897 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 126871 ttgctcttgctcttgctcttg 126891 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 117113 ttgctcttgctcttgctcttg 117133
>gb|AC163389.2| Mus musculus chromosome 1, clone RP23-397E23, complete sequence Length = 203933 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 41647 ttgctcttgctcttgctcttg 41627 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 38326 ttgctcttgctcttgctcttg 38306
>emb|AL844221.6| Mouse DNA sequence from clone RP23-445C3 on chromosome X, complete sequence Length = 188627 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 36801 ttgctcttgctcttgctcttg 36781
>emb|AL606745.11| Mouse DNA sequence from clone RP23-32L6 on chromosome 3, complete sequence Length = 192332 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 169462 ttgctcttgctcttgctcttg 169482
>emb|AL513354.14| Mouse DNA sequence from clone RP23-150J22 on chromosome 15, complete sequence Length = 227073 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 132146 ttgctcttgctcttgctcttg 132166
>emb|AL671911.12| Mouse DNA sequence from clone RP23-250F8 on chromosome X, complete sequence Length = 213401 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 144088 ttgctcttgctcttgctcttg 144068 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 144082 ttgctcttgctcttgctcttg 144062 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 144076 ttgctcttgctcttgctcttg 144056
>emb|AL732443.6| Mouse DNA sequence from clone RP23-90H6 on chromosome X, complete sequence Length = 219342 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 204275 ttgctcttgctcttgctcttg 204255 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 204269 ttgctcttgctcttgctcttg 204249
>gb|AC154874.9| Mus musculus chromosome 15, clone RP23-227M7, complete sequence Length = 206926 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 125942 ttgctcttgctcttgctcttg 125962
>gb|AC166241.7| Mus musculus chromosome 8, clone RP23-125A7, complete sequence Length = 208067 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttg 608 ||||||||||||||||||||| Sbjct: 78361 ttgctcttgctcttgctcttg 78341
>ref|NM_105890.2| Arabidopsis thaliana ATL3; protein binding / ubiquitin-protein ligase/ zinc ion binding AT1G72310 (ATL3) mRNA, complete cds Length = 1649 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||||||||| |||||| Sbjct: 715 ttgctcttgctcttgctgttgttg 692
>ref|NM_112577.2| Arabidopsis thaliana DNA binding / transcription factor AT3G17010 mRNA, complete cds Length = 1074 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 578 ttgctcttgctcttgctctt 559
>gb|AC102130.7| Mus musculus chromosome 3, clone RP23-223I2, complete sequence Length = 176409 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 591 ctcttgctcttgctcttgtt 610 |||||||||||||||||||| Sbjct: 25887 ctcttgctcttgctcttgtt 25868
>gb|AC130671.7| Mus musculus chromosome 15, clone RP24-90K19, complete sequence Length = 205646 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 377 tgcagattctgtgaactgca 396 |||||||||||||||||||| Sbjct: 147005 tgcagattctgtgaactgca 146986
>gb|AC115930.10| Mus musculus chromosome 3, clone RP24-534H10, complete sequence Length = 158041 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 50639 ttgctcttgctcttgctctt 50658
>gb|AC104516.2| Drosophila melanogaster clone BACR20O17, complete sequence Length = 174404 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 271 atgtctcgtttttaccgttt 290 |||||||||||||||||||| Sbjct: 42647 atgtctcgtttttaccgttt 42628
>gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's Hospital Oakland Research Institute) complete sequence Length = 156078 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 591 ctcttgctcttgctcttgtt 610 |||||||||||||||||||| Sbjct: 43426 ctcttgctcttgctcttgtt 43407 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 591 ctcttgctcttgctcttgtt 610 |||||||||||||||||||| Sbjct: 38056 ctcttgctcttgctcttgtt 38037
>gb|AC098294.6| Rattus norvegicus 8 BAC CH230-1L23 (Children's Hospital Oakland Research Institute) complete sequence Length = 150308 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 587 tttgctcttgctcttgctct 606 |||||||||||||||||||| Sbjct: 11255 tttgctcttgctcttgctct 11236
>ref|XM_322802.1| Neurospora crassa OR74A hypothetical protein (NCU03545.1) partial mRNA Length = 6930 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||| |||||||||||| Sbjct: 900 ttgctcttgctgttgctcttgttg 877
>ref|XM_951731.1| Neurospora crassa OR74A hypothetical protein (NCU03545.1) partial mRNA Length = 6930 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||| |||||||||||| Sbjct: 900 ttgctcttgctgttgctcttgttg 877
>gb|AC094830.5| Rattus norvegicus 8 BAC CH230-3H18 (Children's Hospital Oakland Research Institute) complete sequence Length = 237199 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 587 tttgctcttgctcttgctct 606 |||||||||||||||||||| Sbjct: 88908 tttgctcttgctcttgctct 88927
>gb|AC146417.3| Pan troglodytes BAC clone RP43-29B12 from 7, complete sequence Length = 196843 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 218 gctgctcttcacattttgct 237 |||||||||||||||||||| Sbjct: 126157 gctgctcttcacattttgct 126138
>ref|XM_756539.1| Ustilago maydis 521 hypothetical protein (UM05485.1) partial mRNA Length = 5493 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 5423 tgctcttgctcttgctcttg 5404
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 951753 ttgctcttgctcttgctctt 951734
>emb|CR848816.11| Zebrafish DNA sequence from clone DKEY-99F10 in linkage group 11, complete sequence Length = 158354 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 434 ttcttgatcagcgttttcagactt 457 ||||||||||||||||||| |||| Sbjct: 118919 ttcttgatcagcgttttcacactt 118896
>ref|XM_746890.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g08420) partial mRNA Length = 834 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 208 tgctcttgctcttgctcttg 189
>gb|AC113589.13| Mus musculus chromosome 9, clone RP23-257A19, complete sequence Length = 213826 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 591 ctcttgctcttgctcttgtt 610 |||||||||||||||||||| Sbjct: 146379 ctcttgctcttgctcttgtt 146360
>gb|AC161824.6| Mus musculus 6 BAC RP23-62E9 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 263206 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 591 ctcttgctcttgctcttgtt 610 |||||||||||||||||||| Sbjct: 127995 ctcttgctcttgctcttgtt 128014
>emb|BX465195.28| Zebrafish DNA sequence from clone DKEY-246J6 in linkage group 14, complete sequence Length = 175826 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctc 605 |||||||||||||||||||| Sbjct: 90173 ttttgctcttgctcttgctc 90154
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 591 ctcttgctcttgctcttgtt 610 |||||||||||||||||||| Sbjct: 5044706 ctcttgctcttgctcttgtt 5044725
>emb|AL390766.16| Human DNA sequence from clone RP13-348N17 on chromosome 10 Contains part of the PARD3 gene for par-3 partitioning defective 3 homolog (C.elegans), complete sequence Length = 193131 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 218 gctgctcttcacattttgct 237 |||||||||||||||||||| Sbjct: 122764 gctgctcttcacattttgct 122745
>gb|BT010140.1| Arabidopsis thaliana At1g72310 gene, complete cds Length = 975 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||||||||| |||||| Sbjct: 207 ttgctcttgctcttgctgttgttg 184
>gb|AC158903.4| Mus musculus chromosome 18, clone RP23-318E22, complete sequence Length = 201073 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 591 ctcttgctcttgctcttgtt 610 |||||||||||||||||||| Sbjct: 136040 ctcttgctcttgctcttgtt 136059
>gb|AC118772.5| Rattus norvegicus 10 BAC CH230-404C20 (Children's Hospital Oakland Research Institute) complete sequence Length = 178272 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 591 ctcttgctcttgctcttgtt 610 |||||||||||||||||||| Sbjct: 160332 ctcttgctcttgctcttgtt 160313 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 591 ctcttgctcttgctcttgtt 610 |||||||||||||||||||| Sbjct: 154928 ctcttgctcttgctcttgtt 154909
>gb|AC130388.6| Drosophila melanogaster X BAC CH221-14P20 (Children's Hospital Oakland Research Institute Drosophila melanogaster sheared DNA BAC Library) complete sequence Length = 117795 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 4046 tgctcttgctcttgctcttg 4027
>emb|AL669986.1|NCB7N14 Neurospora crassa DNA linkage group II BAC clone B7N14 Length = 107947 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||| |||||||||||| Sbjct: 93254 ttgctcttgctgttgctcttgttg 93277
>emb|BX640588.5| Zebrafish DNA sequence from clone DKEY-110L7 in linkage group 6, complete sequence Length = 117506 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 590 gctcttgctcttgctcttgt 609 |||||||||||||||||||| Sbjct: 14854 gctcttgctcttgctcttgt 14873
>emb|BX323006.12| Zebrafish DNA sequence from clone CH211-145H19 in linkage group 15, complete sequence Length = 161776 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctc 605 |||||||||||||||||||| Sbjct: 50881 ttttgctcttgctcttgctc 50862
>emb|BX571949.19| Zebrafish DNA sequence from clone DKEY-25F1 in linkage group 11, complete sequence Length = 149012 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 434 ttcttgatcagcgttttcagactt 457 ||||||||||||||||||| |||| Sbjct: 67395 ttcttgatcagcgttttcacactt 67418
>gb|AC093500.2| Drosophila melanogaster 3L BAC RP98-29P5 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 173558 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctc 605 |||||||||||||||||||| Sbjct: 169012 ttttgctcttgctcttgctc 168993
>gb|AC010716.4| Drosophila melanogaster 3L BAC RP98-11A21 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 173386 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctc 605 |||||||||||||||||||| Sbjct: 73941 ttttgctcttgctcttgctc 73922
>ref|NM_130716.1| Drosophila melanogaster CG12462-RA (CG12462), mRNA Length = 303 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 149 tgctcttgctcttgctcttg 130
>gb|DQ086198.1| Ictalurus punctatus superoxide dismutase 2 mRNA, partial cds Length = 628 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 46 tgctcttgctcttgctcttg 27 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 41 ttgctcttgctcttgctctt 22
>gb|AC158955.2| Mus musculus chromosome 15, clone RP23-22C17, complete sequence Length = 256999 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 377 tgcagattctgtgaactgca 396 |||||||||||||||||||| Sbjct: 86103 tgcagattctgtgaactgca 86084
>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII, complete sequence Length = 1476513 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 434259 ttgctcttgctcttgctctt 434278 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 434254 tgctcttgctcttgctcttg 434273
>emb|BX815766.1|CNS0ABIS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS92ZC01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1586 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||||||||| |||||| Sbjct: 682 ttgctcttgctcttgctgttgttg 659
>emb|BX814281.1|CNS0ACEG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB66ZA03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1538 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||||||||| |||||| Sbjct: 667 ttgctcttgctcttgctgttgttg 644
>emb|BX817061.1|CNS0ABWR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH83ZB12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1556 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||||||||| |||||| Sbjct: 663 ttgctcttgctcttgctgttgttg 640
>emb|BX815486.1|CNS0ABIO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS66ZA04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1480 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||||||||| |||||| Sbjct: 611 ttgctcttgctcttgctgttgttg 588
>gb|AC153598.4| Mus musculus 6 BAC RP23-167L15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 209035 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 591 ctcttgctcttgctcttgtt 610 |||||||||||||||||||| Sbjct: 196807 ctcttgctcttgctcttgtt 196788
>gb|AC157089.5| Mus musculus 10 BAC RP24-339G14 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 160723 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 367 cctttgctcttgcagattctgtga 390 |||||||||||||||| ||||||| Sbjct: 38112 cctttgctcttgcagactctgtga 38135
>gb|AC154472.2| Mus musculus BAC clone RP24-120L6 from chromosome 12, complete sequence Length = 155996 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 585 tttttgctcttgctcttgctcttg 608 |||||||||||| ||||||||||| Sbjct: 92478 tttttgctcttgttcttgctcttg 92501
>gb|AC016529.7|AC016529 Arabidopsis thaliana chromosome 1 BAC T10D10 genomic sequence, complete sequence Length = 87039 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||||||||| |||||| Sbjct: 86618 ttgctcttgctcttgctgttgttg 86641
>gb|AC067754.6|AC067754 Arabidopsis thaliana chromosome 1 BAC T9N14 genomic sequence, complete sequence Length = 98874 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||||||||| |||||| Sbjct: 90556 ttgctcttgctcttgctgttgttg 90533
>gb|AC008279.3| Homo sapiens BAC clone RP11-427F22 from 2, complete sequence Length = 157258 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 32286 ttgctcttgctcttgctctt 32305
>gb|AC006064.10| Homo sapiens 12 PAC RP5-940J5 (Roswell Park Cancer Institute Human PAC Library) complete sequence Length = 172571 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 aactgctgctcttctccatc 36 |||||||||||||||||||| Sbjct: 58791 aactgctgctcttctccatc 58772
>dbj|AB026636.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17 Length = 92620 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 33686 ttgctcttgctcttgctctt 33667
>ref|NM_211587.1| Eremothecium gossypii AGL142Cp (AGL142C), mRNA Length = 4494 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 4487 tgctcttgctcttgctcttg 4468 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 4482 ttgctcttgctcttgctctt 4463
>gb|AY105739.1| Zea mays PCO084555 mRNA sequence Length = 962 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 856 ttgctcttgctcttgctctt 875
>gb|AC153825.7| Mus musculus 10 BAC RP23-70B19 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 279677 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 79396 ttgctcttgctcttgctctt 79415
>gb|AF132013.1|AF132013 Arabidopsis thaliana RING-H2 zinc finger protein ATL3 (ATL3) mRNA, complete cds Length = 1664 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctcttgttg 611 ||||||||||||||||| |||||| Sbjct: 712 ttgctcttgctcttgctgttgttg 689
>gb|AC155272.3| Mus musculus BAC clone RP23-79N13 from chromosome 13, complete sequence Length = 213306 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 586 ttttgctcttgctcttgctc 605 |||||||||||||||||||| Sbjct: 46527 ttttgctcttgctcttgctc 46546
>gb|AY193533.1| Lactuca sativa clone TDAF resistance protein RGC2 mRNA, complete cds Length = 5648 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 3326 tgctcttgctcttgctcttg 3307
>gb|AE003564.3| Drosophila melanogaster chromosome 3L, section 21 of 83 of the complete sequence Length = 315944 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 586 ttttgctcttgctcttgctc 605 |||||||||||||||||||| Sbjct: 54041 ttttgctcttgctcttgctc 54022
>gb|AE003510.5| Drosophila melanogaster chromosome X, section 62 of 74 of the complete sequence Length = 297236 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 271 atgtctcgtttttaccgttt 290 |||||||||||||||||||| Sbjct: 217322 atgtctcgtttttaccgttt 217303
>gb|AE003428.4| Drosophila melanogaster chromosome X, section 12 of 74 of the complete sequence Length = 203546 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 183834 tgctcttgctcttgctcttg 183815
>emb|CT030195.12| Mouse DNA sequence from clone RP23-191J8 on chromosome 13, complete sequence Length = 219800 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 586 ttttgctcttgctcttgctc 605 |||||||||||||||||||| Sbjct: 211612 ttttgctcttgctcttgctc 211631
>emb|BX005345.12| Mouse DNA sequence from clone RP23-344C21 on chromosome X, complete sequence Length = 208344 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 102457 ttgctcttgctcttgctctt 102438
>gb|AC102393.8| Mus musculus chromosome 18, clone RP24-125H9, complete sequence Length = 152240 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 591 ctcttgctcttgctcttgtt 610 |||||||||||||||||||| Sbjct: 75765 ctcttgctcttgctcttgtt 75746
>emb|AL732620.14| Mouse DNA sequence from clone RP23-167G19 on chromosome 2, complete sequence Length = 230116 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 ttgctcttgctcttgctctt 607 |||||||||||||||||||| Sbjct: 73362 ttgctcttgctcttgctctt 73381
>gb|AC152508.3| Tribolium castaneum BAC T.cast_C29K22 (Clemson University Genomics Institute Tribolium castaneum BAC Library (Red Flour Beetle)) complete sequence Length = 143678 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 tgctcttgctcttgctcttg 608 |||||||||||||||||||| Sbjct: 125742 tgctcttgctcttgctcttg 125723 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,218,181 Number of Sequences: 3902068 Number of extensions: 5218181 Number of successful extensions: 97422 Number of sequences better than 10.0: 230 Number of HSP's better than 10.0 without gapping: 231 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 95808 Number of HSP's gapped (non-prelim): 1524 length of query: 625 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 602 effective length of database: 17,143,297,704 effective search space: 10320265217808 effective search space used: 10320265217808 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
