ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags11p09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK108395.1| Oryza sativa (japonica cultivar-group) cDNA clon... 281 1e-72
2gb|BT018062.1| Zea mays clone EL01N0532G08.c mRNA sequence 248 2e-62
3gb|AY105351.1| Zea mays PCO101615 mRNA sequence 248 2e-62
4ref|XM_480211.1| Oryza sativa (japonica cultivar-group), mRNA 246 8e-62
5gb|AC137606.2| Oryza sativa (japonica cultivar-group) chromosome... 147 5e-32
6gb|AC137624.2| Oryza sativa (japonica cultivar-group) chromosome... 147 5e-32
7dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 147 5e-32
8dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
9dbj|AP005504.3| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
10dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
11dbj|AP003349.4| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
12dbj|AP003418.2| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
13ref|NM_111045.3| Arabidopsis thaliana structural constituent of ... 70 1e-08
14ref|NM_180163.2| Arabidopsis thaliana structural constituent of ... 70 1e-08
15gb|BT010192.1| Arabidopsis thaliana At1g01640 gene, complete cds 70 1e-08
16emb|BX822660.1|CNS0A7H4 Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
17emb|BX822466.1|CNS0A7AA Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
18emb|BX822472.1|CNS0A705 Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
19emb|BX824635.1|CNS0A4TG Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
20gb|BT013176.1| Lycopersicon esculentum clone 134251R, mRNA sequence 58 4e-05
21gb|AC130307.3| Homo sapiens chromosome 11, clone RP11-15D10, com... 44 0.58
22emb|AL929414.5| Mouse DNA sequence from clone RP23-222A19 on chr... 44 0.58
23gb|AC090858.6| Homo sapiens chromosome 11, clone RP11-676E14, co... 44 0.58
24gb|AC153132.4| Mus musculus BAC clone RP24-362N19 from chromosom... 44 0.58
25gb|AF067776.1|AF067776 Abiotrophia defectiva extracellular matri... 44 0.58
26gb|AC010797.4|ATAC010797 Arabidopsis thaliana chromosome III BAC... 42 2.3
27dbj|AK009132.1| Mus musculus adult male tongue cDNA, RIKEN full-... 42 2.3
28ref|XM_640882.1| Dictyostelium discoideum hypothetical protein (... 40 9.0
29ref|XM_657344.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 9.0
30emb|AL035555.11|HS217P22 Human DNA sequence from clone RP1-217P2... 40 9.0
31ref|XM_967054.1| PREDICTED: Tribolium castaneum similar to hydro... 40 9.0
32emb|AJ235273.1|RPXX04 Rickettsia prowazekii strain Madrid E, com... 40 9.0
33emb|AJ131049.1|CAR131049 Cicer arietinum mRNA for hypothetical p... 40 9.0
34emb|CR456624.7| Zebrafish DNA sequence from clone CH211-69E5 in ... 40 9.0
35gb|AC007249.5| Homo sapiens BAC clone RP11-320M2 from 2, complet... 40 9.0
36gb|AF224746.1|AF224746 Xenopus laevis bicaudal-C (Bic-C) mRNA, c... 40 9.0
37emb|Z82598.1|RPZ82598 R.prowazekii genomic DNA fragment (clone A... 40 9.0
38emb|CR293523.11| Zebrafish DNA sequence from clone DKEY-104J7 in... 40 9.0
39emb|CR854857.19| Zebrafish DNA sequence from clone CH211-129F7 i... 40 9.0
40gb|AC106824.2| Homo sapiens chromosome 5 clone RP11-81H9, comple... 40 9.0

>dbj|AK108395.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-142-F09, full
           insert sequence
          Length = 779

 Score =  281 bits (142), Expect = 1e-72
 Identities = 253/290 (87%)
 Strand = Plus / Minus

                                                                       
Query: 370 gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
           ||||| |||||||| ||||||||||| ||||||| ||  || |||||||||||||| |||
Sbjct: 587 gctgctctgtcctgctctttcttctgcgcccttaacagtgcgcgtcttgcccggggacgc 528

                                                                       
Query: 430 atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
           ||||| |||||||||||| | ||||| |  ||||| || ||||| || || |||||||||
Sbjct: 527 atctcgcgcacttggcgtcgtggcatcataaaaggttcaagagggcgatcatggaatggg 468

                                                                       
Query: 490 tgctcgccttcagcaaatatcctcagcttacgatccctatcatcacgcaatttattgcgg 549
           |||||   | ||| |||||||||||| ||||||||||| |||||||||||| ||||||| 
Sbjct: 467 tgctcatttccagaaaatatcctcagtttacgatccctgtcatcacgcaatctattgcga 408

                                                                       
Query: 550 ggaagcatgcgcatgacagctttacggatcacttcagttgggtcttttgccatctggtcc 609
           ||||||||||||||||||||||| || ||  ||||||||||||||||| |||||||||||
Sbjct: 407 ggaagcatgcgcatgacagctttgcgaattgcttcagttgggtctttttccatctggtcc 348

                                                             
Query: 610 ttgagctttctttccttcagatggccaatataccctgtatgccagtagta 659
           |||||  |||||||||||| |||||||||||||||||| |||||||||||
Sbjct: 347 ttgagtcttctttccttcaaatggccaatataccctgtgtgccagtagta 298



to top

>gb|BT018062.1| Zea mays clone EL01N0532G08.c mRNA sequence
          Length = 892

 Score =  248 bits (125), Expect = 2e-62
 Identities = 239/277 (86%)
 Strand = Plus / Minus

                                                                       
Query: 385 tctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgcatctcacgcacttgg 444
           ||||| ||||| ||||||| ||| ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 587 tcttttttctgggcccttaacattgcacgccttgcgcggggtcgcatctcccgaacttgc 528

                                                                       
Query: 445 cgtggcggcatgacgaaaggctcgagaggccggtcgtggaatgggtgctcgccttcagca 504
           ||||| ||||| || ||||  || ||||| ||||| |||||||| |||||   | ||| |
Sbjct: 527 cgtggtggcatcacaaaagcttcaagagggcggtcatggaatggatgctcaattccagaa 468

                                                                       
Query: 505 aatatcctcagcttacgatccctatcatcacgcaatttattgcggggaagcatgcgcatg 564
           ||||||| |||||| ||||||||||||||||||| ||| |||||||||||||||||||  
Sbjct: 467 aatatccgcagcttgcgatccctatcatcacgcagtttgttgcggggaagcatgcgcagc 408

                                                                       
Query: 565 acagctttacggatcacttcagttgggtcttttgccatctggtccttgagctttctttcc 624
           |||||||| || ||||||||||||||||||||  ||||||||||||||||| | ||||||
Sbjct: 407 acagctttgcgaatcacttcagttgggtctttctccatctggtccttgagcctcctttcc 348

                                                
Query: 625 ttcagatggccaatataccctgtatgccagtagtaaa 661
           |||| |||||||| |||||||||||||||||||||||
Sbjct: 347 ttcaaatggccaacataccctgtatgccagtagtaaa 311



to top

>gb|AY105351.1| Zea mays PCO101615 mRNA sequence
          Length = 1079

 Score =  248 bits (125), Expect = 2e-62
 Identities = 239/277 (86%)
 Strand = Plus / Minus

                                                                       
Query: 385 tctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgcatctcacgcacttgg 444
           ||||| ||||| ||||||| ||| ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 635 tcttttttctgggcccttaacattgcacgccttgcacggggtcgcatctcccgtacttgc 576

                                                                       
Query: 445 cgtggcggcatgacgaaaggctcgagaggccggtcgtggaatgggtgctcgccttcagca 504
           ||||| ||||| || ||||  || ||||| ||||| |||||||| |||||   | ||| |
Sbjct: 575 cgtggtggcatcacaaaagcttcaagagggcggtcatggaatggatgctcaattccagaa 516

                                                                       
Query: 505 aatatcctcagcttacgatccctatcatcacgcaatttattgcggggaagcatgcgcatg 564
           ||||||| |||||| ||||||||||||||||||| ||| |||||||||||||||||||  
Sbjct: 515 aatatccgcagcttgcgatccctatcatcacgcagtttgttgcggggaagcatgcgcagc 456

                                                                       
Query: 565 acagctttacggatcacttcagttgggtcttttgccatctggtccttgagctttctttcc 624
           |||||||| || ||||||||||||||||||||  ||||||||||||||||| | ||||||
Sbjct: 455 acagctttgcgaatcacttcagttgggtctttctccatctggtccttgagcctcctttcc 396

                                                
Query: 625 ttcagatggccaatataccctgtatgccagtagtaaa 661
           |||| |||||||| |||||||||||||||||||||||
Sbjct: 395 ttcaaatggccaacataccctgtatgccagtagtaaa 359



to top

>ref|XM_480211.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 690

 Score =  246 bits (124), Expect = 8e-62
 Identities = 250/292 (85%)
 Strand = Plus / Minus

                                                                       
Query: 370 gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
           ||||| |||||||| ||||||||||| ||||| || |  || ||||||||| ||||||||
Sbjct: 551 gctgctctgtcctgctctttcttctgcgccctaataagtgcccgtcttgcctgggggcgc 492

                                                                       
Query: 430 atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
           ||||| ||||| || || || |||||  | ||||| || ||||| || || ||||| || 
Sbjct: 491 atctcgcgcacctgacgcggtggcatcgcaaaaggttcaagagggcgatcatggaaggga 432

                                                                       
Query: 490 tgctcgccttcagcaaatatcctcagcttacgatccctatcatcacgcaatttattgcgg 549
           ||||| | | ||| |||||||||||| || ||||||||||||||||||||| ||||||||
Sbjct: 431 tgctcacttccagaaaatatcctcagtttgcgatccctatcatcacgcaatctattgcgg 372

                                                                       
Query: 550 ggaagcatgcgcatgacagctttacggatcacttcagttgggtcttttgccatctggtcc 609
           |||||||||||||| |||||||| || ||||| || |||||||| ||| |||||||||||
Sbjct: 371 ggaagcatgcgcatcacagctttgcgaatcacctcggttgggtccttttccatctggtcc 312

                                                               
Query: 610 ttgagctttctttccttcagatggccaatataccctgtatgccagtagtaaa 661
           |||||  |||||||||||| |||||||||||||||||| |||||||||||||
Sbjct: 311 ttgagtcttctttccttcaaatggccaatataccctgtgtgccagtagtaaa 260



to top

>gb|AC137606.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0004B23, complete sequence
          Length = 153136

 Score =  147 bits (74), Expect = 5e-32
 Identities = 104/114 (91%)
 Strand = Plus / Plus

                                                                         
Query: 530   catcacgcaatttattgcggggaagcatgcgcatgacagctttacggatcacttcagttg 589
             ||||||||||| ||||||| ||||||||||||||||||||||| || ||  |||||||||
Sbjct: 84984 catcacgcaatctattgcgaggaagcatgcgcatgacagctttgcgaattgcttcagttg 85043

                                                                   
Query: 590   ggtcttttgccatctggtccttgagctttctttccttcagatggccaatatacc 643
             |||||||| ||||||||||||||||  |||||||||||| ||||||||||||||
Sbjct: 85044 ggtctttttccatctggtccttgagtcttctttccttcaaatggccaatatacc 85097



 Score =  133 bits (67), Expect = 8e-28
 Identities = 100/111 (90%)
 Strand = Plus / Plus

                                                                         
Query: 530   catcacgcaatttattgcggggaagcatgcgcatgacagctttacggatcacttcagttg 589
             ||||||||||| ||||||| ||||||||||||||||||||||| || || ||||||||||
Sbjct: 75489 catcacgcaatctattgcgaggaagcatgcgcatgacagctttgcgaattacttcagttg 75548

                                                                
Query: 590   ggtcttttgccatctggtccttgagctttctttccttcagatggccaatat 640
             |||||||| |||| |||||||||||  ||| |||||||| |||||||||||
Sbjct: 75549 ggtctttttccatgtggtccttgagtcttcattccttcaaatggccaatat 75599



 Score =  123 bits (62), Expect = 8e-25
 Identities = 134/158 (84%)
 Strand = Plus / Plus

                                                                         
Query: 370   gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
             ||||| |||||||| ||||||||||| ||||||| ||  ||||||||||||||||| |||
Sbjct: 77289 gctgctctgtcctgctctttcttctgcgcccttaacaatgcacgtcttgcccggggacgc 77348

                                                                         
Query: 430   atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
             |||||  ||||||||||||| ||||| || ||||| || ||||| || || |||||||||
Sbjct: 77349 atctcctgcacttggcgtggtggcatcacaaaaggttcaagagggcgatcatggaatggg 77408

                                                   
Query: 490   tgctcgccttcagcaaatatcctcagcttacgatccct 527
             |||||   | ||| |||||||||||  |||||||||||
Sbjct: 77409 tgctcatttccagaaaatatcctcaatttacgatccct 77446



 Score =  115 bits (58), Expect = 2e-22
 Identities = 133/158 (84%)
 Strand = Plus / Plus

                                                                         
Query: 370   gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
             ||||| |||||||| ||||||||||| ||||||| ||  || |||||||||||||| |||
Sbjct: 82966 gctgctctgtcctgctctttcttctgcgcccttaacagtgcgcgtcttgcccggggacgc 83025

                                                                         
Query: 430   atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
             ||||| |||||||||||| | ||||| |  ||||| || ||||| || || |||||||||
Sbjct: 83026 atctcgcgcacttggcgtcgtggcatcataaaaggttcaagagggcgatcatggaatggg 83085

                                                   
Query: 490   tgctcgccttcagcaaatatcctcagcttacgatccct 527
             |||||   | ||| |||||||||||| |||||||||||
Sbjct: 83086 tgctcatttccagaaaatatcctcagtttacgatccct 83123



to top

>gb|AC137624.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0680F01,
            complete sequence
          Length = 156691

 Score =  147 bits (74), Expect = 5e-32
 Identities = 104/114 (91%)
 Strand = Plus / Plus

                                                                        
Query: 530  catcacgcaatttattgcggggaagcatgcgcatgacagctttacggatcacttcagttg 589
            ||||||||||| ||||||| ||||||||||||||||||||||| || ||  |||||||||
Sbjct: 7835 catcacgcaatctattgcgaggaagcatgcgcatgacagctttgcgaattgcttcagttg 7894

                                                                  
Query: 590  ggtcttttgccatctggtccttgagctttctttccttcagatggccaatatacc 643
            |||||||| ||||||||||||||||  |||||||||||| ||||||||||||||
Sbjct: 7895 ggtctttttccatctggtccttgagtcttctttccttcaaatggccaatatacc 7948



 Score =  123 bits (62), Expect = 8e-25
 Identities = 134/158 (84%)
 Strand = Plus / Plus

                                                                       
Query: 370 gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
           ||||| |||||||| ||||||||||| ||||||| ||  ||||||||||||||||| |||
Sbjct: 140 gctgctctgtcctgctctttcttctgcgcccttaacaatgcacgtcttgcccggggacgc 199

                                                                       
Query: 430 atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
           |||||  ||||||||||||| ||||| || ||||| || ||||| || || |||||||||
Sbjct: 200 atctcctgcacttggcgtggtggcatcacaaaaggttcaagagggcgatcatggaatggg 259

                                                 
Query: 490 tgctcgccttcagcaaatatcctcagcttacgatccct 527
           |||||   | ||| |||||||||||  |||||||||||
Sbjct: 260 tgctcatttccagaaaatatcctcaatttacgatccct 297



 Score =  115 bits (58), Expect = 2e-22
 Identities = 133/158 (84%)
 Strand = Plus / Plus

                                                                        
Query: 370  gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
            ||||| |||||||| ||||||||||| ||||||| ||  || |||||||||||||| |||
Sbjct: 5817 gctgctctgtcctgctctttcttctgcgcccttaacagtgcgcgtcttgcccggggacgc 5876

                                                                        
Query: 430  atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
            ||||| |||||||||||| | ||||| |  ||||| || ||||| || || |||||||||
Sbjct: 5877 atctcgcgcacttggcgtcgtggcatcataaaaggttcaagagggcgatcatggaatggg 5936

                                                  
Query: 490  tgctcgccttcagcaaatatcctcagcttacgatccct 527
            |||||   | ||| |||||||||||| |||||||||||
Sbjct: 5937 tgctcatttccagaaaatatcctcagtttacgatccct 5974



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score =  147 bits (74), Expect = 5e-32
 Identities = 104/114 (91%)
 Strand = Plus / Plus

                                                                           
Query: 530     catcacgcaatttattgcggggaagcatgcgcatgacagctttacggatcacttcagttg 589
               ||||||||||| ||||||| ||||||||||||||||||||||| || ||  |||||||||
Sbjct: 8599412 catcacgcaatctattgcgaggaagcatgcgcatgacagctttgcgaattgcttcagttg 8599471

                                                                     
Query: 590     ggtcttttgccatctggtccttgagctttctttccttcagatggccaatatacc 643
               |||||||| ||||||||||||||||  |||||||||||| ||||||||||||||
Sbjct: 8599472 ggtctttttccatctggtccttgagtcttctttccttcaaatggccaatatacc 8599525



 Score =  133 bits (67), Expect = 8e-28
 Identities = 100/111 (90%)
 Strand = Plus / Plus

                                                                           
Query: 530     catcacgcaatttattgcggggaagcatgcgcatgacagctttacggatcacttcagttg 589
               ||||||||||| ||||||| ||||||||||||||||||||||| || || ||||||||||
Sbjct: 8589917 catcacgcaatctattgcgaggaagcatgcgcatgacagctttgcgaattacttcagttg 8589976

                                                                  
Query: 590     ggtcttttgccatctggtccttgagctttctttccttcagatggccaatat 640
               |||||||| |||| |||||||||||  ||| |||||||| |||||||||||
Sbjct: 8589977 ggtctttttccatgtggtccttgagtcttcattccttcaaatggccaatat 8590027



 Score =  123 bits (62), Expect = 8e-25
 Identities = 134/158 (84%)
 Strand = Plus / Plus

                                                                           
Query: 370     gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
               ||||| |||||||| ||||||||||| ||||||| ||  ||||||||||||||||| |||
Sbjct: 8591717 gctgctctgtcctgctctttcttctgcgcccttaacaatgcacgtcttgcccggggacgc 8591776

                                                                           
Query: 430     atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
               |||||  ||||||||||||| ||||| || ||||| || ||||| || || |||||||||
Sbjct: 8591777 atctcctgcacttggcgtggtggcatcacaaaaggttcaagagggcgatcatggaatggg 8591836

                                                     
Query: 490     tgctcgccttcagcaaatatcctcagcttacgatccct 527
               |||||   | ||| |||||||||||  |||||||||||
Sbjct: 8591837 tgctcatttccagaaaatatcctcaatttacgatccct 8591874



 Score =  115 bits (58), Expect = 2e-22
 Identities = 133/158 (84%)
 Strand = Plus / Plus

                                                                           
Query: 370     gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
               ||||| |||||||| ||||||||||| ||||||| ||  || |||||||||||||| |||
Sbjct: 8597394 gctgctctgtcctgctctttcttctgcgcccttaacagtgcgcgtcttgcccggggacgc 8597453

                                                                           
Query: 430     atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
               ||||| |||||||||||| | ||||| |  ||||| || ||||| || || |||||||||
Sbjct: 8597454 atctcgcgcacttggcgtcgtggcatcataaaaggttcaagagggcgatcatggaatggg 8597513

                                                     
Query: 490     tgctcgccttcagcaaatatcctcagcttacgatccct 527
               |||||   | ||| |||||||||||| |||||||||||
Sbjct: 8597514 tgctcatttccagaaaatatcctcagtttacgatccct 8597551



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  139 bits (70), Expect = 1e-29
 Identities = 103/114 (90%)
 Strand = Plus / Minus

                                                                           
Query: 530     catcacgcaatttattgcggggaagcatgcgcatgacagctttacggatcacttcagttg 589
               ||||||||||| |||||||||||||||||||||| |||||||| || ||||| || ||||
Sbjct: 3630821 catcacgcaatctattgcggggaagcatgcgcatcacagctttgcgaatcacctcggttg 3630762

                                                                     
Query: 590     ggtcttttgccatctggtccttgagctttctttccttcagatggccaatatacc 643
               |||| ||| ||||||||||||||||  |||||||||||| ||||||||||||||
Sbjct: 3630761 ggtccttttccatctggtccttgagtcttctttccttcaaatggccaatatacc 3630708



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 131/161 (81%)
 Strand = Plus / Minus

                                                                           
Query: 370     gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
               ||||| |||||||| ||||||||||| ||||| || |  || ||||||||| ||||||||
Sbjct: 3631624 gctgctctgtcctgctctttcttctgcgccctaataagtgcccgtcttgcctgggggcgc 3631565

                                                                           
Query: 430     atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
               ||||| ||||| || || || |||||  | ||||| || ||||| || || ||||| || 
Sbjct: 3631564 atctcgcgcacctgacgcggtggcatcgcaaaaggttcaagagggcgatcatggaaggga 3631505

                                                        
Query: 490     tgctcgccttcagcaaatatcctcagcttacgatccctatc 530
               ||||| | | ||| |||||||||||| || |||||||||||
Sbjct: 3631504 tgctcacttccagaaaatatcctcagtttgcgatccctatc 3631464



to top

>dbj|AP005504.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0577B11
          Length = 180355

 Score =  139 bits (70), Expect = 1e-29
 Identities = 103/114 (90%)
 Strand = Plus / Minus

                                                                          
Query: 530    catcacgcaatttattgcggggaagcatgcgcatgacagctttacggatcacttcagttg 589
              ||||||||||| |||||||||||||||||||||| |||||||| || ||||| || ||||
Sbjct: 109327 catcacgcaatctattgcggggaagcatgcgcatcacagctttgcgaatcacctcggttg 109268

                                                                    
Query: 590    ggtcttttgccatctggtccttgagctttctttccttcagatggccaatatacc 643
              |||| ||| ||||||||||||||||  |||||||||||| ||||||||||||||
Sbjct: 109267 ggtccttttccatctggtccttgagtcttctttccttcaaatggccaatatacc 109214



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 131/161 (81%)
 Strand = Plus / Minus

                                                                          
Query: 370    gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
              ||||| |||||||| ||||||||||| ||||| || |  || ||||||||| ||||||||
Sbjct: 110130 gctgctctgtcctgctctttcttctgcgccctaataagtgcccgtcttgcctgggggcgc 110071

                                                                          
Query: 430    atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
              ||||| ||||| || || || |||||  | ||||| || ||||| || || ||||| || 
Sbjct: 110070 atctcgcgcacctgacgcggtggcatcgcaaaaggttcaagagggcgatcatggaaggga 110011

                                                       
Query: 490    tgctcgccttcagcaaatatcctcagcttacgatccctatc 530
              ||||| | | ||| |||||||||||| || |||||||||||
Sbjct: 110010 tgctcacttccagaaaatatcctcagtttgcgatccctatc 109970



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  131 bits (66), Expect = 3e-27
 Identities = 135/158 (85%)
 Strand = Plus / Minus

                                                                            
Query: 370      gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
                ||||| |||||||| ||||||||||| ||||||||||   |||||||||||||||| |||
Sbjct: 38993198 gctgctctgtcctgctctttcttctgcgcccttatcagtacacgtcttgcccggggacgc 38993139

                                                                            
Query: 430      atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
                |||||||||||||||||||| ||||| || ||||| || ||||| || || |||||||| 
Sbjct: 38993138 atctcacgcacttggcgtggtggcatcacaaaaggttcaagagggcgatcatggaatgga 38993079

                                                      
Query: 490      tgctcgccttcagcaaatatcctcagcttacgatccct 527
                |||||   | ||| |||||||||||| || ||||||||
Sbjct: 38993078 tgctcatttccagaaaatatcctcagtttgcgatccct 38993041



to top

>dbj|AP003349.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0674H09
          Length = 142955

 Score =  131 bits (66), Expect = 3e-27
 Identities = 135/158 (85%)
 Strand = Plus / Minus

                                                                         
Query: 370   gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
             ||||| |||||||| ||||||||||| ||||||||||   |||||||||||||||| |||
Sbjct: 66831 gctgctctgtcctgctctttcttctgcgcccttatcagtacacgtcttgcccggggacgc 66772

                                                                         
Query: 430   atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
             |||||||||||||||||||| ||||| || ||||| || ||||| || || |||||||| 
Sbjct: 66771 atctcacgcacttggcgtggtggcatcacaaaaggttcaagagggcgatcatggaatgga 66712

                                                   
Query: 490   tgctcgccttcagcaaatatcctcagcttacgatccct 527
             |||||   | ||| |||||||||||| || ||||||||
Sbjct: 66711 tgctcatttccagaaaatatcctcagtttgcgatccct 66674



to top

>dbj|AP003418.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0506A10
          Length = 145265

 Score =  131 bits (66), Expect = 3e-27
 Identities = 135/158 (85%)
 Strand = Plus / Minus

                                                                         
Query: 370   gctgccctgtcctgatctttcttctgtgcccttatcatcgcacgtcttgcccgggggcgc 429
             ||||| |||||||| ||||||||||| ||||||||||   |||||||||||||||| |||
Sbjct: 11178 gctgctctgtcctgctctttcttctgcgcccttatcagtacacgtcttgcccggggacgc 11119

                                                                         
Query: 430   atctcacgcacttggcgtggcggcatgacgaaaggctcgagaggccggtcgtggaatggg 489
             |||||||||||||||||||| ||||| || ||||| || ||||| || || |||||||| 
Sbjct: 11118 atctcacgcacttggcgtggtggcatcacaaaaggttcaagagggcgatcatggaatgga 11059

                                                   
Query: 490   tgctcgccttcagcaaatatcctcagcttacgatccct 527
             |||||   | ||| |||||||||||| || ||||||||
Sbjct: 11058 tgctcatttccagaaaatatcctcagtttgcgatccct 11021



to top

>ref|NM_111045.3| Arabidopsis thaliana structural constituent of ribosome AT3G01790
           transcript variant AT3G01790.1 mRNA, complete cds
          Length = 881

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 503 caaatatcctcagcttacgatccctatcatcacgcaatttattgcggggaagcatgcgca 562
           |||||||||||||||| |||||||| ||||||||||| || || |  |||||||||||| 
Sbjct: 522 caaatatcctcagcttccgatccctgtcatcacgcaaattgttacttggaagcatgcgcc 463

                                                      
Query: 563 tgacagctttacggatcacttcagttgggtcttttgccatctg 605
            |||||| ||||| || || || || || ||||| ||||||||
Sbjct: 462 agacagccttacgaatgacctctgtgggatctttggccatctg 420



to top

>ref|NM_180163.2| Arabidopsis thaliana structural constituent of ribosome AT3G01790
           transcript variant AT3G01790.2 mRNA, complete cds
          Length = 849

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 503 caaatatcctcagcttacgatccctatcatcacgcaatttattgcggggaagcatgcgca 562
           |||||||||||||||| |||||||| ||||||||||| || || |  |||||||||||| 
Sbjct: 468 caaatatcctcagcttccgatccctgtcatcacgcaaattgttacttggaagcatgcgcc 409

                                                      
Query: 563 tgacagctttacggatcacttcagttgggtcttttgccatctg 605
            |||||| ||||| || || || || || ||||| ||||||||
Sbjct: 408 agacagccttacgaatgacctctgtgggatctttggccatctg 366



to top

>gb|BT010192.1| Arabidopsis thaliana At1g01640 gene, complete cds
          Length = 618

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 503 caaatatcctcagcttacgatccctatcatcacgcaatttattgcggggaagcatgcgca 562
           |||||||||||||||| |||||||| ||||||||||| || || |  |||||||||||| 
Sbjct: 427 caaatatcctcagcttccgatccctgtcatcacgcaaattgttacttggaagcatgcgcc 368

                                                      
Query: 563 tgacagctttacggatcacttcagttgggtcttttgccatctg 605
            |||||| ||||| || || || || || ||||| ||||||||
Sbjct: 367 agacagccttacgaatgacctctgtgggatctttggccatctg 325



to top

>emb|BX822660.1|CNS0A7H4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB57ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 671

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 503 caaatatcctcagcttacgatccctatcatcacgcaatttattgcggggaagcatgcgca 562
           |||||||||||||||| |||||||| ||||||||||| || || |  |||||||||||| 
Sbjct: 309 caaatatcctcagcttccgatccctgtcatcacgcaaattgttacttggaagcatgcgcc 250

                                                      
Query: 563 tgacagctttacggatcacttcagttgggtcttttgccatctg 605
            |||||| ||||| || || || || || ||||| ||||||||
Sbjct: 249 agacagccttacgaatgacctctgtgggatctttggccatctg 207



to top

>emb|BX822466.1|CNS0A7AA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB3ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 849

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 503 caaatatcctcagcttacgatccctatcatcacgcaatttattgcggggaagcatgcgca 562
           |||||||||||||||| |||||||| ||||||||||| || || |  |||||||||||| 
Sbjct: 467 caaatatcctcagcttccgatccctgtcatcacgcaaattgttacttggaagcatgcgcc 408

                                                      
Query: 563 tgacagctttacggatcacttcagttgggtcttttgccatctg 605
            |||||| ||||| || || || || || ||||| ||||||||
Sbjct: 407 agacagccttacgaatgacctctgtgggatctttggccatctg 365



to top

>emb|BX822472.1|CNS0A705 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB3ZE12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 850

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 503 caaatatcctcagcttacgatccctatcatcacgcaatttattgcggggaagcatgcgca 562
           |||||||||||||||| |||||||| ||||||||||| || || |  |||||||||||| 
Sbjct: 468 caaatatcctcagcttccgatccctgtcatcacgcaaattgttacttggaagcatgcgcc 409

                                                      
Query: 563 tgacagctttacggatcacttcagttgggtcttttgccatctg 605
            |||||| ||||| || || || || || ||||| ||||||||
Sbjct: 408 agacagccttacgaatgacctctgtgggatctttggccatctg 366



to top

>emb|BX824635.1|CNS0A4TG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZA11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 832

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 503 caaatatcctcagcttacgatccctatcatcacgcaatttattgcggggaagcatgcgca 562
           |||||||||||||||| |||||||| ||||||||||| || || |  |||||||||||| 
Sbjct: 470 caaatatcctcagcttccgatccctgtcatcacgcaaattgttacttggaagcatgcgcc 411

                                                      
Query: 563 tgacagctttacggatcacttcagttgggtcttttgccatctg 605
            |||||| ||||| || || || || || ||||| ||||||||
Sbjct: 410 agacagccttacgaatgacctctgtgggatctttggccatctg 368



to top

>gb|BT013176.1| Lycopersicon esculentum clone 134251R, mRNA sequence
          Length = 1043

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 520 cgatccctatcatcacgcaatttattgcggggaagcatgcgcatgacagctttacggatc 579
           ||||| |||||||||||||| ||||| |  || ||||| |||| ||||||||| || || 
Sbjct: 459 cgatctctatcatcacgcaacttatttcttggcagcattcgcaggacagctttgcgaata 400

                                        
Query: 580 acttcagttgggtcttttgccatctggtc 608
           ||||| ||||| || || |||||||||||
Sbjct: 399 acttctgttggatccttagccatctggtc 371



to top

>gb|AC130307.3| Homo sapiens chromosome 11, clone RP11-15D10, complete sequence
          Length = 159817

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 145   acaaagcttgataagattctag 166
             ||||||||||||||||||||||
Sbjct: 27103 acaaagcttgataagattctag 27082



to top

>emb|AL929414.5| Mouse DNA sequence from clone RP23-222A19 on chromosome 11, complete
             sequence
          Length = 153928

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 614   gctttctttccttcagatggccaata 639
             |||||| |||||||||||||||||||
Sbjct: 50634 gctttcattccttcagatggccaata 50659



to top

>gb|AC090858.6| Homo sapiens chromosome 11, clone RP11-676E14, complete sequence
          Length = 168906

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 145   acaaagcttgataagattctag 166
             ||||||||||||||||||||||
Sbjct: 58237 acaaagcttgataagattctag 58258



to top

>gb|AC153132.4| Mus musculus BAC clone RP24-362N19 from chromosome 13, complete sequence
          Length = 178970

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 594    ttttgccatctggtccttgagctttc 619
              ||||||||| ||||||||||||||||
Sbjct: 128236 ttttgccatttggtccttgagctttc 128261



to top

>gb|AF067776.1|AF067776 Abiotrophia defectiva extracellular matrix binding protein (emb)
            gene, partial cds
          Length = 6413

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 338  cattcttagctgcttctccctcggctttct 367
            ||||||||||||||||| ||| ||||||||
Sbjct: 2273 cattcttagctgcttctaccttggctttct 2244



to top

>gb|AC010797.4|ATAC010797 Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence,
             complete sequence
          Length = 89154

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 503   caaatatcctcagcttacgatccct 527
             |||||||||||||||| ||||||||
Sbjct: 28768 caaatatcctcagcttccgatccct 28792



to top

>dbj|AK009132.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
            library, clone:2310004B02 product:interleukin-1
            receptor-associated kinase 1, full insert sequence
          Length = 1205

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 379  tcctgatctttcttctgtgccctta 403
            ||||||||||| |||||||||||||
Sbjct: 1093 tcctgatctttattctgtgccctta 1117



to top

>ref|XM_640882.1| Dictyostelium discoideum hypothetical protein (DDB0190268), partial
           mRNA
          Length = 2772

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 209 tcaaagagaaaagagatacg 228
           ||||||||||||||||||||
Sbjct: 443 tcaaagagaaaagagatacg 462



to top

>ref|XM_657344.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4832.2), mRNA
          Length = 1356

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 477 gtcgtggaatgggtgctcgc 496
           ||||||||||||||||||||
Sbjct: 442 gtcgtggaatgggtgctcgc 423



to top

>emb|AL035555.11|HS217P22 Human DNA sequence from clone RP1-217P22 on chromosome 6p21.1-21.31
             Contains part of the DNAH8 gene for dynein axonemal heavy
             polypeptide 8 and a novel pseudogene similar to part of
             zuotin related factor-1 (ZRF1), complete sequence
          Length = 130796

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    gaaaggaaattcagaatgag 73
             ||||||||||||||||||||
Sbjct: 53746 gaaaggaaattcagaatgag 53765



to top

>ref|XM_967054.1| PREDICTED: Tribolium castaneum similar to hydroxyprostaglandin
            dehydrogenase 15 (NAD) (LOC660851), mRNA
          Length = 1440

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 617  ttctttccttcagatggcca 636
            ||||||||||||||||||||
Sbjct: 1415 ttctttccttcagatggcca 1396



to top

>emb|AJ235273.1|RPXX04 Rickettsia prowazekii strain Madrid E, complete genome; segment 4/4
          Length = 237523

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   tcatcaaagagaaaagagat 225
             ||||||||||||||||||||
Sbjct: 49528 tcatcaaagagaaaagagat 49547



to top

>emb|AJ131049.1|CAR131049 Cicer arietinum mRNA for hypothetical protein
          Length = 1230

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 349 gcttctccctcggctttctt 368
           ||||||||||||||||||||
Sbjct: 635 gcttctccctcggctttctt 616



to top

>emb|CR456624.7| Zebrafish DNA sequence from clone CH211-69E5 in linkage group 13,
            complete sequence
          Length = 172195

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 388  ttcttctgtgcccttatcat 407
            ||||||||||||||||||||
Sbjct: 3178 ttcttctgtgcccttatcat 3197



to top

>gb|AC007249.5| Homo sapiens BAC clone RP11-320M2 from 2, complete sequence
          Length = 200491

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 123    tctcagcaatcttgctgcct 142
              ||||||||||||||||||||
Sbjct: 146467 tctcagcaatcttgctgcct 146486



to top

>gb|AF224746.1|AF224746 Xenopus laevis bicaudal-C (Bic-C) mRNA, complete cds
          Length = 3300

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 114  caacaggcttctcagcaatc 133
            ||||||||||||||||||||
Sbjct: 1657 caacaggcttctcagcaatc 1676



to top

>emb|Z82598.1|RPZ82598 R.prowazekii genomic DNA fragment (clone A335R)
          Length = 509

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 206 tcatcaaagagaaaagagat 225
           ||||||||||||||||||||
Sbjct: 408 tcatcaaagagaaaagagat 389



to top

>emb|CR293523.11| Zebrafish DNA sequence from clone DKEY-104J7 in linkage group 7, complete
              sequence
          Length = 214581

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 187    caacacaaaagactacatgt 206
              ||||||||||||||||||||
Sbjct: 206658 caacacaaaagactacatgt 206639



to top

>emb|CR854857.19| Zebrafish DNA sequence from clone CH211-129F7 in linkage group 13,
              complete sequence
          Length = 170079

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 388    ttcttctgtgcccttatcat 407
              ||||||||||||||||||||
Sbjct: 139617 ttcttctgtgcccttatcat 139636



to top

>gb|AC106824.2| Homo sapiens chromosome 5 clone RP11-81H9, complete sequence
          Length = 127326

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 204   tgtcatcaaagagaaaagag 223
             ||||||||||||||||||||
Sbjct: 46849 tgtcatcaaagagaaaagag 46830


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,623,255
Number of Sequences: 3902068
Number of extensions: 5623255
Number of successful extensions: 108945
Number of sequences better than 10.0: 40
Number of HSP's better than 10.0 without gapping: 40
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108785
Number of HSP's gapped (non-prelim): 160
length of query: 661
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 638
effective length of database: 17,143,297,704
effective search space: 10937423935152
effective search space used: 10937423935152
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top