| Clone Name | rbags12d16 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_470257.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2151 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Minus Query: 482 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 2115 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2063
>gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence Length = 2441 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 494 tgctgtttgggccacctttgccgcgtagg 522 ||||| ||||||||||||||||||||||| Sbjct: 1961 tgctgcttgggccacctttgccgcgtagg 1933
>gb|BT016816.1| Zea mays clone Contig649 mRNA sequence Length = 1830 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 494 tgctgtttgggccacctttgccgcgtagg 522 ||||| ||||||||||||||||||||||| Sbjct: 1317 tgctgcttgggccacctttgccgcgtagg 1289
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Plus Query: 482 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 3108402 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108454
>gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1134F05, complete sequence Length = 101799 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Plus Query: 482 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 31415 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 31467
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Plus Query: 482 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 3108513 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108565
>dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-F09, full insert sequence Length = 2166 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Minus Query: 482 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 1763 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1711
>dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075E22, full insert sequence Length = 2862 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Minus Query: 482 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 2352 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2300
>dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A14, full insert sequence Length = 2762 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Minus Query: 482 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 2300 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2248
>dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128D05, full insert sequence Length = 1271 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Minus Query: 482 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 928 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 876
>dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-F04, full insert sequence Length = 1771 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Minus Query: 482 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 1264 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1212
>emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA6DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 595 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 472 ccgcaggcttcttctcggccgctgctg 498 |||| |||||||||||||||||||||| Sbjct: 381 ccgccggcttcttctcggccgctgctg 407
>emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 701 ggcttcttctcggccgctgctg 722
>emb|BX058217.1|CNS09H31 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 848 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 349 ggcttcttctcggccgctgctg 370
>emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 366 ggcttcttctcggccgctgctg 387
>emb|BX050629.1|CNS09B89 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27AH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 491 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 343 ggcttcttctcggccgctgctg 364
>emb|BX048891.1|CNS099VZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC24BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 582 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 352 ggcttcttctcggccgctgctg 373
>emb|BX048575.1|CNS099N7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 692 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 692 ggcttcttctcggccgctgctg 671
>emb|BX047759.1|CNS0990J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC22BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 333 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 154 ggcttcttctcggccgctgctg 175
>emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC22BE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 888 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 354 ggcttcttctcggccgctgctg 375
>emb|BX039669.1|CNS092RT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10AC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 765 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 377 ggcttcttctcggccgctgctg 398
>emb|BX037240.1|CNS090WC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9CE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 759 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 377 ggcttcttctcggccgctgctg 398
>emb|BX036580.1|CNS090E0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA8CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 541 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 199 ggcttcttctcggccgctgctg 220
>emb|BX036124.1|CNS0901C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 816 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 367 ggcttcttctcggccgctgctg 388
>emb|BX029509.1|CNS08UXL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44AD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 356 ggcttcttctcggccgctgctg 377
>emb|BX028945.1|CNS08UHX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA43BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 469 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 368 ggcttcttctcggccgctgctg 389
>emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42AB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 459 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 361 ggcttcttctcggccgctgctg 382
>emb|BX027649.1|CNS08THX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 289 ggcttcttctcggccgctgctg 310
>emb|BX027278.1|CNS08T7M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA40DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 361 ggcttcttctcggccgctgctg 382
>emb|BX026134.1|CNS08SBU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA4BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 281 ggcttcttctcggccgctgctg 302
>emb|BX020909.1|CNS08OAP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA30DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 711 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 332 ggcttcttctcggccgctgctg 353
>emb|BX019905.1|CNS08NIT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA3BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1030 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 370 ggcttcttctcggccgctgctg 391
>emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA25CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 574 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 353 ggcttcttctcggccgctgctg 374
>emb|BX016863.1|CNS08L6B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA25BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 657 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 304 ggcttcttctcggccgctgctg 325
>emb|BX010707.1|CNS08GFB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA17AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 749 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 350 ggcttcttctcggccgctgctg 371
>emb|BX010159.1|CNS08G03 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 524 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 369 ggcttcttctcggccgctgctg 390
>emb|BX010158.1|CNS08G02 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 731 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 669 ggcttcttctcggccgctgctg 648
>emb|BX009177.1|CNS08F8T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA14DG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 368 ggcttcttctcggccgctgctg 389
>emb|BX007586.1|CNS08E0M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA12CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 505 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgctg 498 |||||||||||||||||||||| Sbjct: 362 ggcttcttctcggccgctgctg 383
>gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, complete sequence Length = 2129 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 494 tgctgtttgggccacctttgc 514 ||||||||||||||||||||| Sbjct: 1655 tgctgtttgggccacctttgc 1635
>ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diphosphate farnesyltransferase (Squalene synthetase) (SQS) (SS) (FPP:FPP farnesyltransferase) (LOC571911), partial mRNA Length = 752 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 529 ctggaggaccagcagcagggg 549 ||||||||||||||||||||| Sbjct: 292 ctggaggaccagcagcagggg 312
>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III, complete sequence Length = 907057 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 526 cggctggaggaccagcagcag 546 ||||||||||||||||||||| Sbjct: 616609 cggctggaggaccagcagcag 616629
>ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA Length = 2649 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 526 cggctggaggaccagcagcag 546 ||||||||||||||||||||| Sbjct: 265 cggctggaggaccagcagcag 285
>gb|AY430810.1| Neodiprion sertifer nucleopolyhdrovirus, complete genome Length = 86462 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 367 cattacgtttgttcctcatg 386 |||||||||||||||||||| Sbjct: 10531 cattacgtttgttcctcatg 10550
>gb|AC147259.3| Mus musculus BAC clone RP24-178N16 from chromosome Y, complete sequence Length = 149994 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 254 acaagagaaaaaggaggagc 273 |||||||||||||||||||| Sbjct: 104706 acaagagaaaaaggaggagc 104725
>gb|AC124704.4| Mus musculus BAC clone RP23-480H24 from chromosome 6, complete sequence Length = 185099 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 383 catggctagctgggaggatc 402 |||||||||||||||||||| Sbjct: 129909 catggctagctgggaggatc 129928
>emb|Z93397.1|CEZC482 Caenorhabditis elegans Cosmid ZC482, complete sequence Length = 36302 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 154 tttccttttctctttttctg 173 |||||||||||||||||||| Sbjct: 35437 tttccttttctctttttctg 35418
>gb|AC074193.6| Homo sapiens BAC clone RP11-611P20 from 7, complete sequence Length = 44380 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 aaacagggatgatgatagta 245 |||||||||||||||||||| Sbjct: 33833 aaacagggatgatgatagta 33814
>gb|AC079809.4| Homo sapiens BAC clone RP11-958M14 from 7, complete sequence Length = 102918 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 255 caagagaaaaaggaggagctaggggaac 282 ||||| |||||||||||| ||||||||| Sbjct: 100575 caagaaaaaaaggaggaggtaggggaac 100548
>emb|AL139241.11| Human DNA sequence from clone RP11-34A14 on chromosome 10 Contains the 3' end of gene FLJ37160, the LOXL4 gene for lysyl oxidase-like 4, a novel gene and a CpG island, complete sequence Length = 188192 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 154 tttccttttctctttttctg 173 |||||||||||||||||||| Sbjct: 19096 tttccttttctctttttctg 19077
>emb|AL049176.3|HS141H5 Human DNA sequence from clone RP6-141H5 on chromosome Xq22.1-23 Contains the 3' end of the gene for a likely ortholog of mouse neuralin 1 (NRLN1), complete sequence Length = 121600 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 tgtcttgccacaggtttcct 159 |||||||||||||||||||| Sbjct: 42276 tgtcttgccacaggtttcct 42257
>emb|AL035461.11|HS967N21 Human DNA sequence from clone RP5-967N21 on chromosome 20p12.3-13 Contains the CHGB gene for chromogranin B (secretogranin 1), a novel pseudogene, the gene for CGI-09 protein (CGI-09), the C20orf154 gene for a novel MCM2/3/5 family member, a pseudogene similar to part of cytochrome c oxidase I, the C20orf155 gene for a novel CDP-alcohol phosphatidyltransferase family member, the 3' end of a novel gene and four CpG islands, complete sequence Length = 139352 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 aggtttccttttctcttttt 170 |||||||||||||||||||| Sbjct: 102619 aggtttccttttctcttttt 102600
>emb|BX013132.1|CNS08IAO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 ggcttcttctcggccgctgc 496 |||||||||||||||||||| Sbjct: 377 ggcttcttctcggccgctgc 396
>gb|AC114877.2| Homo sapiens chromosome 3 clone CTD-2270K17, complete sequence Length = 179246 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 aaacagggatgatgatagta 245 |||||||||||||||||||| Sbjct: 164637 aaacagggatgatgatagta 164656
>gb|AC011355.6| Homo sapiens chromosome 5 clone CTC-354H18, complete sequence Length = 114276 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 gtttccttttctctttttct 172 |||||||||||||||||||| Sbjct: 52890 gtttccttttctctttttct 52871
>gb|AC096949.2| Homo sapiens chromosome 1 clone RP4-581O6, complete sequence Length = 106449 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 154 tttccttttctctttttctg 173 |||||||||||||||||||| Sbjct: 94582 tttccttttctctttttctg 94563
>gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome y, complete sequence Length = 155247 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 254 acaagagaaaaaggaggagc 273 |||||||||||||||||||| Sbjct: 6323 acaagagaaaaaggaggagc 6342
>gb|AC103922.2| Homo sapiens chromosome 3 clone RP11-226E22, complete sequence Length = 164479 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 aaacagggatgatgatagta 245 |||||||||||||||||||| Sbjct: 115439 aaacagggatgatgatagta 115420
>gb|AC126425.2| Lemur catta, clone -162D1, complete sequence Length = 154718 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 154 tttccttttctctttttctg 173 |||||||||||||||||||| Sbjct: 27273 tttccttttctctttttctg 27254
>gb|AC131599.2| Lemur catta, clone -206F2, complete sequence Length = 155606 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 154 tttccttttctctttttctg 173 |||||||||||||||||||| Sbjct: 90464 tttccttttctctttttctg 90483
>gb|AC093628.3| Homo sapiens BAC clone RP11-98N20 from 4, complete sequence Length = 159991 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 257 agagaaaaaggaggagctag 276 |||||||||||||||||||| Sbjct: 124092 agagaaaaaggaggagctag 124073
>gb|AC102491.19| Mus musculus chromosome 1, clone RP24-529L13, complete sequence Length = 190728 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 gtttccttttctctttttct 172 |||||||||||||||||||| Sbjct: 22737 gtttccttttctctttttct 22718
>gb|AC151581.2| Pan troglodytes BAC clone RP43-166C19 from chromosome 7, complete sequence Length = 180623 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 255 caagagaaaaaggaggagctaggggaac 282 ||||| |||||||||||| ||||||||| Sbjct: 140763 caagaaaaaaaggaggaggtaggggaac 140790
>gb|AC138070.3| Homo sapiens chromosome 3 clone RP11-263E3, complete sequence Length = 169834 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 aaacagggatgatgatagta 245 |||||||||||||||||||| Sbjct: 17593 aaacagggatgatgatagta 17612
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 456 ggcttcttctcggtcaccgc 475 |||||||||||||||||||| Sbjct: 1176320 ggcttcttctcggtcaccgc 1176339
>emb|AL121769.4|CNS01DSD Human chromosome 14 DNA sequence BAC R-299L17 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 167344 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 253 aacaagagaaaaaggaggag 272 |||||||||||||||||||| Sbjct: 65335 aacaagagaaaaaggaggag 65354
>dbj|AP002987.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-428C14, complete sequence Length = 166893 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 150 caggtttccttttctctttt 169 |||||||||||||||||||| Sbjct: 74125 caggtttccttttctctttt 74144
>dbj|AP002456.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-956A8, complete sequence Length = 114109 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 207 tttagagctaagcaaactga 226 |||||||||||||||||||| Sbjct: 94632 tttagagctaagcaaactga 94651
>dbj|AP001929.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-640N11, complete sequence Length = 161547 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 207 tttagagctaagcaaactga 226 |||||||||||||||||||| Sbjct: 31460 tttagagctaagcaaactga 31479
>gb|AC004063.1|AC004063 Homo sapiens chromosome 4 clone B32I8, complete sequence Length = 177014 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 257 agagaaaaaggaggagctag 276 |||||||||||||||||||| Sbjct: 59532 agagaaaaaggaggagctag 59513
>dbj|AP001862.2| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:2060O22, complete sequence Length = 111557 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 257 agagaaaaaggaggagctag 276 |||||||||||||||||||| Sbjct: 78153 agagaaaaaggaggagctag 78134 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,131,988 Number of Sequences: 3902068 Number of extensions: 4131988 Number of successful extensions: 92342 Number of sequences better than 10.0: 71 Number of HSP's better than 10.0 without gapping: 71 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 92102 Number of HSP's gapped (non-prelim): 240 length of query: 553 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 530 effective length of database: 17,143,297,704 effective search space: 9085947783120 effective search space used: 9085947783120 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)