ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags12d16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_470257.1| Oryza sativa (japonica cultivar-group), predic... 50 0.008
2gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence 50 0.008
3gb|BT016816.1| Zea mays clone Contig649 mRNA sequence 50 0.008
4gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 50 0.008
5gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.008
6dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.008
7dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.008
8dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.008
9dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.008
10dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.008
11dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.008
12emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-... 46 0.12
13emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-... 44 0.48
14emb|BX058217.1|CNS09H31 Single read from an extremity of a full-... 44 0.48
15emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-... 44 0.48
16emb|BX050629.1|CNS09B89 Single read from an extremity of a full-... 44 0.48
17emb|BX048891.1|CNS099VZ Single read from an extremity of a full-... 44 0.48
18emb|BX048575.1|CNS099N7 Single read from an extremity of a full-... 44 0.48
19emb|BX047759.1|CNS0990J Single read from an extremity of a full-... 44 0.48
20emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-... 44 0.48
21emb|BX039669.1|CNS092RT Single read from an extremity of a full-... 44 0.48
22emb|BX037240.1|CNS090WC Single read from an extremity of a full-... 44 0.48
23emb|BX036580.1|CNS090E0 Single read from an extremity of a full-... 44 0.48
24emb|BX036124.1|CNS0901C Single read from an extremity of a full-... 44 0.48
25emb|BX029509.1|CNS08UXL Single read from an extremity of a full-... 44 0.48
26emb|BX028945.1|CNS08UHX Single read from an extremity of a full-... 44 0.48
27emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-... 44 0.48
28emb|BX027649.1|CNS08THX Single read from an extremity of a full-... 44 0.48
29emb|BX027278.1|CNS08T7M Single read from an extremity of a full-... 44 0.48
30emb|BX026134.1|CNS08SBU Single read from an extremity of a full-... 44 0.48
31emb|BX020909.1|CNS08OAP Single read from an extremity of a full-... 44 0.48
32emb|BX019905.1|CNS08NIT Single read from an extremity of a full-... 44 0.48
33emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-... 44 0.48
34emb|BX016863.1|CNS08L6B Single read from an extremity of a full-... 44 0.48
35emb|BX010707.1|CNS08GFB Single read from an extremity of a full-... 44 0.48
36emb|BX010159.1|CNS08G03 Single read from an extremity of a full-... 44 0.48
37emb|BX010158.1|CNS08G02 Single read from an extremity of a full-... 44 0.48
38emb|BX009177.1|CNS08F8T Single read from an extremity of a full-... 44 0.48
39emb|BX007586.1|CNS08E0M Single read from an extremity of a full-... 44 0.48
40gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, comple... 42 1.9
41ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diph... 42 1.9
42gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 1.9
43ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA 42 1.9
44gb|AY430810.1| Neodiprion sertifer nucleopolyhdrovirus, complete... 40 7.5
45gb|AC147259.3| Mus musculus BAC clone RP24-178N16 from chromosom... 40 7.5
46gb|AC124704.4| Mus musculus BAC clone RP23-480H24 from chromosom... 40 7.5
47emb|Z93397.1|CEZC482 Caenorhabditis elegans Cosmid ZC482, comple... 40 7.5
48gb|AC074193.6| Homo sapiens BAC clone RP11-611P20 from 7, comple... 40 7.5
49gb|AC079809.4| Homo sapiens BAC clone RP11-958M14 from 7, comple... 40 7.5
50emb|AL139241.11| Human DNA sequence from clone RP11-34A14 on chr... 40 7.5
51emb|AL049176.3|HS141H5 Human DNA sequence from clone RP6-141H5 o... 40 7.5
52emb|AL035461.11|HS967N21 Human DNA sequence from clone RP5-967N2... 40 7.5
53emb|BX013132.1|CNS08IAO Single read from an extremity of a full-... 40 7.5
54gb|AC114877.2| Homo sapiens chromosome 3 clone CTD-2270K17, comp... 40 7.5
55gb|AC011355.6| Homo sapiens chromosome 5 clone CTC-354H18, compl... 40 7.5
56gb|AC096949.2| Homo sapiens chromosome 1 clone RP4-581O6, comple... 40 7.5
57gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome... 40 7.5
58gb|AC103922.2| Homo sapiens chromosome 3 clone RP11-226E22, comp... 40 7.5
59gb|AC126425.2| Lemur catta, clone -162D1, complete sequence 40 7.5
60gb|AC131599.2| Lemur catta, clone -206F2, complete sequence 40 7.5
61gb|AC093628.3| Homo sapiens BAC clone RP11-98N20 from 4, complet... 40 7.5
62gb|AC102491.19| Mus musculus chromosome 1, clone RP24-529L13, co... 40 7.5
63gb|AC151581.2| Pan troglodytes BAC clone RP43-166C19 from chromo... 40 7.5
64gb|AC138070.3| Homo sapiens chromosome 3 clone RP11-263E3, compl... 40 7.5
65dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 7.5
66emb|AL121769.4|CNS01DSD Human chromosome 14 DNA sequence BAC R-2... 40 7.5
67dbj|AP002987.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 7.5
68dbj|AP002456.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 7.5
69dbj|AP001929.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 7.5
70gb|AC004063.1|AC004063 Homo sapiens chromosome 4 clone B32I8, co... 40 7.5
71dbj|AP001862.2| Homo sapiens genomic DNA, chromosome 4q22-q24, c... 40 7.5 
>ref|XM_470257.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2151

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 482  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2115 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2063
to top
>gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence
          Length = 2441

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 494  tgctgtttgggccacctttgccgcgtagg 522
            ||||| |||||||||||||||||||||||
Sbjct: 1961 tgctgcttgggccacctttgccgcgtagg 1933
to top
>gb|BT016816.1| Zea mays clone Contig649 mRNA sequence
          Length = 1830

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 494  tgctgtttgggccacctttgccgcgtagg 522
            ||||| |||||||||||||||||||||||
Sbjct: 1317 tgctgcttgggccacctttgccgcgtagg 1289
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                    
Query: 482     cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534
               |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 3108402 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108454
to top
>gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1134F05,
             complete sequence
          Length = 101799

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 482   cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534
             |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 31415 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 31467
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                    
Query: 482     cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534
               |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 3108513 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108565
to top
>dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-F09, full
            insert sequence
          Length = 2166

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 482  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 1763 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1711
to top
>dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075E22, full
            insert sequence
          Length = 2862

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 482  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2352 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2300
to top
>dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A14, full
            insert sequence
          Length = 2762

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 482  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2300 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2248
to top
>dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128D05, full
           insert sequence
          Length = 1271

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 482 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534
           |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 928 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 876
to top
>dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-F04, full
            insert sequence
          Length = 1771

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 482  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 534
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 1264 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1212
to top
>emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 472 ccgcaggcttcttctcggccgctgctg 498
           |||| ||||||||||||||||||||||
Sbjct: 381 ccgccggcttcttctcggccgctgctg 407
to top
>emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 701 ggcttcttctcggccgctgctg 722
to top
>emb|BX058217.1|CNS09H31 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 349 ggcttcttctcggccgctgctg 370
to top
>emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 366 ggcttcttctcggccgctgctg 387
to top
>emb|BX050629.1|CNS09B89 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 491

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 343 ggcttcttctcggccgctgctg 364
to top
>emb|BX048891.1|CNS099VZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 352 ggcttcttctcggccgctgctg 373
to top
>emb|BX048575.1|CNS099N7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 692 ggcttcttctcggccgctgctg 671
to top
>emb|BX047759.1|CNS0990J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 333

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 154 ggcttcttctcggccgctgctg 175
to top
>emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 354 ggcttcttctcggccgctgctg 375
to top
>emb|BX039669.1|CNS092RT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgctg 398
to top
>emb|BX037240.1|CNS090WC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgctg 398
to top
>emb|BX036580.1|CNS090E0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 199 ggcttcttctcggccgctgctg 220
to top
>emb|BX036124.1|CNS0901C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 367 ggcttcttctcggccgctgctg 388
to top
>emb|BX029509.1|CNS08UXL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 356 ggcttcttctcggccgctgctg 377
to top
>emb|BX028945.1|CNS08UHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 368 ggcttcttctcggccgctgctg 389
to top
>emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 459

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 361 ggcttcttctcggccgctgctg 382
to top
>emb|BX027649.1|CNS08THX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 289 ggcttcttctcggccgctgctg 310
to top
>emb|BX027278.1|CNS08T7M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 361 ggcttcttctcggccgctgctg 382
to top
>emb|BX026134.1|CNS08SBU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 281 ggcttcttctcggccgctgctg 302
to top
>emb|BX020909.1|CNS08OAP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 332 ggcttcttctcggccgctgctg 353
to top
>emb|BX019905.1|CNS08NIT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1030

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 370 ggcttcttctcggccgctgctg 391
to top
>emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 574

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 353 ggcttcttctcggccgctgctg 374
to top
>emb|BX016863.1|CNS08L6B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 657

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 304 ggcttcttctcggccgctgctg 325
to top
>emb|BX010707.1|CNS08GFB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 350 ggcttcttctcggccgctgctg 371
to top
>emb|BX010159.1|CNS08G03 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 524

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 369 ggcttcttctcggccgctgctg 390
to top
>emb|BX010158.1|CNS08G02 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 669 ggcttcttctcggccgctgctg 648
to top
>emb|BX009177.1|CNS08F8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 368 ggcttcttctcggccgctgctg 389
to top
>emb|BX007586.1|CNS08E0M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 505

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 477 ggcttcttctcggccgctgctg 498
           ||||||||||||||||||||||
Sbjct: 362 ggcttcttctcggccgctgctg 383
to top
>gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, complete sequence
          Length = 2129

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 494  tgctgtttgggccacctttgc 514
            |||||||||||||||||||||
Sbjct: 1655 tgctgtttgggccacctttgc 1635
to top
>ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diphosphate
           farnesyltransferase (Squalene synthetase) (SQS) (SS)
           (FPP:FPP farnesyltransferase) (LOC571911), partial mRNA
          Length = 752

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 529 ctggaggaccagcagcagggg 549
           |||||||||||||||||||||
Sbjct: 292 ctggaggaccagcagcagggg 312
to top
>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 526    cggctggaggaccagcagcag 546
              |||||||||||||||||||||
Sbjct: 616609 cggctggaggaccagcagcag 616629
to top
>ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA
          Length = 2649

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 526 cggctggaggaccagcagcag 546
           |||||||||||||||||||||
Sbjct: 265 cggctggaggaccagcagcag 285
to top
>gb|AY430810.1| Neodiprion sertifer nucleopolyhdrovirus, complete genome
          Length = 86462

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 367   cattacgtttgttcctcatg 386
             ||||||||||||||||||||
Sbjct: 10531 cattacgtttgttcctcatg 10550
to top
>gb|AC147259.3| Mus musculus BAC clone RP24-178N16 from chromosome Y, complete sequence
          Length = 149994

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    acaagagaaaaaggaggagc 273
              ||||||||||||||||||||
Sbjct: 104706 acaagagaaaaaggaggagc 104725
to top
>gb|AC124704.4| Mus musculus BAC clone RP23-480H24 from chromosome 6, complete sequence
          Length = 185099

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 383    catggctagctgggaggatc 402
              ||||||||||||||||||||
Sbjct: 129909 catggctagctgggaggatc 129928
to top
>emb|Z93397.1|CEZC482 Caenorhabditis elegans Cosmid ZC482, complete sequence
          Length = 36302

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 154   tttccttttctctttttctg 173
             ||||||||||||||||||||
Sbjct: 35437 tttccttttctctttttctg 35418
to top
>gb|AC074193.6| Homo sapiens BAC clone RP11-611P20 from 7, complete sequence
          Length = 44380

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 226   aaacagggatgatgatagta 245
             ||||||||||||||||||||
Sbjct: 33833 aaacagggatgatgatagta 33814
to top
>gb|AC079809.4| Homo sapiens BAC clone RP11-958M14 from 7, complete sequence
          Length = 102918

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 255    caagagaaaaaggaggagctaggggaac 282
              ||||| |||||||||||| |||||||||
Sbjct: 100575 caagaaaaaaaggaggaggtaggggaac 100548
to top
>emb|AL139241.11| Human DNA sequence from clone RP11-34A14 on chromosome 10 Contains the
             3' end of gene FLJ37160, the LOXL4 gene for lysyl
             oxidase-like 4, a novel gene and a CpG island, complete
             sequence
          Length = 188192

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 154   tttccttttctctttttctg 173
             ||||||||||||||||||||
Sbjct: 19096 tttccttttctctttttctg 19077
to top
>emb|AL049176.3|HS141H5 Human DNA sequence from clone RP6-141H5 on chromosome Xq22.1-23
             Contains the 3' end of the gene for a likely ortholog of
             mouse neuralin 1 (NRLN1), complete sequence
          Length = 121600

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 140   tgtcttgccacaggtttcct 159
             ||||||||||||||||||||
Sbjct: 42276 tgtcttgccacaggtttcct 42257
to top
>emb|AL035461.11|HS967N21 Human DNA sequence from clone RP5-967N21 on chromosome 20p12.3-13
              Contains the CHGB gene for chromogranin B (secretogranin
              1), a novel pseudogene, the gene for CGI-09 protein
              (CGI-09), the C20orf154 gene for a novel MCM2/3/5 family
              member, a pseudogene similar to part of cytochrome c
              oxidase I, the C20orf155 gene for a novel CDP-alcohol
              phosphatidyltransferase family member, the 3' end of a
              novel gene and four CpG islands, complete sequence
          Length = 139352

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 151    aggtttccttttctcttttt 170
              ||||||||||||||||||||
Sbjct: 102619 aggtttccttttctcttttt 102600
to top
>emb|BX013132.1|CNS08IAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 477 ggcttcttctcggccgctgc 496
           ||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgc 396
to top
>gb|AC114877.2| Homo sapiens chromosome 3 clone CTD-2270K17, complete sequence
          Length = 179246

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 226    aaacagggatgatgatagta 245
              ||||||||||||||||||||
Sbjct: 164637 aaacagggatgatgatagta 164656
to top
>gb|AC011355.6| Homo sapiens chromosome 5 clone CTC-354H18, complete sequence
          Length = 114276

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   gtttccttttctctttttct 172
             ||||||||||||||||||||
Sbjct: 52890 gtttccttttctctttttct 52871
to top
>gb|AC096949.2| Homo sapiens chromosome 1 clone RP4-581O6, complete sequence
          Length = 106449

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 154   tttccttttctctttttctg 173
             ||||||||||||||||||||
Sbjct: 94582 tttccttttctctttttctg 94563
to top
>gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome y, complete
            sequence
          Length = 155247

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 254  acaagagaaaaaggaggagc 273
            ||||||||||||||||||||
Sbjct: 6323 acaagagaaaaaggaggagc 6342
to top
>gb|AC103922.2| Homo sapiens chromosome 3 clone RP11-226E22, complete sequence
          Length = 164479

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 226    aaacagggatgatgatagta 245
              ||||||||||||||||||||
Sbjct: 115439 aaacagggatgatgatagta 115420
to top
>gb|AC126425.2| Lemur catta, clone -162D1, complete sequence
          Length = 154718

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 154   tttccttttctctttttctg 173
             ||||||||||||||||||||
Sbjct: 27273 tttccttttctctttttctg 27254
to top
>gb|AC131599.2| Lemur catta, clone -206F2, complete sequence
          Length = 155606

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   tttccttttctctttttctg 173
             ||||||||||||||||||||
Sbjct: 90464 tttccttttctctttttctg 90483
to top
>gb|AC093628.3| Homo sapiens BAC clone RP11-98N20 from 4, complete sequence
          Length = 159991

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 257    agagaaaaaggaggagctag 276
              ||||||||||||||||||||
Sbjct: 124092 agagaaaaaggaggagctag 124073
to top
>gb|AC102491.19| Mus musculus chromosome 1, clone RP24-529L13, complete sequence
          Length = 190728

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   gtttccttttctctttttct 172
             ||||||||||||||||||||
Sbjct: 22737 gtttccttttctctttttct 22718
to top
>gb|AC151581.2| Pan troglodytes BAC clone RP43-166C19 from chromosome 7, complete
              sequence
          Length = 180623

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 255    caagagaaaaaggaggagctaggggaac 282
              ||||| |||||||||||| |||||||||
Sbjct: 140763 caagaaaaaaaggaggaggtaggggaac 140790
to top
>gb|AC138070.3| Homo sapiens chromosome 3 clone RP11-263E3, complete sequence
          Length = 169834

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 226   aaacagggatgatgatagta 245
             ||||||||||||||||||||
Sbjct: 17593 aaacagggatgatgatagta 17612
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 456     ggcttcttctcggtcaccgc 475
               ||||||||||||||||||||
Sbjct: 1176320 ggcttcttctcggtcaccgc 1176339
to top
>emb|AL121769.4|CNS01DSD Human chromosome 14 DNA sequence BAC R-299L17 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 167344

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 253   aacaagagaaaaaggaggag 272
             ||||||||||||||||||||
Sbjct: 65335 aacaagagaaaaaggaggag 65354
to top
>dbj|AP002987.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-428C14, complete
             sequence
          Length = 166893

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 150   caggtttccttttctctttt 169
             ||||||||||||||||||||
Sbjct: 74125 caggtttccttttctctttt 74144
to top
>dbj|AP002456.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-956A8, complete
             sequence
          Length = 114109

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   tttagagctaagcaaactga 226
             ||||||||||||||||||||
Sbjct: 94632 tttagagctaagcaaactga 94651
to top
>dbj|AP001929.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-640N11, complete
             sequence
          Length = 161547

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   tttagagctaagcaaactga 226
             ||||||||||||||||||||
Sbjct: 31460 tttagagctaagcaaactga 31479
to top
>gb|AC004063.1|AC004063 Homo sapiens chromosome 4 clone B32I8, complete sequence
          Length = 177014

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 257   agagaaaaaggaggagctag 276
             ||||||||||||||||||||
Sbjct: 59532 agagaaaaaggaggagctag 59513
to top
>dbj|AP001862.2| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:2060O22, complete
             sequence
          Length = 111557

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 257   agagaaaaaggaggagctag 276
             ||||||||||||||||||||
Sbjct: 78153 agagaaaaaggaggagctag 78134


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,131,988
Number of Sequences: 3902068
Number of extensions: 4131988
Number of successful extensions: 92342
Number of sequences better than 10.0: 71
Number of HSP's better than 10.0 without gapping: 71
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92102
Number of HSP's gapped (non-prelim): 240
length of query: 553
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 530
effective length of database: 17,143,297,704
effective search space: 9085947783120
effective search space used: 9085947783120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top