>emb|BX548058.9| Zebrafish DNA sequence from clone CH211-181H11 in linkage group 18,
             complete sequence
          Length = 95339

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 291   caaagacaacacaacagtcaa 311
             |||||||||||||||||||||
Sbjct: 54424 caaagacaacacaacagtcaa 54444

>emb|BX548060.7| Zebrafish DNA sequence from clone CH211-117I10 in linkage group 18,
            complete sequence
          Length = 120346

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 291  caaagacaacacaacagtcaa 311
            |||||||||||||||||||||
Sbjct: 8337 caaagacaacacaacagtcaa 8317

>ref|XM_705503.1| Candida albicans SC5314 putative spliceosomal translocase-like
           protein Snu114p (CaO19.144), mRNA
          Length = 3069

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 256 cttcttcttcatcttgcaga 275
           ||||||||||||||||||||
Sbjct: 160 cttcttcttcatcttgcaga 141

>ref|XM_705490.1| Candida albicans SC5314 putative spliceosomal translocase-like
           protein Snu114p (CaO19.7784), mRNA
          Length = 3069

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 256 cttcttcttcatcttgcaga 275
           ||||||||||||||||||||
Sbjct: 160 cttcttcttcatcttgcaga 141

>gb|AC008900.5| Homo sapiens chromosome 5 clone CTD-2242C17, complete sequence
          Length = 166253

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 192   actagcaggccttctccctg 211
             ||||||||||||||||||||
Sbjct: 45380 actagcaggccttctccctg 45361

>gb|AC026230.5|AC026230 Homo sapiens chromosome 5 clone CTD-2288O8, complete sequence
          Length = 114802

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 192  actagcaggccttctccctg 211
            ||||||||||||||||||||
Sbjct: 7045 actagcaggccttctccctg 7064


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,653,472
Number of Sequences: 3902068
Number of extensions: 2653472
Number of successful extensions: 59482
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59472
Number of HSP's gapped (non-prelim): 10
length of query: 454
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 432
effective length of database: 17,147,199,772
effective search space: 7407590301504
effective search space used: 7407590301504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)