>dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, complete genome
          Length = 4171146

 Score = 44.1 bits (22), Expect = 0.048
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 17      tggcttgcttgcagagtttgaa 38
               ||||||||||||||||||||||
Sbjct: 2055998 tggcttgcttgcagagtttgaa 2055977

>emb|AL592309.24| Human DNA sequence from clone RP11-293F5 on chromosome 1 Contains a
             novel gene, a novel pseudogene, a novel gene similar to
             heparan sulfate 6-O-sulfotransferase 1 (HS6ST1), a
             pseudogene similar to part of a novel gene, the gene for a
             hypothetical protein AE2, a profilin 1 (PFN1) pseudogene,
             the 5' end of the ALPL gene for alkaline phosphatase,
             liver/bone/kidney and a CpG island, complete sequence
          Length = 206231

 Score = 42.1 bits (21), Expect = 0.19
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 22    tgcttgcagagtttgaattgggtaatatc 50
             |||||||||||| ||||||||| ||||||
Sbjct: 63099 tgcttgcagagtgtgaattgggaaatatc 63127

>gb|AC021118.6| Homo sapiens BAC clone RP11-332D24 from 4, complete sequence
          Length = 194612

 Score = 40.1 bits (20), Expect = 0.75
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    ggcttgcttgcagagtttga 37
             ||||||||||||||||||||
Sbjct: 43380 ggcttgcttgcagagtttga 43399

>gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome
          Length = 2427734

 Score = 38.2 bits (19), Expect = 3.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 33      tttgaattgggtaatatcc 51
               |||||||||||||||||||
Sbjct: 1571752 tttgaattgggtaatatcc 1571734

>ref|XM_467813.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 981

 Score = 38.2 bits (19), Expect = 3.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tggcttgcttgcagagttt 35
           |||||||||||||||||||
Sbjct: 563 tggcttgcttgcagagttt 545

>emb|Z93015.9|HS169I5 Human DNA sequence from clone RP1-169I5 on chromosome Xp11 Contains the
             3' end of the DDX3 gene for DEAD/H (Asp-Glu-Ala-Asp/His)
             box polypeptide 3, the NYX gene for  nyctalopin, a gem
             (nuclear organelle) associated protein 7 (GEMIN7)
             pseudogene and two CpG islands, complete sequence
          Length = 133568

 Score = 38.2 bits (19), Expect = 3.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    tgaattgggtaatatcctg 53
             |||||||||||||||||||
Sbjct: 72083 tgaattgggtaatatcctg 72101

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 38.2 bits (19), Expect = 3.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 17       tggcttgcttgcagagttt 35
                |||||||||||||||||||
Sbjct: 31549928 tggcttgcttgcagagttt 31549910

>dbj|AP004774.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0431B06
          Length = 154796

 Score = 38.2 bits (19), Expect = 3.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    tggcttgcttgcagagttt 35
             |||||||||||||||||||
Sbjct: 40488 tggcttgcttgcagagttt 40470

>dbj|AK059134.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-H04, full
           insert sequence
          Length = 980

 Score = 38.2 bits (19), Expect = 3.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tggcttgcttgcagagttt 35
           |||||||||||||||||||
Sbjct: 562 tggcttgcttgcagagttt 544


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 385,342
Number of Sequences: 3902068
Number of extensions: 385342
Number of successful extensions: 27505
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27472
Number of HSP's gapped (non-prelim): 33
length of query: 74
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 53
effective length of database: 17,151,101,840
effective search space: 909008397520
effective search space used: 909008397520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)