ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags12b11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DQ167203.2| Triticum aestivum eukaryotic translation initiati... 920 0.0
2gb|DQ234391.1| Secale cereale translation initiation factor 5A m... 755 0.0
3gb|DQ234393.1| Aegilops tauschii translation initiation factor 5... 747 0.0
4gb|DQ234394.1| Secale sylvestre translation initiation factor 5A... 729 0.0
5gb|DQ234390.1| Dasypyrum breviaristatum translation initiation f... 726 0.0
6gb|DQ234392.1| Thinopyrum intermedium translation initiation fac... 644 0.0
7gb|DQ167202.1| Triticum aestivum eukaryotic translation initiati... 363 5e-97
8gb|DQ167201.1| Triticum aestivum eukaryotic translation initiati... 363 5e-97
9ref|NM_194115.2| Oryza sativa (japonica cultivar-group), mRNA 214 3e-52
10dbj|AK058206.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 3e-52
11ref|XM_469841.1| Oryza sativa (japonica cultivar-group), mRNA 204 3e-49
12emb|AJ312906.1|OSA312906 Oryza sativa mRNA for translation initi... 204 3e-49
13emb|AJ252135.1|OSA252135 Oryza sativa mRNA for translation initi... 204 3e-49
14dbj|AK121592.1| Oryza sativa (japonica cultivar-group) cDNA clon... 204 3e-49
15dbj|AK060387.1| Oryza sativa (japonica cultivar-group) cDNA clon... 204 3e-49
16emb|AJ843977.1| Plantago major mRNA for eukaryotic translation i... 178 2e-41
17gb|DQ279897.1| Secale cereale translation initiation factor gene... 172 9e-40
18ref|XM_479006.1| Oryza sativa (japonica cultivar-group), mRNA 167 6e-38
19ref|XM_506443.1| PREDICTED Oryza sativa (japonica cultivar-group... 167 6e-38
20emb|AJ238624.1|SVE238624 Senecio vernalis mRNA for translation i... 167 6e-38
21dbj|AK062134.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 6e-38
22gb|AF094773.1|AF094773 Oryza sativa translation initiation facto... 167 6e-38
23gb|DQ279894.1| Lophopyrum elongatum translation initiation facto... 165 2e-37
24dbj|AK103429.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
25gb|DQ279893.1| Pseudoroegneria spicata translation initiation fa... 159 1e-35
26gb|DQ414518.1| Dasypyrum breviaristatum eukaryotic translation i... 157 6e-35
27gb|DQ279895.1| Eremopyrum bonaepartis translation initiation fac... 157 6e-35
28gb|DQ279900.1| Haynaldia villosa translation initiation factor g... 149 1e-32
29gb|DQ279896.1| Aegilops tauschii translation initiation factor g... 149 1e-32
30gb|DQ345329.1| Rosa chinensis eukaryotic translation initiation ... 145 2e-31
31gb|DQ279899.1| Crithopsis delileana translation initiation facto... 143 8e-31
32gb|AF516357.1| Hevea brasiliensis eukaryotic translation initiat... 137 5e-29
33dbj|AB004825.1| Solanum tuberosum mRNA for eukaryotic initiation... 137 5e-29
34emb|X63542.1|NPNEIF5A2 N.plumbaginifolia mRNA NeIF-5A2 for initi... 135 2e-28
35dbj|AK061867.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
36dbj|AK099039.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
37gb|DQ279898.1| Psathyrostachys juncea translation initiation fac... 135 2e-28
38gb|DQ200358.1| Solanum tuberosum clone 053D09 eukaryotic initiat... 129 1e-26
39gb|DQ083198.1| Oryza sativa (indica cultivar-group) clone 5S10E1... 123 8e-25
40gb|AY484392.1| Capsicum annuum eukaryotic initiation factor 5A2 ... 117 5e-23
41gb|AY484391.1| Capsicum annuum mary storys protein mRNA, complet... 117 5e-23
42gb|AF516358.1| Hevea brasiliensis eukaryotic translation initiat... 117 5e-23
43gb|AF296085.1|AF296085 Lycopersicon esculentum eukaryotic transl... 115 2e-22
44emb|Y07920.1|ZMTRINF5A Z.mays mRNA for translation initiation fa... 107 5e-20
45emb|X59441.1|MSEIF4DMR M.sativa mRNA for eIF-4D 107 5e-20
46gb|AF266464.1|AF266464 Manihot esculenta translation initiation ... 107 5e-20
47gb|AF323604.1|AF323604 Manihot esculenta initiation factor eIF5-... 107 5e-20
48gb|AY103556.1| Zea mays PCO150862 mRNA sequence 107 5e-20
49gb|AF296081.1|AF296081 Dianthus caryophyllus eukaryotic translat... 103 7e-19
50gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 101 3e-18
51gb|AC079887.17| Oryza sativa (japonica cultivar-group) chromosom... 101 3e-18
52gb|AC084282.6| Oryza sativa chromosome 3 BAC OSJNBb0048A17 genom... 101 3e-18
53dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
54dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
55dbj|AP003874.5| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
56dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
57gb|AY488173.1| Capsicum annuum M1C3b mRNA, partial sequence 100 1e-17
58gb|AF516353.1| Hevea brasiliensis eukaryotic translation initiat... 100 1e-17
59gb|AF516352.1| Hevea brasiliensis eukaryotic translation initiat... 100 1e-17
60gb|AF516351.1| Hevea brasiliensis eukaryotic translation initiat... 100 1e-17
61gb|AF516350.1| Hevea brasiliensis eukaryotic translation initiat... 100 1e-17
62emb|X63541.1|NPNEIF5A1 N.plumbaginifolia mRNA NeIF-5A1 for initi... 100 1e-17
63gb|DQ228346.1| Solanum tuberosum clone 148H01 eukaryotic initiat... 94 7e-16
64gb|DQ222495.1| Solanum tuberosum clone 103C10 eukaryotic initiat... 94 7e-16
65gb|BT018311.1| Zea mays clone EL01T0207A06.c mRNA sequence 94 7e-16
66gb|AY496435.1| Brassica napus eukaryotic translation initiation ... 94 7e-16
67gb|AY389707.1| Hyacinthus orientalis eukaryotic translation init... 92 3e-15
68gb|AY587771.1| Tamarix androssowii translation initiation factor... 92 3e-15
69gb|AF516354.1| Hevea brasiliensis eukaryotic translation initiat... 92 3e-15
70gb|AF416338.1|AF416338 Medicago sativa eukaryotic translation in... 92 3e-15
71ref|NM_105608.2| Arabidopsis thaliana translation initiation fac... 90 1e-14
72gb|AY060530.1| Arabidopsis thaliana At1g69410/F10D13.8 mRNA, com... 90 1e-14
73gb|AF372933.1|AF372933 Arabidopsis thaliana At1g69410/F10D13.8 m... 90 1e-14
74emb|BX818518.1|CNS0AE6E Arabidopsis thaliana Full-length cDNA Co... 90 1e-14
75gb|AY087040.1| Arabidopsis thaliana clone 30884 mRNA, complete s... 90 1e-14
76dbj|AP004275.3| Oryza sativa (japonica cultivar-group) genomic D... 90 1e-14
77gb|DQ207846.1| Solanum tuberosum clone 073A09 eukaryotic initiat... 88 4e-14
78gb|AF225297.1|AF225297 Euphorbia esula translation initiation fa... 88 4e-14
79dbj|AB004827.1| Solanum tuberosum mRNA for eukaryotic initiation... 88 4e-14
80dbj|AB004824.1| Solanum tuberosum mRNA for eukaryotic initiation... 88 4e-14
81dbj|AB004823.1| Solanum tuberosum mRNA for eukaryotic initiation... 88 4e-14
82emb|AJ608752.1| Nicotiana plumbaginifolia cDNA-AFLP fragment, cl... 86 2e-13
83dbj|AB004826.1| Solanum tuberosum mRNA for eukaryotic initiation... 86 2e-13
84ref|NM_102425.2| Arabidopsis thaliana translation initiation fac... 84 7e-13
85gb|AF492850.1| Arabidopsis thaliana putative initiation factor 5... 84 7e-13
86gb|AY055789.1| Arabidopsis thaliana At1g26630/T24P13_1 mRNA, com... 84 7e-13
87gb|AY039588.1| Arabidopsis thaliana At1g26630/T24P13_1 mRNA, com... 84 7e-13
88emb|BX814148.1|CNS0AEAE Arabidopsis thaliana Full-length cDNA Co... 84 7e-13
89gb|AY084827.1| Arabidopsis thaliana clone 118823 mRNA, complete ... 84 7e-13
90dbj|AP004303.2| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
91ref|NM_101261.1| Arabidopsis thaliana EIF-5A; translation initia... 80 1e-11
92gb|AC122160.21| Medicago truncatula clone mth2-23d6, complete se... 80 1e-11
93gb|AC152068.17| Medicago truncatula clone mth2-29p8, complete se... 80 1e-11
94gb|AY117272.1| Arabidopsis thaliana putative initiation factor 5... 80 1e-11
95gb|AY063780.1| Arabidopsis thaliana putative initiation factor 5... 80 1e-11
96gb|AF296084.1|AF296084 Lycopersicon esculentum eukaryotic transl... 80 1e-11
97gb|AF296082.1|AF296082 Arabidopsis thaliana eukaryotic translati... 80 1e-11
98emb|BX816465.1|CNS0ABU4 Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
99emb|BX817162.1|CNS0ABMR Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
100emb|BX817272.1|CNS0AAJ3 Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
101gb|AC073178.9|AC073178 Arabidopsis thaliana chromosome 1 BAC F10... 80 1e-11
102gb|AC018364.5|AC018364 Arabidopsis thaliana chromosome 1 BAC F23... 80 1e-11
103dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
104dbj|D10399.1|RIC225 Oryza sativa mRNA for initiation factor eIF-... 78 4e-11
105gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 78 4e-11
106emb|AL731759.2|CNS07YPA Oryza sativa chromosome 12, . BAC OSJNBa... 78 4e-11
107emb|X63543.1|NTNEIF5A3 N.tabacum NeIF-5A3 gene for initiation fa... 76 2e-10
108gb|AF296086.1|AF296086 Lycopersicon esculentum eukaryotic transl... 76 2e-10
109dbj|AP004534.1| Lotus japonicus genomic DNA, chromosome 4, clone... 76 2e-10
110gb|AY961927.1| Picea abies eukaryotic translation initiation fac... 72 3e-09
111gb|BT016590.1| Zea mays clone Contig423 mRNA sequence 70 1e-08
112gb|BT017712.1| Zea mays clone EL01N0446G03.c mRNA sequence 70 1e-08
113emb|BX814371.1|CNS0ABYU Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
114gb|AF034943.1|AF034943 Zea mays translation initiation factor 5A... 70 1e-08
115gb|AY961932.1| Picea abies eukaryotic translation initiation fac... 68 4e-08
116gb|AF516355.1| Hevea brasiliensis eukaryotic translation initiat... 68 4e-08
117gb|AY961929.1| Picea abies eukaryotic translation initiation fac... 66 2e-07
118gb|DQ407749.1| Gymnadenia conopsea eukaryotic translation initia... 66 2e-07
119ref|NM_186716.1| Oryza sativa (japonica cultivar-group), mRNA 64 6e-07
120gb|AF296083.1|AF296083 Lycopersicon esculentum eukaryotic transl... 62 2e-06
121gb|AC006535.7|AC006535 Genomic sequence for Arabidopsis thaliana... 62 2e-06
122ref|NM_102426.3| Arabidopsis thaliana unknown protein AT1G26640 ... 56 1e-04
123gb|AF516356.1| Hevea brasiliensis eukaryotic translation initiat... 56 1e-04
124gb|AY961931.1| Picea abies eukaryotic translation initiation fac... 54 6e-04
125gb|AC007576.3| Arabidopsis thaliana chromosome I BAC F7A19 genom... 52 0.002
126gb|AC068197.4|AC068197 Genomic sequence for Arabidopsis thaliana... 52 0.002
127gb|AC117827.6| Mus musculus chromosome 1, clone RP24-88L2, compl... 50 0.009
128gb|AC151350.2| Xenopus tropicalis clone ISB-400N1, complete sequ... 50 0.009
129emb|CR392002.14| Zebrafish DNA sequence from clone DKEY-61D19 in... 50 0.009
130emb|AL391134.13| Human DNA sequence from clone RP11-245M24 on ch... 50 0.009
131emb|BX547935.12| Zebrafish DNA sequence from clone CH211-207C1 i... 50 0.009
132emb|BX950219.10| Mouse DNA sequence from clone RP23-303E24 on ch... 50 0.009
133gb|AC102666.13| Mus musculus chromosome 1, clone RP23-444A8, com... 50 0.009
134emb|CT030739.10| Mouse DNA sequence from clone RP24-496K8 on chr... 50 0.009
135gb|AC133097.3| Mus musculus BAC clone RP23-287O2 from 1, complet... 50 0.009
136gb|AC107677.7| Mus musculus chromosome 3, clone RP23-235F22, com... 48 0.036
137gb|AC156576.3| Mus musculus BAC clone RP23-7C22 from chromosome ... 48 0.036
138gb|AC122820.4| Mus musculus BAC clone RP23-200M5 from chromosome... 48 0.036
139gb|AC124486.4| Mus musculus BAC clone RP23-451E1 from chromosome... 48 0.036
140gb|AC124501.3| Mus musculus BAC clone RP23-412F10 from chromosom... 48 0.036
141gb|AC101142.9| Mus musculus chromosome 13, clone RP23-170P21, co... 48 0.036
142emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chr... 48 0.036
143gb|AC164168.3| Mus musculus 6 BAC RP23-343D21 (Roswell Park Canc... 48 0.036
144gb|AC164662.6| Mus musculus 10 BAC RP24-279D11 (Roswell Park Can... 48 0.036
145gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270... 48 0.036
146gb|AC084407.10| Mus Musculus Strain C57BL6/J Chromosome 11 Clone... 48 0.036
147gb|AC154817.2| Mus musculus BAC clone RP23-72G6 from chromosome ... 48 0.036
148gb|AC153496.4| Mus musculus 10 BAC RP23-373D1 (Roswell Park Canc... 48 0.036
149emb|AL929209.17| Mouse DNA sequence from clone RP23-415C3 on chr... 48 0.036
150gb|AC140301.3| Mus musculus BAC clone RP23-435M8 from 5, complet... 48 0.036
151emb|AL606704.20| Mouse DNA sequence from clone RP23-375B1 on chr... 48 0.036
152emb|AL672188.6| Mouse DNA sequence from clone RP23-53B2 on chrom... 48 0.036
153gb|AY961930.1| Picea abies eukaryotic translation initiation fac... 46 0.14
154gb|AC118009.7| Mus musculus chromosome 8, clone RP23-442H2, comp... 46 0.14
155gb|AC122239.4| Mus musculus BAC clone RP23-143K14 from chromosom... 46 0.14
156gb|AC142328.1| Pan troglodytes BAC clone RP43-24E4 from 7, compl... 46 0.14
157emb|AJ391219.1|APY391219 Aethia pygmaea microsatellite DNA, clon... 46 0.14
158emb|AL591521.8| Human DNA sequence from clone RP5-965F6 on chrom... 46 0.14
159emb|AL589740.4| Human DNA sequence from clone RP11-436D23 on chr... 46 0.14
160emb|AL512510.13| Human DNA sequence from clone RP11-537P24 on ch... 46 0.14
161gb|AC098719.3| Mus musculus clone RP23-2M3, complete sequence 46 0.14
162gb|AC024887.22| Homo sapiens 3 BAC RP11-307B9 (Roswell Park Canc... 46 0.14
163gb|AC112230.5| Homo sapiens BAC clone RP11-85D18 from 2, complet... 46 0.14
164gb|AF054116.1|AF054116 Rattus norvegicus polymorphic marker D5UI... 46 0.14
165gb|AC149588.4| Mus musculus BAC clone RP23-366I10 from 15, compl... 46 0.14
166gb|AC124097.6| Mus musculus chromosome 15, clone RP23-431H12, co... 44 0.57
167gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, co... 44 0.57
168gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, co... 44 0.57
169gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome... 44 0.57
170gb|AC162466.6| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cance... 44 0.57
171gb|AC115930.10| Mus musculus chromosome 3, clone RP24-534H10, co... 44 0.57
172gb|AC099644.6| Mus musculus chromosome 15, clone RP24-359B20, co... 44 0.57
173ref|NM_001013019.1| Mus musculus RIKEN cDNA 1110067I12 gene (111... 44 0.57
174gb|AC161210.5| Mus musculus chromosome 3, clone RP23-71N6, compl... 44 0.57
175gb|AF153595.1| Sebastes alutus microsatellite Sal1,6 sequence 44 0.57
176gb|AY324145.1| Desmognathus auriculatus clone Dau11 microsatelli... 44 0.57
177gb|U93889.1|MNU93889 Megaptera novaeangliae clone GATA019 micros... 44 0.57
178gb|AY024187.1| Oryza sativa microsatellite MRG6512 containing (T... 44 0.57
179gb|AY024166.1| Oryza sativa microsatellite MRG6491 containing (T... 44 0.57
180gb|AY023432.1| Oryza sativa microsatellite MRG5757 containing (T... 44 0.57
181gb|AY023429.1| Oryza sativa microsatellite MRG5754 containing (T... 44 0.57
182gb|AC145809.3| Oryza sativa (japonica cultivar-group) chromosome... 44 0.57
183gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 ma... 44 0.57
184gb|AC149301.1| Solanum demissum chromosome 5 clone PGEC517A09 ma... 44 0.57
185gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, c... 44 0.57
186gb|AY730340.1| Solanum tuberosum strain P6/210 clone BAC BA87d17... 44 0.57
187gb|AC142496.2| Homo sapiens chromosome X clone RP1-8N8 map p11.2... 44 0.57
188gb|AY526337.1| Panulirus argus clone Par3(4D19) microsatellite s... 44 0.57
189gb|AC115878.12| Mus musculus chromosome 15, clone RP24-358G9, co... 44 0.57
190gb|AC133874.10| Mus musculus chromosome 19, clone RP23-81N16, co... 44 0.57
191gb|AC100986.9| Mus musculus chromosome 3, clone RP23-77E5, compl... 44 0.57
192gb|AC134611.4| Mus musculus BAC clone RP23-98D8 from chromosome ... 44 0.57
193gb|AC120845.11| Mus musculus chromosome 3, clone RP23-468E4, com... 44 0.57
194gb|AC133649.2| Mus musculus BAC clone RP23-341M13 from chromosom... 44 0.57
195gb|AC147380.2| Mus musculus BAC clone RP24-119J10 from chromosom... 44 0.57
196gb|AC139335.3| Mus musculus BAC clone RP23-376N11 from chromosom... 44 0.57
197gb|AC102195.14| Mus musculus chromosome 18, clone RP24-430B21, c... 44 0.57
198gb|AC162285.6| Mus musculus chromosome 7, clone RP23-312O8, comp... 44 0.57
199gb|AC165348.3| Mus musculus BAC clone RP23-300C11 from chromosom... 44 0.57
200gb|AC164603.4| Mus musculus chromosome 8, clone RP24-114E3, comp... 44 0.57
201gb|DQ168326.1| Solanum tuberosum clone 149E01 metallocarboxypept... 44 0.57
202gb|DQ168312.1| Solanum tuberosum clone 024H10 metallocarboxypept... 44 0.57
203gb|AC164102.2| Mus musculus BAC clone RP23-7E23 from chromosome ... 44 0.57
204gb|AC137991.3| Oryza sativa chromosome 3 BAC OSJNBa0034D21 genom... 44 0.57
205gb|AC139863.5| Mus musculus chromosome 14, clone RP23-19M21, com... 44 0.57
206gb|AC118227.12| Mus musculus chromosome 15, clone RP23-379H6, co... 44 0.57
207emb|BX908756.12| Zebrafish DNA sequence from clone CH211-190D13 ... 44 0.57
208emb|AL133390.7| Human DNA sequence from clone RP1-317G22 on chro... 44 0.57
209gb|AC124444.4| Mus musculus BAC clone RP24-185P7 from chromosome... 44 0.57
210gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosom... 44 0.57
211gb|AC118607.12| Mus musculus chromosome 14, clone RP23-479D1, co... 44 0.57
212gb|AC121996.3| Mus musculus BAC clone RP24-312F5 from chromosome... 44 0.57
213gb|AC129217.3| Mus musculus BAC clone RP24-458M20 from chromosom... 44 0.57
214gb|AC127563.4| Mus musculus BAC clone RP24-283E13 from chromosom... 44 0.57
215gb|AC124523.5| Mus musculus BAC clone RP23-399P19 from chromosom... 44 0.57
216gb|AC112792.4| Mus musculus BAC clone RP23-192J17 from 18, compl... 44 0.57
217gb|AC124752.4| Mus musculus BAC clone RP23-283G18 from 13, compl... 44 0.57
218gb|AC122880.4| Mus musculus BAC clone RP23-77F18 from 8, complet... 44 0.57
219gb|AC122912.2| Mus musculus BAC clone RP23-61E5 from 7, complete... 44 0.57
220gb|AC114006.3| Mus musculus BAC clone RP23-185F9 from 17, comple... 44 0.57
221gb|AC122027.1| Mus musculus BAC clone RP24-390L20 from 1, comple... 44 0.57
222gb|AC114823.4| Mus musculus BAC clone RP23-209L10 from 2, comple... 44 0.57
223gb|AC107369.9| Mus musculus chromosome 15, clone RP23-368M2, com... 44 0.57
224gb|AC113025.9| Mus musculus chromosome 6, clone RP23-196D12, com... 44 0.57
225gb|AC093714.2| Homo sapiens BAC clone RP11-458K10 from 7, comple... 44 0.57
226gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, com... 44 0.57
227gb|AC100590.9| Mus musculus chromosome 10, clone RP23-156N5, com... 44 0.57
228gb|AC107781.9| Mus musculus, clone RP23-56O1, complete sequence 44 0.57
229emb|AL391840.6| Human DNA sequence from clone RP11-342L8 on chro... 44 0.57
230gb|AC159970.4| Mus musculus chromosome 3, clone RP23-301J11, com... 44 0.57
231emb|AL022161.1|HS380C13 Human DNA sequence from clone RP3-380C13... 44 0.57
232gb|AC073153.16| Mus musculus Strain C57BL6/J chromosome 19 BAC, ... 44 0.57
233gb|AC165148.2| Mus musculus BAC clone RP24-278K24 from chromosom... 44 0.57
234emb|CR352297.14| Zebrafish DNA sequence from clone CH211-165L15 ... 44 0.57
235emb|CR384099.6| Zebrafish DNA sequence from clone DKEY-266I18 in... 44 0.57
236emb|BX323089.13| Zebrafish DNA sequence from clone DKEYP-10D2 in... 44 0.57
237emb|AL713925.10| Mouse DNA sequence from clone RP23-298B18 on ch... 44 0.57
238emb|AL646093.9| Mouse DNA sequence from clone RP23-55I2 on chrom... 44 0.57
239emb|AL669858.8| Mouse DNA sequence from clone RP23-51G7 on chrom... 44 0.57
240emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chr... 44 0.57
241emb|BX276104.14| Mouse DNA sequence from clone RP24-313E3 on chr... 44 0.57
242emb|AL928592.13| Mouse DNA sequence from clone RP24-168J7 on chr... 44 0.57
243emb|BX511109.4| Zebrafish DNA sequence from clone DKEY-288G16 in... 44 0.57
244gb|AC124771.4| Mus musculus BAC clone RP23-28G12 from chromosome... 44 0.57
245emb|AL929566.30| Zebrafish DNA sequence from clone CH211-159C13 ... 44 0.57
246emb|CR293511.11| Zebrafish DNA sequence from clone DKEY-93H22 in... 44 0.57
247emb|BX629347.20| Zebrafish DNA sequence from clone DKEY-103K21 i... 44 0.57
248gb|DQ402491.1| Liposcelis decolor microsatellite Lip135 sequence 44 0.57
249emb|AL844587.19| Zebrafish DNA sequence from clone DKEY-7E14 in ... 44 0.57
250gb|AC008249.14| Homo sapiens 3 BAC RP11-211P13 (Roswell Park Can... 44 0.57
251emb|BX571955.15| Zebrafish DNA sequence from clone DKEY-27B3 in ... 44 0.57
252gb|AC006065.3| Homo sapiens 12q24.2 BAC RPCI11-407A16 (Roswell P... 44 0.57
253gb|AC097515.5| Homo sapiens BAC clone RP11-446J8 from 4, complet... 44 0.57
254gb|AY034584.1| Mus musculus cathepsin M (CtsM) pseudogene, parti... 44 0.57
255gb|AF467894.1|AF467894 Homo sapiens cytochrome P450, subfamily I... 44 0.57
256gb|AC083751.6| Genomic sequence for Oryza sativa, Nipponbare str... 44 0.57
257gb|AC147620.5| Mus musculus BAC clone RP24-285H21 from chromosom... 44 0.57
258gb|AC153596.5| Mus musculus 6 BAC RP23-305C1 (Roswell Park Cance... 44 0.57
259emb|BX571983.11| Zebrafish DNA sequence from clone DKEY-18M7 in ... 44 0.57
260gb|AC096627.28| Mus musculus strain C57BL/6J clone rp23-77b23 ma... 44 0.57
261gb|AC159099.4| Mus musculus chromosome 15, clone RP24-132A22, co... 44 0.57
262gb|AC158239.2| Mus musculus BAC clone RP23-48A24 from chromosome... 44 0.57
263gb|AC158533.2| Mus musculus BAC clone RP23-107I15 from chromosom... 44 0.57
264gb|AC131183.4| Mus musculus BAC clone RP23-225A14 from chromosom... 44 0.57
265gb|AC154778.2| Mus musculus BAC clone RP24-459I17 from chromosom... 44 0.57
266dbj|AK087615.1| Mus musculus 2 days pregnant adult female oviduc... 44 0.57
267dbj|AK049485.1| Mus musculus 7 days embryo whole body cDNA, RIKE... 44 0.57
268dbj|AK049402.1| Mus musculus 7 days embryo whole body cDNA, RIKE... 44 0.57
269gb|AC006576.15| Homo sapiens Chromosome 12p13.3 BAC Clone 762c12... 44 0.57
270gb|AC005336.1|AC005336 Homo sapien chromosome 19, cosmid F20129,... 44 0.57
271gb|AF226042.1|AF226038S5 Mus musculus isovaleryl CoA dehydrogena... 44 0.57
272ref|NG_002774.1| Mus musculus cathepsin M, pseudogene (Ctsm-ps) ... 44 0.57
273emb|BX539340.7| Zebrafish DNA sequence from clone DKEY-57K2 in l... 44 0.57
274emb|BX005024.13| Zebrafish DNA sequence from clone DKEY-211F1, c... 44 0.57
275dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.57
276dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.57
277dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.57
278emb|BX085194.14| Zebrafish DNA sequence from clone DKEY-242M13, ... 44 0.57
279gb|AC079818.56| Mus musculus strain C57BL/6J chromosome 10 clone... 44 0.57
280gb|AC005104.1| Homo sapiens BAC clone CTA-442F18 from 2, complet... 44 0.57
281gb|AC102461.15| Mus musculus chromosome 8, clone RP24-319H6, com... 44 0.57
282gb|AC005904.19| Homo sapiens 12 PAC RP4-751H1 (Roswell Park Canc... 44 0.57
283dbj|AP002744.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.57
284gb|AY183109.1| Trifolium repens clone c3.10 microsatellite sequence 44 0.57
285gb|AY183098.1| Trifolium repens clone c1.9 microsatellite sequence 44 0.57
286gb|AY183073.1| Trifolium repens clone a2.22 microsatellite sequence 44 0.57
287gb|AY183071.1| Trifolium repens clone A2.10 microsatellite sequence 44 0.57
288gb|AF482426.1| Homo sapiens encephalopsin splice variant 1 (OPN3... 44 0.57
289gb|AC068812.13|AC068812 Homo sapiens chromosome N/A clone RP11-2... 44 0.57
290gb|AC012155.17|AC012155 Homo sapiens 6 BAC RP11-114J19 (Roswell ... 44 0.57
291gb|AY178300.1| Trifolium repens microsatellite agr1012 sequence 44 0.57
292gb|AY178297.1| Trifolium repens microsatellite agr1009 sequence 44 0.57
293gb|AY178296.1| Trifolium repens microsatellite agr1007 sequence 44 0.57
294gb|AC124982.13| Mus musculus chromosome 3, clone RP24-173F6, com... 44 0.57
295gb|AC011001.2|AC011001 Arabidopsis thaliana chromosome I BAC F4H... 44 0.57
296dbj|AP002839.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.57
297gb|AC107815.11| Mus musculus chromosome 7, clone RP23-114A6, com... 44 0.57
298dbj|AP005875.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.57
299emb|AL935129.25| Mouse DNA sequence from clone RP23-181O3 on chr... 44 0.57
300emb|BX649621.5| Mouse DNA sequence from clone RP23-173F3 on chro... 44 0.57
301dbj|BS000169.1| Pan troglodytes chromosome 22 clone:RP43-042E01,... 44 0.57
302gb|AC121359.8| Mus musculus chromosome 15, clone RP23-138I21, co... 44 0.57
303dbj|AK067735.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.57
304emb|BX936406.24| Zebrafish DNA sequence from clone DKEY-13K17 in... 44 0.57
305emb|BX248410.4| Zebrafish DNA sequence from clone DKEY-65M5 in l... 44 0.57
306gb|AC119264.8| Mus musculus chromosome 15, clone RP24-289J12, co... 44 0.57
307emb|BX936423.12| Zebrafish DNA sequence from clone DKEY-174M14 i... 44 0.57
308emb|BX539307.6| Zebrafish DNA sequence from clone DKEY-253D23 in... 44 0.57
309emb|BX323595.8| Zebrafish DNA sequence from clone CH211-155O21 i... 44 0.57
310emb|BX120005.6| Zebrafish DNA sequence from clone RP71-56I13 in ... 44 0.57
311emb|BX000986.4| Zebrafish DNA sequence from clone CH211-210B19 i... 44 0.57
312emb|CR925790.6| Zebrafish DNA sequence from clone DKEY-275J21 in... 44 0.57
313gb|AC133283.13| Mus musculus chromosome 15, clone RP24-435N1, co... 44 0.57
314emb|BX901950.7| Zebrafish DNA sequence from clone DKEY-111C4 in ... 44 0.57
315gb|AC158911.7| Mus musculus chromosome 5, clone RP24-363D4, comp... 44 0.57
316emb|CT030740.8| Mouse DNA sequence from clone RP24-312D7 on chro... 44 0.57
317emb|AL162464.5|CNS01RHT Human chromosome 14 DNA sequence BAC R-8... 44 0.57
318emb|AL121775.3|CNS01DSG Human chromosome 14 DNA sequence BAC R-5... 44 0.57
319gb|AC107045.9| Mus musculus chromosome 1, clone RP23-334J7, comp... 44 0.57
320dbj|AP000626.5| Homo sapiens genomic DNA, chromosome 11q clone:C... 44 0.57
321gb|AC109608.14| Mus musculus strain C57BL/6J chromosome 5 clone ... 44 0.57
322gb|AC109606.11| Mus musculus strain C57BL/6J chromosome 5 clone ... 44 0.57
323gb|AC161764.4| Mus musculus BAC clone RP23-193D1 from chromosome... 44 0.57
324gb|AF056032.1|AF056032 Homo sapiens kynurenine 3-hydroxylase mRN... 44 0.57
325emb|AL928547.12| Mouse DNA sequence from clone RP23-226B16 on ch... 44 0.57
326gb|AC174083.2| Mus musculus BAC clone RP23-25B17 from chromosome... 44 0.57
327gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.57
328emb|AL929565.16| Mouse DNA sequence from clone RP23-454N16 on ch... 44 0.57
329gb|AC138456.5| Mus musculus BAC clone RP24-262P4 from 3, complet... 44 0.57
330emb|CT030233.6| Mouse DNA sequence from clone RP24-103C16 on chr... 44 0.57
331gb|AC134608.3| Mus musculus BAC clone RP23-68H13 from 13, comple... 44 0.57
332gb|AC151578.1| Mus musculus BAC clone RP23-218K4 from 18, comple... 44 0.57
333gb|M25858.1|HUMVWFA31 Human von Willebrand factor gene, exon 39,... 44 0.57
334gb|AC161488.7| Mus musculus chromosome 7, clone RP24-300N16, com... 44 0.57
335gb|AC161932.5| Mus musculus chromosome 18, clone RP24-78F20, com... 44 0.57
336gb|AC161166.7| Mus musculus chromosome 7, clone RP23-26A14, comp... 44 0.57
337ref|NM_003679.2| Homo sapiens kynurenine 3-monooxygenase (kynure... 44 0.57
338emb|AL845518.6| Mouse DNA sequence from clone RP23-300M9 on chro... 44 0.57
339emb|AL607074.13| Mouse DNA sequence from clone RP23-174M9 on chr... 44 0.57
340emb|AL607066.23| Mouse DNA sequence from clone RP23-406N5 on chr... 44 0.57
341emb|AL672106.9| Mouse DNA sequence from clone RP23-372E6 on chro... 44 0.57
342emb|AL845500.6| Mouse DNA sequence from clone RP23-221K3 on chro... 44 0.57
343emb|AL772255.12| Mouse DNA sequence from clone RP23-172B16 on ch... 44 0.57
344gb|AC164983.2| Mus musculus BAC clone RP23-16J24 from chromosome... 44 0.57
345emb|AL732448.6| Mouse DNA sequence from clone RP23-116F12 on chr... 44 0.57
346emb|AL713916.13| Mouse DNA sequence from clone RP23-129N3 on chr... 44 0.57
347emb|AL627076.14| Mouse DNA sequence from clone RP23-402I22 on ch... 44 0.57
348emb|AL663028.12| Mouse DNA sequence from clone RP23-23J11 on chr... 44 0.57
349gb|AC154026.1| Mus musculus 6 NOVECTOR RP24-423A5 (Roswell Park ... 42 2.2
350gb|AC121281.19| Mus musculus chromosome 3, clone RP23-61G16, com... 42 2.2
351gb|AC115727.10| Mus musculus chromosome 3, clone RP23-30A13, com... 42 2.2
352gb|AC102696.6| Mus musculus chromosome 7, clone RP24-112I14, com... 42 2.2
353gb|AC154262.1| Mus musculus chromosome 14 clone RP24-304G19, com... 42 2.2
354gb|AC116896.7| Mus musculus chromosome 8, clone RP24-531D19, com... 42 2.2
355gb|AC136372.13| Mus musculus chromosome 15, clone RP23-232G24, c... 42 2.2
356gb|AC160134.2| Mus musculus BAC clone RP23-139G11 from chromosom... 42 2.2
357gb|AC102908.11| Mus musculus chromosome 16, clone RP24-288K2, co... 42 2.2
358gb|AC101748.7| Mus musculus chromosome 5, clone RP24-133H21, com... 42 2.2
359gb|AC165078.2| Mus musculus BAC clone RP24-287O1 from chromosome... 42 2.2
360gb|AC153380.1| Mus musculus BAC RP23-256G5 (Roswell Park Cancer... 42 2.2
361gb|AC161571.11| Mus musculus chromosome 7, clone RP23-403M22, co... 42 2.2
362gb|AC164079.11| Mus musculus chromosome 1, clone RP23-15E12, com... 42 2.2
363gb|AC170862.1| Mus musculus chromosome 19, clone wi1-593J16, com... 42 2.2
364gb|AC163689.3| Mus musculus BAC clone CH36-200G6 from chromosome... 42 2.2
365gb|AC154102.15| Mus musculus chromosome 8, clone RP24-186O14, co... 42 2.2
366gb|AC125018.15| Mus musculus chromosome 7, clone RP24-158A20, co... 42 2.2
367gb|AC153645.4| Mus musculus BAC clone RP24-534E8 from chromosome... 42 2.2
368gb|AC164095.4| Mus musculus BAC clone RP23-355A22 from chromosom... 42 2.2
369gb|AC164648.3| Mus musculus BAC clone RP23-434H4 from chromosome... 42 2.2
370gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosom... 42 2.2
371gb|AC134662.11| Mus musculus chromosome 15, clone RP24-445D14, c... 42 2.2
372gb|AC116121.8| Mus musculus chromosome 8, clone RP23-79K4, compl... 42 2.2
373gb|AC108768.14| Mus musculus chromosome 8, clone RP23-398L15, co... 42 2.2
374gb|AC154786.2| Mus musculus BAC clone RP24-468B14 from chromosom... 42 2.2
375gb|AC102081.15| Mus musculus chromosome 18, clone RP23-43H5, com... 42 2.2
376gb|AC167963.5| Mus musculus chromosome 1, clone RP24-171A4, comp... 42 2.2
377gb|AC152999.1| Homo sapiens chromosome X clone Qc-3H10 map q28, ... 42 2.2
378gb|AC107757.15| Mus musculus chromosome 15, clone RP23-207L14, c... 42 2.2
379gb|AC115691.8| Mus musculus chromosome 18, clone RP24-286B14, co... 42 2.2
380gb|AC131085.16| Mus musculus chromosome 13, clone RP23-452D10, c... 42 2.2
381gb|AC115011.27| Mus musculus chromosome 1, clone RP24-192A11, co... 42 2.2
382gb|AC118193.9| Mus musculus chromosome 8, clone RP23-241A10, com... 42 2.2
383gb|AC115749.12| Mus musculus chromosome 3, clone RP23-14C17, com... 42 2.2
384gb|AC122014.3| Mus musculus chromosome 1 clone RP24-358F15, comp... 42 2.2
385gb|AC104203.11| Mus musculus chromosome 5, clone RP24-301M6, com... 42 2.2
386gb|AC102525.8| Mus musculus chromosome 8, clone RP24-133K20, com... 42 2.2
387gb|AC123703.8| Mus musculus chromosome 3, clone RP23-345N18, com... 42 2.2
388gb|AC154555.3| Mus musculus BAC clone RP23-418L12 from chromosom... 42 2.2
389gb|AC163612.3| Mus musculus BAC clone RP23-89N5 from chromosome ... 42 2.2
390gb|AC154236.2| Mus musculus BAC clone RP24-160E14 from chromosom... 42 2.2
391gb|AC163281.3| Mus musculus BAC clone RP23-443B19 from chromosom... 42 2.2
392gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome... 42 2.2
393gb|AC159285.3| Mus musculus BAC clone RP23-306M13 from chromosom... 42 2.2
394gb|AC165075.3| Mus musculus BAC clone RP24-465N15 from chromosom... 42 2.2
395gb|AC161411.11| Mus musculus chromosome 1, clone RP24-223E1, com... 42 2.2
396gb|AC169502.1| Mus musculus BAC clone RP24-409G12 from chromosom... 42 2.2
397gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, com... 42 2.2
398gb|AC169503.1| Mus musculus BAC clone RP24-281B5 from chromosome... 42 2.2
399gb|AC162520.7| Mus musculus chromosome 5, clone RP24-118C7, comp... 42 2.2
400gb|AC169813.2| Rhesus Macaque BAC CH250-16M3 (Children's Hospit... 42 2.2
401gb|AC114653.11| Mus musculus chromosome 5, clone RP24-158G19, co... 42 2.2
402gb|AC137842.8| Mus musculus chromosome 15, clone RP23-91M6, comp... 42 2.2
403gb|AC163094.5| Mus musculus chromosome 5, clone RP23-123P10, com... 42 2.2
404gb|AC104918.13| Mus musculus chromosome 7, clone RP23-335G1, com... 42 2.2
405gb|AC154107.3| Mus musculus BAC clone RP23-67L1 from chromosome ... 42 2.2
406gb|AC102150.10| Mus musculus chromosome 7, clone RP23-310N5, com... 42 2.2
407gb|AC110194.11| Mus musculus chromosome 7, clone RP23-238J3, com... 42 2.2
408gb|AY453831.1| Mandarina ponderosa clone Mpo5 microsatellite seq... 42 2.2
409gb|AC129588.10| Mus musculus chromosome 3, clone RP23-296L7, com... 42 2.2
410gb|AC152010.1| Homo sapiens chromosome X clone Qc-13B12 map q28,... 42 2.2
411gb|AC151961.1| Homo sapiens chromosome X clone RP11-76K17 map q2... 42 2.2
412gb|AC151960.1| Homo sapiens chromosome X clone RP11-76K17 map q2... 42 2.2
413gb|AC151959.1| Homo sapiens chromosome X clone RP11-76K17 map q2... 42 2.2
414gb|AC102410.5| Mus musculus chromosome 18, clone RP24-369O1, com... 42 2.2
415gb|AC124083.14| Mus musculus chromosome 5, clone RP24-400H4, com... 42 2.2
416gb|AC119856.13| Mus musculus chromosome 5, clone RP23-256B18, co... 42 2.2
417gb|AC107786.14| Mus musculus chromosome 5, clone RP23-5E3, compl... 42 2.2
418gb|AC168277.2| Mus musculus BAC RP24-186L17 (Roswell Park Cance... 42 2.2
419gb|AC079290.12| Mus musculus chromosome 18, clone RP23-330E13, c... 42 2.2
420gb|AC120867.10| Mus musculus chromosome 5, clone RP23-91O14, com... 42 2.2
421gb|AC114420.11| Mus musculus chromosome 5, clone RP23-375E13, co... 42 2.2
422gb|AC158918.7| Mus musculus chromosome 15, clone RP23-106N12, co... 42 2.2
423gb|AC102938.20| Mus musculus chromosome 1, clone RP24-187H3, com... 42 2.2
424gb|AF325697.1| Schistosoma mansoni microsatellite SMD43 sequence 42 2.2
425gb|AF296724.1| Acrantophis madagascariensis microsatellite 5HDZ6... 42 2.2
426gb|AY023933.1| Oryza sativa microsatellite MRG6258 containing (A... 42 2.2
427gb|AY023869.1| Oryza sativa microsatellite MRG6194 containing (A... 42 2.2
428gb|AC139130.10| Mus musculus chromosome 15, clone RP23-210B16, c... 42 2.2
429gb|AC120889.3| Oryza sativa (japonica cultivar-group) chromosome... 42 2.2
430gb|AC147802.2| Oryza sativa chromosome 3 BAC OSJNBb0013C14 genom... 42 2.2
431gb|AC162892.7| Mus musculus chromosome 5, clone RP23-257D19, com... 42 2.2
432gb|AC165315.5| Mus musculus chromosome 3, clone RP24-205J15, com... 42 2.2
433gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ... 42 2.2
434gb|AC160334.2| Mus musculus BAC clone RP23-37D14 from chromosome... 42 2.2
435gb|AC164437.2| Mus musculus BAC clone RP23-105B9 from chromosome... 42 2.2
436gb|AC157570.5| Mus musculus BAC clone RP23-105H5 from chromosome... 42 2.2
437gb|AC154240.2| Mus musculus BAC clone RP24-170E23 from chromosom... 42 2.2
438gb|AC161587.2| Mus musculus BAC clone RP24-492G17 from chromosom... 42 2.2
439gb|AC113099.12| Mus musculus chromosome 8, clone RP23-314N20, co... 42 2.2
440gb|AC110036.8| Mus musculus chromosome 7, clone RP23-254F9, comp... 42 2.2
441gb|AC125273.9| Mus musculus chromosome 1, clone RP24-156N4, comp... 42 2.2
442gb|AC136905.6| Oryza sativa (japonica cultivar-group) chromosome... 42 2.2
443gb|AC105067.8| Mus musculus chromosome 18, clone RP23-232D3, com... 42 2.2
444gb|AC107692.7| Mus musculus chromosome 3, clone RP24-387H23, com... 42 2.2
445gb|AC120004.14| Mus musculus chromosome 5, clone RP24-150N15, co... 42 2.2
446gb|AC116507.9| Mus musculus chromosome 19, clone RP24-309C17, co... 42 2.2
447gb|AC115013.18| Mus musculus chromosome 10, clone RP24-193P19, c... 42 2.2
448gb|AC113328.5| Mus musculus chromosome 3, clone RP23-456E2, comp... 42 2.2
449gb|AC011070.8| Drosophila melanogaster clone BACR02B12, complete... 42 2.2
450gb|AC147909.2| Xenopus tropicalis clone CH216-80K10, complete se... 42 2.2
451gb|AC146440.5| Pan troglodytes BAC clone RP43-11P11 from 7, comp... 42 2.2
452gb|AC134414.12| Mus musculus chromosome 15, clone RP24-70H12, co... 42 2.2
453gb|AY526335.1| Panulirus argus clone Par1(1G27) microsatellite s... 42 2.2
454gb|AF534377.1| Limulus polyphemus clone LpoA73 microsatellite se... 42 2.2
455gb|AC126115.5| Rattus norvegicus 4 BAC CH230-213L22 (Children's ... 42 2.2
456gb|AC125688.6| Rattus norvegicus 20 BAC CH230-186I2 (Children's ... 42 2.2
457gb|AC134127.3| Rattus norvegicus 8 BAC CH230-24F13 (Children's H... 42 2.2
458gb|AC114434.4| Rattus norvegicus 1 BAC CH230-210C18 (Children's ... 42 2.2
459gb|AC097023.6| Rattus norvegicus BAC CH230-35L12 (Children's Hos... 42 2.2
460gb|AC069539.5| Homo sapiens chromosome 11 clone RP11-321E15, com... 42 2.2
461gb|AC091473.2| Mus musculus chromosome X clones RP21-114F21, RP2... 42 2.2
462gb|AC102229.7| Mus musculus chromosome 15, clone RP24-70F9, comp... 42 2.2
463gb|AC120388.11| Mus musculus chromosome 9, clone RP24-300P2, com... 42 2.2
464gb|AC138766.20| Mus musculus chromosome 5, clone RP23-444J3, com... 42 2.2
465gb|AC148244.3| Mus musculus chromosome 9, clone wi1-65440F10, co... 42 2.2
466gb|AC115924.11| Mus musculus chromosome 15, clone RP24-511O11, c... 42 2.2
467gb|AC148966.2| X. tropicalis BAC clone ISB1-137N19 containing ge... 42 2.2
468gb|AC140447.3| Mus musculus BAC clone RP23-53E23 from chromosome... 42 2.2
469gb|AC144933.4| Mus musculus BAC clone RP24-531B24 from chromosom... 42 2.2
470gb|AC137514.2| Mus musculus BAC clone RP24-511G20 from chromosom... 42 2.2
471gb|AC133934.3| Mus musculus BAC clone RP24-361B1 from chromosome... 42 2.2
472gb|AC130828.4| Mus musculus BAC clone RP23-406H14 from chromosom... 42 2.2
473gb|AC132681.5| Mus musculus BAC clone RP23-442K13 from chromosom... 42 2.2
474gb|AC144816.3| Mus musculus BAC clone RP24-243E15 from chromosom... 42 2.2
475gb|AC111109.6| Mus musculus chromosome 1, clone RP23-199D23, com... 42 2.2
476gb|AC138260.7| Mus musculus chromosome 6, clone RP23-247I19, com... 42 2.2
477gb|AC126593.5| Rattus norvegicus 13 BAC CH230-103N15 (Children's... 42 2.2
478gb|AC110243.9| Mus musculus chromosome 15, clone RP23-246C6, com... 42 2.2
479gb|AC119218.7| Mus musculus chromosome 7, clone RP24-200I20, com... 42 2.2
480gb|AC138401.9| Mus musculus chromosome 13, clone RP24-79G5, comp... 42 2.2
481ref|NM_001025566.1| Mus musculus choline kinase alpha (Chka), tr... 42 2.2
482gb|AC148924.2| Pan troglodytes fosmid clone CH1251-1825H8 from Y... 42 2.2
483gb|AC158619.12| Mus musculus 10 BAC RP23-291O3 (Roswell Park Can... 42 2.2
484gb|AC147228.3| Mus musculus BAC clone RP23-159I8 from chromosome... 42 2.2
485gb|AC134583.5| Mus musculus BAC clone RP24-94C12 from chromosome... 42 2.2
486gb|AC132322.3| Mus musculus BAC clone RP24-262F3 from chromosome... 42 2.2
487gb|AC101757.12| Mus musculus chromosome 8, clone RP24-545I11, co... 42 2.2
488gb|AC126424.12| Mus musculus chromosome 17, clone RP23-19K10, co... 42 2.2
489gb|AC147058.3| Pan troglodytes BAC clone RP43-154B16 from 7, com... 42 2.2
490gb|AC131745.4| Mus musculus BAC clone RP23-55L3 from chromosome ... 42 2.2
491gb|AC125406.4| Mus musculus BAC clone RP23-32C18 from chromosome... 42 2.2
492gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome... 42 2.2
493gb|AC115360.6| Mus musculus BAC clone RP23-191N22 from chromosom... 42 2.2
494gb|AC134576.3| Mus musculus BAC clone RP24-68G10 from chromosome... 42 2.2
495gb|AC123531.4| Mus musculus BAC clone RP24-289C11 from chromosom... 42 2.2
496gb|AC134826.4| Mus musculus BAC clone RP24-459P6 from chromosome... 42 2.2
497gb|AC140843.2| Mus musculus BAC clone RP24-443L17 from chromosom... 42 2.2
498gb|AC122527.3| Mus musculus BAC clone RP24-502E10 from chromosom... 42 2.2
499gb|AC144776.2| Mus musculus BAC clone RP23-357B5 from chromosome... 42 2.2
500gb|AC114409.17| Mus musculus chromosome 5, clone RP23-148F6, com... 42 2.2

>gb|DQ167203.2| Triticum aestivum eukaryotic translation initiation factor 5A3
           mRNA, complete cds
          Length = 768

 Score =  920 bits (464), Expect = 0.0
 Identities = 507/520 (97%), Gaps = 1/520 (0%)
 Strand = Plus / Minus

                                                                       
Query: 132 ataatagagatagatagatagataacaaagtactagcagcacctcgagcattcggtgtaa 191
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 768 ataatagagatagatagatagataacaaagtactagcagcacctcgagcattcggtgtaa 709

                                                                       
Query: 192 aaaacacacaaatctggatcaaacttgtttcacccaacagatatcttgatgcctatgtat 251
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 708 aaaacacacaaatctggatcaaacttgtttcacccaacagatatcttgatgcctatgtat 649

                                                                       
Query: 252 gtgtatctcaaacacccagaagcactagataccaagtatcacagctaggcaaccatgcac 311
           |||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||
Sbjct: 648 gtgtatctcaaacacccagaagcactagataccaagtatcgcaggtaggcaaccacgcac 589

                                                                       
Query: 312 cgctgcttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggc 371
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 588 agctgcttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggc 529

                                                                       
Query: 372 agacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatctggccaag 431
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 528 ggacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatctggccaag 469

                                                                       
Query: 432 cagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcag 491
           |||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||
Sbjct: 468 cagaacatcatcagtgggaagcttcaggtcatccttagtgttaccactctcagtgagaag 409

                                                                       
Query: 492 gctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 551
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 408 gctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 349

                                                                       
Query: 552 aacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtc 611
            |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 348 gacgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtc 289

                                                   
Query: 612 aatggcaacaaagtggcactttgcgtgggccatgcttccc 651
           ||||||||||||||| |||||||||| | |||||||||||
Sbjct: 288 aatggcaacaaagtgacactttgcgt-gaccatgcttccc 250



to top

>gb|DQ234391.1| Secale cereale translation initiation factor 5A mRNA, complete cds
          Length = 636

 Score =  755 bits (381), Expect = 0.0
 Identities = 418/429 (97%), Gaps = 1/429 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 282
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 636 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 577

                                                                       
Query: 283 ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 342
           ||||||||| ||| |||||||||  |||| ||||||||||||||||||||||||||||||
Sbjct: 576 ccaagtatcgcaggtaggcaaccgcgcacagctgcttacttgccaccaccgatttccttc 517

                                                                       
Query: 343 acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 402
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 516 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 457

                                                                       
Query: 403 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 462
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 456 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 397

                                                                       
Query: 463 tccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatc 522
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 396 tccttagtgttgccactctcagttagaaggctgacatatccatcatcagttatgtcaatc 337

                                                                       
Query: 523 agctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaata 582
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 336 agctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaaggaacaata 277

                                                                       
Query: 583 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtgggcc 642
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||
Sbjct: 276 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgt-gacc 218

                    
Query: 643 atgcttccc 651
           |||||||||
Sbjct: 217 atgcttccc 209



to top

>gb|DQ234393.1| Aegilops tauschii translation initiation factor 5A gene, complete
           cds
          Length = 636

 Score =  747 bits (377), Expect = 0.0
 Identities = 417/429 (97%), Gaps = 1/429 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 282
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 636 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 577

                                                                       
Query: 283 ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 342
           ||||||||| ||| |||||||||| |||| ||||||||||||||||||||||||||||||
Sbjct: 576 ccaagtatcgcaggtaggcaaccacgcacagctgcttacttgccaccaccgatttccttc 517

                                                                       
Query: 343 acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 402
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 516 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 457

                                                                       
Query: 403 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 462
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 456 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 397

                                                                       
Query: 463 tccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatc 522
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 396 tccttagtgttgccactctcagtgagaaggctgacatatccatcatcagttatgtcaatc 337

                                                                       
Query: 523 agctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaata 582
           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 336 agctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaaggaacgata 277

                                                                       
Query: 583 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtgggcc 642
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||
Sbjct: 276 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtgacactttgcgt-gacc 218

                    
Query: 643 atgcttccc 651
           |||||||||
Sbjct: 217 atgcttccc 209



to top

>gb|DQ234394.1| Secale sylvestre translation initiation factor 5A mRNA, complete
           cds
          Length = 636

 Score =  729 bits (368), Expect = 0.0
 Identities = 404/416 (97%)
 Strand = Plus / Minus

                                                                       
Query: 223 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 282
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 636 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 577

                                                                       
Query: 283 ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 342
           ||||||||| ||| |||||||||  |||| ||||||||||||||||||||||||||||| 
Sbjct: 576 ccaagtatcgcaggtaggcaaccgcgcacagctgcttacttgccaccaccgatttcctta 517

                                                                       
Query: 343 acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 402
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 516 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 457

                                                                       
Query: 403 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 462
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 456 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 397

                                                                       
Query: 463 tccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatc 522
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 396 tccttagtgttgccactctcagtgagaaggctgacatatccatcatcagttatgtcaatc 337

                                                                       
Query: 523 agctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaata 582
           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 336 agctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaaggaacgata 277

                                                                   
Query: 583 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtg 638
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 276 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtgacactttgcgtg 221



to top

>gb|DQ234390.1| Dasypyrum breviaristatum translation initiation factor 5A mRNA,
           complete cds
          Length = 637

 Score =  726 bits (366), Expect = 0.0
 Identities = 416/430 (96%), Gaps = 2/430 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 acccaacagatatcttgatgcctatgtat-gtgtatctcaaacacccagaagcactagat 281
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 637 acccaacagatatcttgatgcctatgtattgtgtatctcaaacacccagaagcactagat 578

                                                                       
Query: 282 accaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttcctt 341
           |||||||||| ||| |||||||||| || | |||||||||||||||||||| ||||||||
Sbjct: 577 accaagtatcgcagataggcaaccacgcgcagctgcttacttgccaccaccaatttcctt 518

                                                                       
Query: 342 cacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcc 401
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 517 cacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcc 458

                                                                       
Query: 402 atcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtc 461
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 457 atcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtc 398

                                                                       
Query: 462 atccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaat 521
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 397 atccttagtgttgccactctcagtcagaaggctgacatatccatcatcagttatgtcaat 338

                                                                       
Query: 522 cagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaat 581
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 337 cagctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaaggaacgat 278

                                                                       
Query: 582 atcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtgggc 641
           ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| | |
Sbjct: 277 atcctcaagcttctttccattaaagatgtcaatggcaacgaagtgacactttgcgt-gac 219

                     
Query: 642 catgcttccc 651
           ||||||||||
Sbjct: 218 catgcttccc 209



to top

>gb|DQ234392.1| Thinopyrum intermedium translation initiation factor 5A mRNA,
           complete cds
          Length = 636

 Score =  644 bits (325), Expect = 0.0
 Identities = 404/429 (94%), Gaps = 1/429 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 282
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 636 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 577

                                                                       
Query: 283 ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 342
           ||||||| | |||||||||||||| |||| |||||||||||||||||||||| |||||||
Sbjct: 576 ccaagtaccgcagctaggcaaccacgcacagctgcttacttgccaccaccgacttccttc 517

                                                                       
Query: 343 acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 402
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 516 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 457

                                                                       
Query: 403 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 462
           ||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 456 tcagcaaatccagccttgatctgggcaagcagagcatcatcagtgggaagcttcaggtca 397

                                                                       
Query: 463 tccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatc 522
           ||||||||| ||||||||||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 396 tccttagtgctgccactctcagttagaaggctgacatatccatcatcagtgatgtcaatc 337

                                                                       
Query: 523 agctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaata 582
           |||||| ||||  | |||  ||||||||| || |||||||||||||||||||| || |||
Sbjct: 336 agctgaaaatccagacgggtaacatgggggacatcacagttgtgggatgaagggacgata 277

                                                                       
Query: 583 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtgggcc 642
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||
Sbjct: 276 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgt-gacc 218

                    
Query: 643 atgcttccc 651
           |||||||||
Sbjct: 217 atgcttccc 209



to top

>gb|DQ167202.1| Triticum aestivum eukaryotic translation initiation factor 5A2 gene,
            complete cds
          Length = 1679

 Score =  363 bits (183), Expect = 5e-97
 Identities = 198/203 (97%)
 Strand = Plus / Minus

                                                                        
Query: 223  acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 282
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1679 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 1620

                                                                        
Query: 283  ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 342
            ||||||||| ||| |||||||||| |||| ||||||||||||||||||||||||||||||
Sbjct: 1619 ccaagtatcgcaggtaggcaaccacgcacagctgcttacttgccaccaccgatttccttc 1560

                                                                        
Query: 343  acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 402
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1559 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 1500

                                   
Query: 403  tcagcaaatccagtcttgatctg 425
            |||||||||||||||||||||||
Sbjct: 1499 tcagcaaatccagtcttgatctg 1477



 Score =  157 bits (79), Expect = 6e-35
 Identities = 95/99 (95%), Gaps = 1/99 (1%)
 Strand = Plus / Minus

                                                                        
Query: 553  acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1085 acgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtca 1026

                                                   
Query: 613  atggcaacaaagtggcactttgcgtgggccatgcttccc 651
            |||||||||||||| |||||||||| | |||||||||||
Sbjct: 1025 atggcaacaaagtgacactttgcgt-gaccatgcttccc 988



 Score =  117 bits (59), Expect = 5e-23
 Identities = 71/75 (94%)
 Strand = Plus / Minus

                                                                        
Query: 423  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 482
            ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||
Sbjct: 1389 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagggttaccactctc 1330

                           
Query: 483  agtcagcaggctgac 497
            ||| || ||||||||
Sbjct: 1329 agtgagaaggctgac 1315



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 496  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 551
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 1178



to top

>gb|DQ167201.1| Triticum aestivum eukaryotic translation initiation factor 5A1 gene,
            complete cds
          Length = 1910

 Score =  363 bits (183), Expect = 5e-97
 Identities = 198/203 (97%)
 Strand = Plus / Minus

                                                                        
Query: 223  acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 282
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1910 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 1851

                                                                        
Query: 283  ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 342
            ||||||||| ||| |||||||||| |||| ||||||||||||||||||||||||||||||
Sbjct: 1850 ccaagtatcgcaggtaggcaaccacgcacagctgcttacttgccaccaccgatttccttc 1791

                                                                        
Query: 343  acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 402
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1790 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 1731

                                   
Query: 403  tcagcaaatccagtcttgatctg 425
            |||||||||||||||||||||||
Sbjct: 1730 tcagcaaatccagtcttgatctg 1708



 Score =  157 bits (79), Expect = 6e-35
 Identities = 95/99 (95%), Gaps = 1/99 (1%)
 Strand = Plus / Minus

                                                                        
Query: 553  acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1321 acgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtca 1262

                                                   
Query: 613  atggcaacaaagtggcactttgcgtgggccatgcttccc 651
            |||||||||||||| |||||||||| | |||||||||||
Sbjct: 1261 atggcaacaaagtgacactttgcgt-gaccatgcttccc 1224



 Score =  133 bits (67), Expect = 8e-28
 Identities = 73/75 (97%)
 Strand = Plus / Minus

                                                                        
Query: 423  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 482
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1622 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1563

                           
Query: 483  agtcagcaggctgac 497
            ||| || ||||||||
Sbjct: 1562 agttagaaggctgac 1548



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 496  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 551
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1465 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 1410



to top

>ref|NM_194115.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 863

 Score =  214 bits (108), Expect = 3e-52
 Identities = 258/306 (84%), Gaps = 4/306 (1%)
 Strand = Plus / Minus

                                                                       
Query: 349 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatc---a 405
           ||||||||||||||||||||||| |||||||||| || |||||  |||||||| ||   |
Sbjct: 542 cagatctgttcttcacccatggcggacatcacagtcaagatcatatccttgccttcttca 483

                                                                       
Query: 406 gcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcc 465
            |||| ||  |||||||||||  |  ||||  |||||||||||||||| ||| |||||||
Sbjct: 482 ccaaacccgttcttgatctggttagtcagagtatcatcagtgggaagcctcaagtcatcc 423

                                                                       
Query: 466 ttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagc 525
           ||||||||||| ||||||||||  ||||| ||| ||||||| || |  ||||||||||||
Sbjct: 422 ttagtgttgccgctctcagtcaaaaggctcacaaatccatcttccgaaatgtcaatcagc 363

                                                                       
Query: 526 tgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcc 585
           || |||||    || |||||||| ||||||||||||||||||||||| || |||||||| 
Sbjct: 362 tggtaatcagtacgatcaacatgaggaacgtcacagttgtgggatgaggggacaatatct 303

                                                                       
Query: 586 tcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtgggccatg 645
           ||||||||||||||||| || ||||||||  ||||||||||||| || |||| | |||||
Sbjct: 302 tcaagcttctttccattgaaaatgtcaataccaacaaagtggcatttggcgt-gaccatg 244

                 
Query: 646 cttccc 651
           ||||||
Sbjct: 243 cttccc 238



to top

>dbj|AK058206.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-A08, full
           insert sequence
          Length = 863

 Score =  214 bits (108), Expect = 3e-52
 Identities = 258/306 (84%), Gaps = 4/306 (1%)
 Strand = Plus / Minus

                                                                       
Query: 349 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatc---a 405
           ||||||||||||||||||||||| |||||||||| || |||||  |||||||| ||   |
Sbjct: 542 cagatctgttcttcacccatggcggacatcacagtcaagatcatatccttgccttcttca 483

                                                                       
Query: 406 gcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcc 465
            |||| ||  |||||||||||  |  ||||  |||||||||||||||| ||| |||||||
Sbjct: 482 ccaaacccgttcttgatctggttagtcagagtatcatcagtgggaagcctcaagtcatcc 423

                                                                       
Query: 466 ttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagc 525
           ||||||||||| ||||||||||  ||||| ||| ||||||| || |  ||||||||||||
Sbjct: 422 ttagtgttgccgctctcagtcaaaaggctcacaaatccatcttccgaaatgtcaatcagc 363

                                                                       
Query: 526 tgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcc 585
           || |||||    || |||||||| ||||||||||||||||||||||| || |||||||| 
Sbjct: 362 tggtaatcagtacgatcaacatgaggaacgtcacagttgtgggatgaggggacaatatct 303

                                                                       
Query: 586 tcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtgggccatg 645
           ||||||||||||||||| || ||||||||  ||||||||||||| || |||| | |||||
Sbjct: 302 tcaagcttctttccattgaaaatgtcaataccaacaaagtggcatttggcgt-gaccatg 244

                 
Query: 646 cttccc 651
           ||||||
Sbjct: 243 cttccc 238



to top

>ref|XM_469841.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 859

 Score =  204 bits (103), Expect = 3e-49
 Identities = 250/299 (83%)
 Strand = Plus / Minus

                                                                       
Query: 337 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 396
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 542 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 483

                                                                       
Query: 397 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 456
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 482 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 423

                                                                       
Query: 457 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 516
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 422 aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 363

                                                                       
Query: 517 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 576
           |||||||||||||||||    ||||  || ||||| ||||||||||||||||| || || 
Sbjct: 362 tcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggaggagggc 303

                                                                      
Query: 577 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgc 635
           |||||||| ||||||||||| ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 302 acaatatcttcaagcttcttcccattgaagatgtcaatggccacaaagtggcattttgc 244



to top

>emb|AJ312906.1|OSA312906 Oryza sativa mRNA for translation initiation factor, eIF-5A (eIF-5A
           gene)
          Length = 831

 Score =  204 bits (103), Expect = 3e-49
 Identities = 250/299 (83%)
 Strand = Plus / Minus

                                                                       
Query: 337 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 396
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 537 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 478

                                                                       
Query: 397 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 456
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 477 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 418

                                                                       
Query: 457 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 516
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 417 aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 358

                                                                       
Query: 517 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 576
           |||||||||||||||||    ||||  || ||||| ||||||||||||||||| || || 
Sbjct: 357 tcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggaggagggc 298

                                                                      
Query: 577 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgc 635
           |||||||| ||||||||||| ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 297 acaatatcttcaagcttcttcccattgaagatgtcaatggccacaaagtggcattttgc 239



to top

>emb|AJ252135.1|OSA252135 Oryza sativa mRNA for translation initiation factor eIF-5A
          Length = 722

 Score =  204 bits (103), Expect = 3e-49
 Identities = 250/299 (83%)
 Strand = Plus / Minus

                                                                       
Query: 337 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 396
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 537 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 478

                                                                       
Query: 397 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 456
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 477 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 418

                                                                       
Query: 457 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 516
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 417 aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 358

                                                                       
Query: 517 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 576
           |||||||||||||||||    ||||  || ||||| ||||||||||||||||| || || 
Sbjct: 357 tcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggaggagggc 298

                                                                      
Query: 577 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgc 635
           |||||||| ||||||||||| ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 297 acaatatcttcaagcttcttcccattgaagatgtcaatggccacaaagtggcattttgc 239



to top

>dbj|AK121592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033038B14, full
           insert sequence
          Length = 838

 Score =  204 bits (103), Expect = 3e-49
 Identities = 250/299 (83%)
 Strand = Plus / Minus

                                                                       
Query: 337 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 396
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 547 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 488

                                                                       
Query: 397 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 456
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 487 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 428

                                                                       
Query: 457 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 516
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 427 aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 368

                                                                       
Query: 517 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 576
           |||||||||||||||||    ||||  || ||||| ||||||||||||||||| || || 
Sbjct: 367 tcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggaggagggc 308

                                                                      
Query: 577 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgc 635
           |||||||| ||||||||||| ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 307 acaatatcttcaagcttcttcccattgaagatgtcaatggccacaaagtggcattttgc 249



to top

>dbj|AK060387.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-G06, full
           insert sequence
          Length = 947

 Score =  204 bits (103), Expect = 3e-49
 Identities = 250/299 (83%)
 Strand = Plus / Minus

                                                                       
Query: 337 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 396
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 553 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 494

                                                                       
Query: 397 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 456
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 493 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 434

                                                                       
Query: 457 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 516
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 433 aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 374

                                                                       
Query: 517 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 576
           |||||||||||||||||    ||||  || ||||| ||||||||||||||||| || || 
Sbjct: 373 tcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggaggagggc 314

                                                                      
Query: 577 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgc 635
           |||||||| ||||||||||| ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 313 acaatatcttcaagcttcttcccattgaagatgtcaatggccacaaagtggcattttgc 255



to top

>emb|AJ843977.1| Plantago major mRNA for eukaryotic translation initiation factor
           5A-1 (eif5a1 gene)
          Length = 890

 Score =  178 bits (90), Expect = 2e-41
 Identities = 174/202 (86%)
 Strand = Plus / Minus

                                                                       
Query: 437 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 496
           |||||||||| || ||| | ||||||||||||||| | ||| | ||||| |||| ||| |
Sbjct: 510 catcatcagttgggagcctaaggtcatccttagtgcttccattgtcagttagcaagctca 451

                                                                       
Query: 497 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 556
           || ||||||| ||||  ||||||||||||||||||||    |||| |||||| || || |
Sbjct: 450 caaatccatcctcagaaatgtcaatcagctgataatcaacacggttaacatgagggacat 391

                                                                       
Query: 557 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 616
           |||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 390 cacaattgtgggaagaaggaacaatatcctcaagcttcttgccattaaagatgtcaatgg 331

                                 
Query: 617 caacaaagtggcactttgcgtg 638
           |||||||||| || ||||||||
Sbjct: 330 caacaaagtgacattttgcgtg 309



to top

>gb|DQ279897.1| Secale cereale translation initiation factor gene, partial cds
          Length = 1298

 Score =  172 bits (87), Expect = 9e-40
 Identities = 97/99 (97%), Gaps = 1/99 (1%)
 Strand = Plus / Minus

                                                                       
Query: 553 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 828 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 769

                                                  
Query: 613 atggcaacaaagtggcactttgcgtgggccatgcttccc 651
           ||||||||||||||||||||||||| | |||||||||||
Sbjct: 768 atggcaacaaagtggcactttgcgt-gaccatgcttccc 731



 Score =  131 bits (66), Expect = 3e-27
 Identities = 72/74 (97%)
 Strand = Plus / Minus

                                                                        
Query: 352  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
            ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1298 atctgctcttcacccatggcggacatcacagacaggatcaggtccttgccatcagcaaat 1239

                          
Query: 412  ccagtcttgatctg 425
            ||||||||||||||
Sbjct: 1238 ccagtcttgatctg 1225



 Score =  125 bits (63), Expect = 2e-25
 Identities = 72/75 (96%)
 Strand = Plus / Minus

                                                                        
Query: 423  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 482
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1137 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgtcgccactctc 1078

                           
Query: 483  agtcagcaggctgac 497
            ||| || ||||||||
Sbjct: 1077 agttagaaggctgac 1063



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                   
Query: 496 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 551
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 976 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 921



to top

>ref|XM_479006.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 934

 Score =  167 bits (84), Expect = 6e-38
 Identities = 234/284 (82%)
 Strand = Plus / Minus

                                                                       
Query: 349 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 408
           |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 553 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 494

                                                                       
Query: 409 aatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcctta 468
           ||||||||||||||||| || || |||   |||||||| || ||  | || |||||||||
Sbjct: 493 aatccagtcttgatctgacccaggagactgtcatcagttgggagtctaagatcatcctta 434

                                                                       
Query: 469 gtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctga 528
           ||||| ||||||||||| || ||||| ||  ||||||| || | ||||||||||||||| 
Sbjct: 433 gtgttaccactctcagtaagaaggctcacgaatccatcctctgatatgtcaatcagctgg 374

                                                                       
Query: 529 taatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctca 588
           || |||  |||||  ||||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 373 tactctgtgcggttcacatgtggaacatcacagttgtgggacgaaggaacaatatcctca 314

                                                       
Query: 589 agcttctttccattaaagatgtcaatggcaacaaagtggcactt 632
           ||||| || ||||| || || || |||||||||||||| |||||
Sbjct: 313 agctttttaccattgaatatatctatggcaacaaagtgacactt 270



to top

>ref|XM_506443.1| PREDICTED Oryza sativa (japonica cultivar-group), P0453E05.118 mRNA
          Length = 996

 Score =  167 bits (84), Expect = 6e-38
 Identities = 234/284 (82%)
 Strand = Plus / Minus

                                                                       
Query: 349 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 408
           |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 556 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 497

                                                                       
Query: 409 aatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcctta 468
           ||||||||||||||||| || || |||   |||||||| || ||  | || |||||||||
Sbjct: 496 aatccagtcttgatctgacccaggagactgtcatcagttgggagtctaagatcatcctta 437

                                                                       
Query: 469 gtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctga 528
           ||||| ||||||||||| || ||||| ||  ||||||| || | ||||||||||||||| 
Sbjct: 436 gtgttaccactctcagtaagaaggctcacgaatccatcctctgatatgtcaatcagctgg 377

                                                                       
Query: 529 taatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctca 588
           || |||  |||||  ||||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 376 tactctgtgcggttcacatgtggaacatcacagttgtgggacgaaggaacaatatcctca 317

                                                       
Query: 589 agcttctttccattaaagatgtcaatggcaacaaagtggcactt 632
           ||||| || ||||| || || || |||||||||||||| |||||
Sbjct: 316 agctttttaccattgaatatatctatggcaacaaagtgacactt 273



to top

>emb|AJ238624.1|SVE238624 Senecio vernalis mRNA for translation initiation factor 5A
           precursor protein eIF-5A (eifsv1 gene)
          Length = 480

 Score =  167 bits (84), Expect = 6e-38
 Identities = 195/232 (84%)
 Strand = Plus / Minus

                                                                       
Query: 407 caaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcct 466
           ||||||||  ||||||||||  ||| ||| |||||||||| || ||||||||||||||||
Sbjct: 394 caaatccatccttgatctgggtaagaagagcatcatcagttggcagcttcaggtcatcct 335

                                                                       
Query: 467 tagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagct 526
           | ||||| ||| | ||||||||||  || ||| ||||||| ||||  || ||||| ||||
Sbjct: 334 tggtgttaccattttcagtcagcaaactcacaaatccatcctcagaaatatcaattagct 275

                                                                       
Query: 527 gataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcct 586
           | |||||    ||||  ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 274 ggtaatcagtacggttgacatgaggaacatcacaattgtgggaagatggaacaatatctt 215

                                                               
Query: 587 caagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtg 638
           |||||||||||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 214 caagcttctttccattaaagatgtcaatagcaacaaagtgacacttagcgtg 163



to top

>dbj|AK062134.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-E11, full
           insert sequence
          Length = 934

 Score =  167 bits (84), Expect = 6e-38
 Identities = 234/284 (82%)
 Strand = Plus / Minus

                                                                       
Query: 349 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 408
           |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 553 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 494

                                                                       
Query: 409 aatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcctta 468
           ||||||||||||||||| || || |||   |||||||| || ||  | || |||||||||
Sbjct: 493 aatccagtcttgatctgacccaggagactgtcatcagttgggagtctaagatcatcctta 434

                                                                       
Query: 469 gtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctga 528
           ||||| ||||||||||| || ||||| ||  ||||||| || | ||||||||||||||| 
Sbjct: 433 gtgttaccactctcagtaagaaggctcacgaatccatcctctgatatgtcaatcagctgg 374

                                                                       
Query: 529 taatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctca 588
           || |||  |||||  ||||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 373 tactctgtgcggttcacatgtggaacatcacagttgtgggacgaaggaacaatatcctca 314

                                                       
Query: 589 agcttctttccattaaagatgtcaatggcaacaaagtggcactt 632
           ||||| || ||||| || || || |||||||||||||| |||||
Sbjct: 313 agctttttaccattgaatatatctatggcaacaaagtgacactt 270



to top

>gb|AF094773.1|AF094773 Oryza sativa translation initiation factor 5A (eIF-5A) mRNA,
           complete cds
          Length = 822

 Score =  167 bits (84), Expect = 6e-38
 Identities = 234/284 (82%)
 Strand = Plus / Minus

                                                                       
Query: 349 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 408
           |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 549 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 490

                                                                       
Query: 409 aatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcctta 468
           ||||||||||||||||| || || |||   |||||||| || ||  | || |||||||||
Sbjct: 489 aatccagtcttgatctgacccaggagactgtcatcagttgggagtctaagatcatcctta 430

                                                                       
Query: 469 gtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctga 528
           ||||| ||||||||||| || ||||| ||  ||||||| || | ||||||||||||||| 
Sbjct: 429 gtgttaccactctcagtaagaaggctcacgaatccatcctctgatatgtcaatcagctgg 370

                                                                       
Query: 529 taatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctca 588
           || |||  |||||  ||||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 369 tactctgtgcggttcacatgtggaacatcacagttgtgggacgaaggaacaatatcctca 310

                                                       
Query: 589 agcttctttccattaaagatgtcaatggcaacaaagtggcactt 632
           ||||| || ||||| || || || |||||||||||||| |||||
Sbjct: 309 agctttttaccattgaatatatctatggcaacaaagtgacactt 266



to top

>gb|DQ279894.1| Lophopyrum elongatum translation initiation factor gene, partial
           cds
          Length = 1334

 Score =  165 bits (83), Expect = 2e-37
 Identities = 96/99 (96%), Gaps = 1/99 (1%)
 Strand = Plus / Minus

                                                                       
Query: 553 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 865 acgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtca 806

                                                  
Query: 613 atggcaacaaagtggcactttgcgtgggccatgcttccc 651
           ||||||||||||||||||||||||| | |||||||||||
Sbjct: 805 atggcaacaaagtggcactttgcgt-gaccatgcttccc 768



 Score =  139 bits (70), Expect = 1e-29
 Identities = 73/74 (98%)
 Strand = Plus / Minus

                                                                        
Query: 352  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1334 atctgttcttcacccatggcggacatcacagacaggatcaggtccttgccatcagcaaat 1275

                          
Query: 412  ccagtcttgatctg 425
            ||||||||||||||
Sbjct: 1274 ccagtcttgatctg 1261



 Score =  133 bits (67), Expect = 8e-28
 Identities = 73/75 (97%)
 Strand = Plus / Minus

                                                                        
Query: 423  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 482
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1114

                           
Query: 483  agtcagcaggctgac 497
            ||| || ||||||||
Sbjct: 1113 agttagaaggctgac 1099



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 496  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 551
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1013 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 958



to top

>dbj|AK103429.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128M07, full
           insert sequence
          Length = 996

 Score =  159 bits (80), Expect = 1e-35
 Identities = 233/284 (82%)
 Strand = Plus / Minus

                                                                       
Query: 349 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 408
           |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 556 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 497

                                                                       
Query: 409 aatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcctta 468
           |||||||||| |||||| || || |||   |||||||| || ||  | || |||||||||
Sbjct: 496 aatccagtctcgatctgacccaggagactgtcatcagttgggagtctaagatcatcctta 437

                                                                       
Query: 469 gtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctga 528
           ||||| ||||||||||| || ||||| ||  ||||||| || | ||||||||||||||| 
Sbjct: 436 gtgttaccactctcagtaagaaggctcacgaatccatcctctgatatgtcaatcagctgg 377

                                                                       
Query: 529 taatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctca 588
           || |||  |||||  ||||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 376 tactctgtgcggttcacatgtggaacatcacagttgtgggacgaaggaacaatatcctca 317

                                                       
Query: 589 agcttctttccattaaagatgtcaatggcaacaaagtggcactt 632
           ||||| || ||||| || || || |||||||||||||| |||||
Sbjct: 316 agctttttaccattgaatatatctatggcaacaaagtgacactt 273



to top

>gb|DQ279893.1| Pseudoroegneria spicata translation initiation factor gene, partial
           cds
          Length = 1358

 Score =  159 bits (80), Expect = 1e-35
 Identities = 93/96 (96%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                       
Query: 556 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 882 tcacagttgtgggatgaagggacaatatcctcaagcttctttccattaaagatgtcaatg 823

                                               
Query: 616 gcaacaaagtggcactttgcgtgggccatgcttccc 651
           |||||||||||||||||||||| | |||||||||||
Sbjct: 822 gcaacaaagtggcactttgcgt-gaccatgcttccc 788



 Score =  123 bits (62), Expect = 8e-25
 Identities = 71/74 (95%)
 Strand = Plus / Minus

                                                                        
Query: 352  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
            ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 1358 atctgttcttcacccattgcggacatcacagacaggatcaggtccttgccatcagcaaat 1299

                          
Query: 412  ccagtcttgatctg 425
            |||| |||||||||
Sbjct: 1298 ccagccttgatctg 1285



 Score =  101 bits (51), Expect = 3e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                        
Query: 423  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 482
            |||| |||||||| ||||||||||||||||||||||||||||||||||| |||| |||||
Sbjct: 1195 ctgggcaagcagagcatcatcagtgggaagcttcaggtcatccttagtgctgccgctctc 1136

                           
Query: 483  agtcagcaggctgac 497
            ||| || ||||||||
Sbjct: 1135 agttagaaggctgac 1121



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 496  acatatccatcatcagttatgtcaatcagctga 528
            |||||||||||||||||||||||||||||||||
Sbjct: 1037 acatatccatcatcagttatgtcaatcagctga 1005



to top

>gb|DQ414518.1| Dasypyrum breviaristatum eukaryotic translation initiation factor
           eIF5A gene, partial cds
          Length = 1344

 Score =  157 bits (79), Expect = 6e-35
 Identities = 95/99 (95%), Gaps = 1/99 (1%)
 Strand = Plus / Minus

                                                                       
Query: 553 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 878 acgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtca 819

                                                  
Query: 613 atggcaacaaagtggcactttgcgtgggccatgcttccc 651
           |||||||||||||| |||||||||| | |||||||||||
Sbjct: 818 atggcaacaaagtgacactttgcgt-gaccatgcttccc 781



 Score =  147 bits (74), Expect = 5e-32
 Identities = 74/74 (100%)
 Strand = Plus / Minus

                                                                        
Query: 352  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1344 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 1285

                          
Query: 412  ccagtcttgatctg 425
            ||||||||||||||
Sbjct: 1284 ccagtcttgatctg 1271



 Score =  141 bits (71), Expect = 3e-30
 Identities = 74/75 (98%)
 Strand = Plus / Minus

                                                                        
Query: 423  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 482
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1184 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1125

                           
Query: 483  agtcagcaggctgac 497
            |||||| ||||||||
Sbjct: 1124 agtcagaaggctgac 1110



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 496  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 551
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1026 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 971



to top

>gb|DQ279895.1| Eremopyrum bonaepartis translation initiation factor gene, partial
           cds
          Length = 1334

 Score =  157 bits (79), Expect = 6e-35
 Identities = 82/83 (98%)
 Strand = Plus / Minus

                                                                       
Query: 556 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 879 tcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtcaatg 820

                                  
Query: 616 gcaacaaagtggcactttgcgtg 638
           |||||||||||||||||||||||
Sbjct: 819 gcaacaaagtggcactttgcgtg 797



 Score =  125 bits (63), Expect = 2e-25
 Identities = 72/75 (96%)
 Strand = Plus / Minus

                                                                        
Query: 423  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 482
            ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1174 ctggccaagaagaacatcatcagtgggaagcttcaggtcatccttagtattgccactctc 1115

                           
Query: 483  agtcagcaggctgac 497
            |||||| ||||||||
Sbjct: 1114 agtcagaaggctgac 1100



 Score =  123 bits (62), Expect = 8e-25
 Identities = 71/74 (95%)
 Strand = Plus / Minus

                                                                        
Query: 352  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
            ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| 
Sbjct: 1334 atctgttcttcacccatcgcggacatcacagacaggatcaggtccttgccatcagcaaac 1275

                          
Query: 412  ccagtcttgatctg 425
            ||||||||||||||
Sbjct: 1274 ccagtcttgatctg 1261



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 496  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 551
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1016 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 961



to top

>gb|DQ279900.1| Haynaldia villosa translation initiation factor gene, partial cds
          Length = 1338

 Score =  149 bits (75), Expect = 1e-32
 Identities = 81/83 (97%)
 Strand = Plus / Minus

                                                                       
Query: 553 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 873 acgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtca 814

                                  
Query: 613 atggcaacaaagtggcactttgc 635
           |||||||||||||| ||||||||
Sbjct: 813 atggcaacaaagtgacactttgc 791



 Score =  143 bits (72), Expect = 8e-31
 Identities = 72/72 (100%)
 Strand = Plus / Minus

                                                                        
Query: 352  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1338 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 1279

                        
Query: 412  ccagtcttgatc 423
            ||||||||||||
Sbjct: 1278 ccagtcttgatc 1267



 Score =  135 bits (68), Expect = 2e-28
 Identities = 71/72 (98%)
 Strand = Plus / Minus

                                                                        
Query: 423  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 482
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1178 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1119

                        
Query: 483  agtcagcaggct 494
            |||||| |||||
Sbjct: 1118 agtcagaaggct 1107



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 496  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 551
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1021 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 966



to top

>gb|DQ279896.1| Aegilops tauschii translation initiation factor gene, partial cds
          Length = 1282

 Score =  149 bits (75), Expect = 1e-32
 Identities = 94/99 (94%), Gaps = 1/99 (1%)
 Strand = Plus / Minus

                                                                       
Query: 553 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
           |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 817 acgtcacagttgtgggatgaaggaacgatatcctcaagcttcttcccattaaagatgtca 758

                                                  
Query: 613 atggcaacaaagtggcactttgcgtgggccatgcttccc 651
           |||||||||||||| |||||||||| | |||||||||||
Sbjct: 757 atggcaacaaagtgacactttgcgt-gaccatgcttccc 720



 Score =  133 bits (67), Expect = 8e-28
 Identities = 73/75 (97%)
 Strand = Plus / Minus

                                                                        
Query: 423  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 482
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1121 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1062

                           
Query: 483  agtcagcaggctgac 497
            ||| || ||||||||
Sbjct: 1061 agtgagaaggctgac 1047



 Score =  131 bits (66), Expect = 3e-27
 Identities = 72/74 (97%)
 Strand = Plus / Minus

                                                                        
Query: 352  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
            ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 1282 atctgttcttcacccattgcggacatcacagacaggatcaggtccttgccatcagcaaat 1223

                          
Query: 412  ccagtcttgatctg 425
            ||||||||||||||
Sbjct: 1222 ccagtcttgatctg 1209



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                   
Query: 496 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 551
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 965 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 910



to top

>gb|DQ345329.1| Rosa chinensis eukaryotic translation initiation factor eIF5A mRNA,
           complete cds
          Length = 474

 Score =  145 bits (73), Expect = 2e-31
 Identities = 220/269 (81%)
 Strand = Plus / Minus

                                                                       
Query: 364 cccatggcagacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatc 423
           |||||||||||||| |||| ||  |  || |||||||| ||||||||||||  ||| | |
Sbjct: 437 cccatggcagacatgacagtcaccacaagatccttgccctcagcaaatccatccttaagc 378

                                                                       
Query: 424 tggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctca 483
           ||    |||||| ||||||||||||||||| |||| |||||||| ||||| ||| | |||
Sbjct: 377 tgagtgagcagagcatcatcagtgggaagcctcagatcatccttggtgtttccattttca 318

                                                                       
Query: 484 gtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtca 543
           ||||  || || ||| | ||||| ||||  || ||||||||||| || ||    ||||  
Sbjct: 317 gtcaagagactcacaaagccatcttcagagatatcaatcagctggtagtcagtacggttc 258

                                                                       
Query: 544 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 603
           ||||| ||||| ||||| |||||||||||||| |||||||||||||||||||| ||||| 
Sbjct: 257 acatgaggaacatcacaattgtgggatgaagggacaatatcctcaagcttcttgccattg 198

                                        
Query: 604 aagatgtcaatggcaacaaagtggcactt 632
           ||||| ||||| |||||||||||||||||
Sbjct: 197 aagatatcaattgcaacaaagtggcactt 169



to top

>gb|DQ279899.1| Crithopsis delileana translation initiation factor gene, partial cds
          Length = 1494

 Score =  143 bits (72), Expect = 8e-31
 Identities = 91/96 (94%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                        
Query: 556  tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
            |||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||
Sbjct: 1020 tcacagttgtgggatgaagggacgatatcctcaagtttctttccattaaagatgtcaatg 961

                                                
Query: 616  gcaacaaagtggcactttgcgtgggccatgcttccc 651
            |||||||||||||||||||||| | |||||||||||
Sbjct: 960  gcaacaaagtggcactttgcgt-gaccatgcttccc 926



 Score =  139 bits (70), Expect = 1e-29
 Identities = 73/74 (98%)
 Strand = Plus / Minus

                                                                        
Query: 352  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1494 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 1435

                          
Query: 412  ccagtcttgatctg 425
            |||| |||||||||
Sbjct: 1434 ccagccttgatctg 1421



 Score =  117 bits (59), Expect = 5e-23
 Identities = 71/75 (94%)
 Strand = Plus / Minus

                                                                        
Query: 423  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 482
            |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1333 ctgggcaagcagagcatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1274

                           
Query: 483  agtcagcaggctgac 497
            ||| || ||||||||
Sbjct: 1273 agttagaaggctgac 1259



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                    
Query: 496  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 551
            ||||||||||||||||| ||||||||||||||||||||  |||||  |||||||||
Sbjct: 1175 acatatccatcatcagtgatgtcaatcagctgataatccaggcgggtaacatgggg 1120



to top

>gb|AF516357.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform VIII (eIF-5A) mRNA, partial cds
          Length = 597

 Score =  137 bits (69), Expect = 5e-29
 Identities = 156/185 (84%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           |||||||| |||||| | ||||||||||| ||||| ||| ||||||||||||| ||||||
Sbjct: 359 tcatcagttggaagccttaggtcatccttggtgtttccattctcagtcagcagactgaca 300

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            ||||||| ||||  || |||||||||||||||||    |||  |||||||||||| |||
Sbjct: 299 aatccatcctcagagatatcaatcagctgataatcagtacgggtaacatggggaacatca 240

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           |||||||| || ||||| || ||||| ||||||||||| ||||| ||||| |||||  ||
Sbjct: 239 cagttgtgagaagaagggacgatatcttcaagcttcttgccattgaagatatcaattcca 180

                
Query: 619 acaaa 623
           |||||
Sbjct: 179 acaaa 175



to top

>dbj|AB004825.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A4,
           complete cds
          Length = 726

 Score =  137 bits (69), Expect = 5e-29
 Identities = 219/269 (81%)
 Strand = Plus / Minus

                                                                       
Query: 352 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
           |||||||| |||||||| || ||||| |||||||  |  ||||| || || |||||||| 
Sbjct: 492 atctgttcctcacccatagctgacataacagacacaacgaggtctttaccctcagcaaac 433

                                                                       
Query: 412 ccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtg 471
           |||  |||||||||   |||||||  |||||| || |||||| | ||||||||||| |||
Sbjct: 432 ccatccttgatctgtgaaagcagactatcatcggtaggaagcctgaggtcatccttggtg 373

                                                                       
Query: 472 ttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgataa 531
           || ||| | ||||| ||||| || ||| ||||||| ||||  |||||||| |||||||||
Sbjct: 372 ttaccattgtcagtgagcagactcacaaatccatcttcagagatgtcaataagctgataa 313

                                                                       
Query: 532 tcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagc 591
           |||  ||| | ||||||||| || ||||| ||||| || || || |||||||||||||||
Sbjct: 312 tctgtgcgattaacatggggcacatcacaattgtgagaagaggggacaatatcctcaagc 253

                                        
Query: 592 ttctttccattaaagatgtcaatggcaac 620
           ||||||||| | ||||| ||||| |||||
Sbjct: 252 ttctttccagtgaagatatcaatagcaac 224



to top

>emb|X63542.1|NPNEIF5A2 N.plumbaginifolia mRNA NeIF-5A2 for initiation factor 5A(2)
          Length = 1224

 Score =  135 bits (68), Expect = 2e-28
 Identities = 221/272 (81%)
 Strand = Plus / Minus

                                                                       
Query: 352 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
           ||||| || ||||||||||| ||||| |||||||  |  ||||| || || |||||||| 
Sbjct: 487 atctgctcctcacccatggctgacatgacagacacaacaaggtcttttccctcagcaaac 428

                                                                       
Query: 412 ccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtg 471
           |||  |||||||||   ||| ||   ||||||||| |||||| | ||||||||||| |||
Sbjct: 427 ccatccttgatctgtgtaaggaggttatcatcagtaggaagcctaaggtcatccttggtg 368

                                                                       
Query: 472 ttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgataa 531
           || ||| ||||||| ||||| || ||| ||||||| ||||  |||||||| |||||||||
Sbjct: 367 ttaccattctcagtgagcagactcacaaatccatcttcagaaatgtcaataagctgataa 308

                                                                       
Query: 532 tcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagc 591
           |||   || | ||| ||||| || ||||| ||||| || || ||||||||||||||||||
Sbjct: 307 tctgtacgattaacgtggggcacatcacaattgtgtgaagagggaacaatatcctcaagc 248

                                           
Query: 592 ttctttccattaaagatgtcaatggcaacaaa 623
           ||||||||| | ||||||||||| || |||||
Sbjct: 247 ttctttccagtgaagatgtcaatagcgacaaa 216



to top

>dbj|AK061867.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-H10, full
           insert sequence
          Length = 961

 Score =  135 bits (68), Expect = 2e-28
 Identities = 248/308 (80%)
 Strand = Plus / Minus

                                                                       
Query: 331 ccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatc 390
           ||||| |||||||  ||||||||||| || || |||||||||||||| |||| ||  | |
Sbjct: 573 ccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcaccacc 514

                                                                       
Query: 391 aggtccttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtggga 450
           |||||||| || ||  ||||||||  ||||||||| | ||||||   ||||||||| || 
Sbjct: 513 aggtccttcccttctccaaatccatccttgatctgactaagcaggttatcatcagtaggg 454

                                                                       
Query: 451 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 510
           ||| | ||||||||||| ||||||||| | ||||| | ||| || ||| ||||||| |||
Sbjct: 453 agcctgaggtcatccttggtgttgccattttcagttaacagactcacaaatccatcctca 394

                                                                       
Query: 511 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 570
           | ||| ||||| ||||| || ||    ||||  ||||| || || ||||||||||| || 
Sbjct: 393 gatatatcaatgagctggtactccgtacggttcacatgcgggacatcacagttgtgagaa 334

                                                                       
Query: 571 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 630
           || || |||||||| || ||||||||  || ||||||||||||| |||||||||||||||
Sbjct: 333 gatggcacaatatcttcgagcttcttggcagtaaagatgtcaattgcaacaaagtggcac 274

                   
Query: 631 tttgcgtg 638
           || |||||
Sbjct: 273 ttggcgtg 266



to top

>dbj|AK099039.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013131C14, full
           insert sequence
          Length = 981

 Score =  135 bits (68), Expect = 2e-28
 Identities = 248/308 (80%)
 Strand = Plus / Minus

                                                                       
Query: 331 ccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatc 390
           ||||| |||||||  ||||||||||| || || |||||||||||||| |||| ||  | |
Sbjct: 572 ccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcaccacc 513

                                                                       
Query: 391 aggtccttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtggga 450
           |||||||| || ||  ||||||||  ||||||||| | ||||||   ||||||||| || 
Sbjct: 512 aggtccttcccttctccaaatccatccttgatctgactaagcaggttatcatcagtaggg 453

                                                                       
Query: 451 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 510
           ||| | ||||||||||| ||||||||| | ||||| | ||| || ||| ||||||| |||
Sbjct: 452 agcctgaggtcatccttggtgttgccattttcagttaacagactcacaaatccatcctca 393

                                                                       
Query: 511 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 570
           | ||| ||||| ||||| || ||    ||||  ||||| || || ||||||||||| || 
Sbjct: 392 gatatatcaatgagctggtactccgtacggttcacatgcgggacatcacagttgtgagaa 333

                                                                       
Query: 571 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 630
           || || |||||||| || ||||||||  || ||||||||||||| |||||||||||||||
Sbjct: 332 gatggcacaatatcttcgagcttcttggcagtaaagatgtcaattgcaacaaagtggcac 273

                   
Query: 631 tttgcgtg 638
           || |||||
Sbjct: 272 ttggcgtg 265



to top

>gb|DQ279898.1| Psathyrostachys juncea translation initiation factor gene, partial
           cds
          Length = 1375

 Score =  135 bits (68), Expect = 2e-28
 Identities = 77/80 (96%)
 Strand = Plus / Minus

                                                                       
Query: 553 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
           ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 912 acgtcacagttgtgggatgaaggaacaatatcctccagcttctttccattgaagatgtca 853

                               
Query: 613 atggcaacaaagtggcactt 632
           |||||||||||||| |||||
Sbjct: 852 atggcaacaaagtgacactt 833



 Score =  131 bits (66), Expect = 3e-27
 Identities = 72/74 (97%)
 Strand = Plus / Minus

                                                                        
Query: 352  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1375 atctgttcttcacccatggcggacatcacagacaggatcaggtccttgccatcagcaaat 1316

                          
Query: 412  ccagtcttgatctg 425
            ||||||| ||||||
Sbjct: 1315 ccagtctcgatctg 1302



 Score =  109 bits (55), Expect = 1e-20
 Identities = 70/75 (93%)
 Strand = Plus / Minus

                                                                        
Query: 423  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 482
            |||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1214 ctgggcaagcagagcatcatcagtgggaagcttcaggtcatccttagtgctgccactctc 1155

                           
Query: 483  agtcagcaggctgac 497
            ||| || ||||||||
Sbjct: 1154 agttagaaggctgac 1140



 Score =  101 bits (51), Expect = 3e-18
 Identities = 57/59 (96%)
 Strand = Plus / Minus

                                                                       
Query: 496  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaac 554
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 1058 acatatccatcatcagttatgtcaatcagttgataatcttggcggtcaacatgaggaac 1000



to top

>gb|DQ200358.1| Solanum tuberosum clone 053D09 eukaryotic initiation factor
           5A4-like protein mRNA, complete cds
          Length = 790

 Score =  129 bits (65), Expect = 1e-26
 Identities = 218/269 (81%)
 Strand = Plus / Minus

                                                                       
Query: 352 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
           |||||||| |||||||| || ||||| |||||||  |  ||||| || || |||||||| 
Sbjct: 497 atctgttcctcacccatagctgacataacagacacaacgaggtctttaccctcagcaaac 438

                                                                       
Query: 412 ccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtg 471
           |||  |||||||||   |||||||  |||||| || |||||| | ||||||||||| |||
Sbjct: 437 ccatccttgatctgtgaaagcagactatcatcggtaggaagcctgaggtcatccttggtg 378

                                                                       
Query: 472 ttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgataa 531
           || ||| | ||||| ||||| || ||| ||||||| ||||  |||||||| |||||||||
Sbjct: 377 ttaccattgtcagtgagcagactcacaaatccatcttcagagatgtcaataagctgataa 318

                                                                       
Query: 532 tcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagc 591
           |||  ||| | ||||||||| || ||||| ||||| || || || |||||||||||||||
Sbjct: 317 tctgtgcgattaacatggggcacatcacaattgtgagaagaggggacaatatcctcaagc 258

                                        
Query: 592 ttctttccattaaagatgtcaatggcaac 620
            |||||||| | ||||| ||||| |||||
Sbjct: 257 ctctttccagtgaagatatcaatagcaac 229



to top

>gb|DQ083198.1| Oryza sativa (indica cultivar-group) clone 5S10E11 mRNA sequence
          Length = 371

 Score =  123 bits (62), Expect = 8e-25
 Identities = 161/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 337 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 396
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 200 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 141

                                                                       
Query: 397 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 456
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 140 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 81

                                                                       
Query: 457 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 516
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 80  aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 21

                         
Query: 517 tcaatcagctgata 530
           ||||||||||||||
Sbjct: 20  tcaatcagctgata 7



to top

>gb|AY484392.1| Capsicum annuum eukaryotic initiation factor 5A2 (eIF5A2) mRNA,
           complete cds
          Length = 718

 Score =  117 bits (59), Expect = 5e-23
 Identities = 239/299 (79%)
 Strand = Plus / Minus

                                                                       
Query: 337 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 396
           ||||||||||| || ||||||||||||||||| ||||||||||| ||||| |  || |||
Sbjct: 493 tccttcacagcacaaatctgttcttcacccattgcagacatcaccgacagcacgagatcc 434

                                                                       
Query: 397 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 456
           || || ||  ||||||||   || | |||||  |||||    ||||| ||||||||| | 
Sbjct: 433 tttccttcctcaaatccacctttaacctggctcagcagggtgtcatcggtgggaagcctg 374

                                                                       
Query: 457 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 516
           |||||||| || ||||| ||| | ||||| || ||    ||| | ||||| ||||  |||
Sbjct: 373 aggtcatctttggtgttaccattttcagtaagaagagacacaaaaccatcttcagagatg 314

                                                                       
Query: 517 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 576
           |||||||||||||| |||   ||||  ||||| || || ||||| ||||| |||||||||
Sbjct: 313 tcaatcagctgatagtctgtacggttgacatgtggcacatcacaattgtgagatgaagga 254

                                                                      
Query: 577 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgc 635
           |||||||| ||||||||||||||||| || |||||||| || |||||||| || |||||
Sbjct: 253 acaatatcttcaagcttctttccattgaaaatgtcaattgccacaaagtgacattttgc 195



to top

>gb|AY484391.1| Capsicum annuum mary storys protein mRNA, complete cds
          Length = 718

 Score =  117 bits (59), Expect = 5e-23
 Identities = 239/299 (79%)
 Strand = Plus / Minus

                                                                       
Query: 337 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 396
           ||||||||||| || ||||||||||||||||| ||||||||||| ||||| |  || |||
Sbjct: 493 tccttcacagcacaaatctgttcttcacccattgcagacatcaccgacagcacgagatcc 434

                                                                       
Query: 397 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 456
           || || ||  ||||||||   || | |||||  |||||    ||||| ||||||||| | 
Sbjct: 433 tttccttcctcaaatccacctttaacctggctcagcagggtgtcatcggtgggaagcctg 374

                                                                       
Query: 457 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 516
           |||||||| || ||||| ||| | ||||| || ||    ||| | ||||| ||||  |||
Sbjct: 373 aggtcatctttggtgttaccattttcagtaagaagagacacaaaaccatcttcagagatg 314

                                                                       
Query: 517 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 576
           |||||||||||||| |||   ||||  ||||| || || ||||| ||||| |||||||||
Sbjct: 313 tcaatcagctgatagtctgtacggttgacatgtggcacatcacaattgtgagatgaagga 254

                                                                      
Query: 577 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgc 635
           |||||||| ||||||||||||||||| || |||||||| || |||||||| || |||||
Sbjct: 253 acaatatcttcaagcttctttccattgaaaatgtcaattgccacaaagtgacattttgc 195



to top

>gb|AF516358.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform IX (eIF-5A) mRNA, partial cds
          Length = 285

 Score =  117 bits (59), Expect = 5e-23
 Identities = 128/151 (84%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           |||||||| |||||| ||||||||||||| ||||| ||| ||||||||||||| || |||
Sbjct: 151 tcatcagttggaagcctcaggtcatccttggtgtttccattctcagtcagcagactcaca 92

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            ||||||| ||||  || |||||||||||||||||   ||||  |||||||||||| |||
Sbjct: 91  aatccatcctcagagatatcaatcagctgataatcagtgcgggtaacatggggaacatca 32

                                          
Query: 559 cagttgtgggatgaaggaacaatatcctcaa 589
           |||||||| || ||||| || ||||| ||||
Sbjct: 31  cagttgtgagaagaagggacgatatcttcaa 1



to top

>gb|AF296085.1|AF296085 Lycopersicon esculentum eukaryotic translation initiation factor
           5A-3 mRNA, complete cds
          Length = 713

 Score =  115 bits (58), Expect = 2e-22
 Identities = 151/182 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           |||||||| |||||| | ||||||||||| ||||| ||| | ||||| ||||| || |||
Sbjct: 413 tcatcagtaggaagcctgaggtcatccttggtgttaccattgtcagtaagcagactcaca 354

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            ||||||| ||||  |||||||| ||||||||||||   || | ||||||||| || |||
Sbjct: 353 aatccatcttcagagatgtcaataagctgataatctgtacgattaacatggggcacatca 294

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || ||||| || || || |||||||||||||||||||| ||| | ||||||||||| |||
Sbjct: 293 caattgtgtgaagaggggacaatatcctcaagcttcttcccagtgaagatgtcaatagca 234

             
Query: 619 ac 620
           ||
Sbjct: 233 ac 232



to top

>emb|Y07920.1|ZMTRINF5A Z.mays mRNA for translation initiation factor 5A
          Length = 807

 Score =  107 bits (54), Expect = 5e-20
 Identities = 159/190 (83%), Gaps = 3/190 (1%)
 Strand = Plus / Minus

                                                                       
Query: 460 tcatccttagtgttgccactctca-gtcagcaggctgacatatccatcatcagttatgtc 518
           |||||||||||||||||| ||| | || || ||||| ||| ||||||| ||||  || ||
Sbjct: 418 tcatccttagtgttgcca-tctgaagtaagaaggctcacaaatccatcctcagaaatatc 360

                                                                       
Query: 519 aatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaac 578
           |||||||||||| ||    ||||  ||||| |||| |||||||||||| |||||||||||
Sbjct: 359 aatcagctgatactcagtacggttcacatgcggaatgtcacagttgtgtgatgaaggaac 300

                                                                       
Query: 579 aatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtg 638
           |||||| |||||||| || ||||| || ||||| ||||| ||||||||||| || |||| 
Sbjct: 299 aatatcttcaagctttttcccattgaatatgtctatggcgacaaagtggcatttggcgt- 241

                     
Query: 639 ggccatgctt 648
           ||||||||||
Sbjct: 240 ggccatgctt 231



to top

>emb|X59441.1|MSEIF4DMR M.sativa mRNA for eIF-4D
          Length = 741

 Score =  107 bits (54), Expect = 5e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 328 ccaccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacagg 387
           ||||| || ||||||| ||| |||||||| || |||||||| ||||||||||| || |  
Sbjct: 593 ccaccaatatccttcaaagcacagatctgctcctcacccatagcagacatcacggataca 534

                                                                       
Query: 388 atcaggtccttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtg 447
           |  |||||||| || ||||||||||||  |||||||||    ||||||   ||||| |||
Sbjct: 533 acaaggtcctttccctcagcaaatccatccttgatctgagtgagcagactgtcatcggtg 474

                                                                       
Query: 448 ggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatca 507
           ||||| || ||||||||||||||||| ||| | ||||| |||| ||| ||| ||||||| 
Sbjct: 473 ggaagtttgaggtcatccttagtgtttccattttcagtgagcaagctcacaaatccatct 414

                                     
Query: 508 tcagttatgtcaatcagctgataatc 533
           ||||  |||||||| |||||||||||
Sbjct: 413 tcagaaatgtcaatgagctgataatc 388



to top

>gb|AF266464.1|AF266464 Manihot esculenta translation initiation factor 5A mRNA, complete
           cds
          Length = 1288

 Score =  107 bits (54), Expect = 5e-20
 Identities = 159/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           ||||| ||||||||| | || || ||||| ||||| ||| | |||||||| || || |||
Sbjct: 432 tcatcggtgggaagcctgagatcgtccttggtgtttccagtttcagtcagaagactcaca 373

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            | ||||| ||||  || |||||||||||||||||    |||| |||||| ||||| |||
Sbjct: 372 aaaccatcttcagagatatcaatcagctgataatcagtacggttaacatgaggaacatca 313

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || ||||||||||||||||||||||| ||||| || |||||||| || || |||||  ||
Sbjct: 312 caattgtgggatgaaggaacaatatcttcaagtttttttccattgaatatatcaattcca 253

                         
Query: 619 acaaagtggcactt 632
           ||||| ||||||||
Sbjct: 252 acaaaatggcactt 239



to top

>gb|AF323604.1|AF323604 Manihot esculenta initiation factor eIF5-A mRNA, complete cds
          Length = 925

 Score =  107 bits (54), Expect = 5e-20
 Identities = 159/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           ||||| ||||||||| | || || ||||| ||||| ||| | |||||||| || || |||
Sbjct: 412 tcatcggtgggaagcctgagatcgtccttggtgtttccagtttcagtcagaagactcaca 353

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            | ||||| ||||  || |||||||||||||||||    |||| |||||| ||||| |||
Sbjct: 352 aaaccatcttcagagatatcaatcagctgataatcagtacggttaacatgaggaacatca 293

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || ||||||||||||||||||||||| ||||| || |||||||| || || |||||  ||
Sbjct: 292 caattgtgggatgaaggaacaatatcttcaagtttttttccattgaatatatcaattcca 233

                         
Query: 619 acaaagtggcactt 632
           ||||| ||||||||
Sbjct: 232 acaaaatggcactt 219



to top

>gb|AY103556.1| Zea mays PCO150862 mRNA sequence
          Length = 966

 Score =  107 bits (54), Expect = 5e-20
 Identities = 159/190 (83%), Gaps = 3/190 (1%)
 Strand = Plus / Minus

                                                                       
Query: 460 tcatccttagtgttgccactctca-gtcagcaggctgacatatccatcatcagttatgtc 518
           |||||||||||||||||| ||| | || || ||||| ||| ||||||| ||||  || ||
Sbjct: 531 tcatccttagtgttgcca-tctgaagtaagaaggctcacaaatccatcctcagaaatatc 473

                                                                       
Query: 519 aatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaac 578
           |||||||||||| ||    ||||  ||||| |||| |||||||||||| |||||||||||
Sbjct: 472 aatcagctgatactcagtacggttcacatgcggaatgtcacagttgtgtgatgaaggaac 413

                                                                       
Query: 579 aatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtg 638
           |||||| |||||||| || ||||| || ||||| ||||| ||||||||||| || |||| 
Sbjct: 412 aatatcttcaagctttttcccattgaatatgtctatggcgacaaagtggcatttggcgt- 354

                     
Query: 639 ggccatgctt 648
           ||||||||||
Sbjct: 353 ggccatgctt 344



to top

>gb|AF296081.1|AF296081 Dianthus caryophyllus eukaryotic translation initiation factor 5A
           mRNA, complete cds
          Length = 810

 Score =  103 bits (52), Expect = 7e-19
 Identities = 154/188 (81%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           |||||||  ||||||||||| |||||||| ||||  ||||| ||||||||||| || |||
Sbjct: 428 tcatcagcaggaagcttcagatcatccttggtgtcaccactgtcagtcagcagactaaca 369

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            | ||||| ||||| || |||| |||||| || ||    ||||  ||||| ||||| |||
Sbjct: 368 aagccatcttcagtgatatcaagcagctggtagtcgacacggttgacatgtggaacatca 309

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || ||||||||||| || |||||||| || |||||||| || || || ||||||||||||
Sbjct: 308 caattgtgggatgaggggacaatatcttccagcttcttgccgttgaaaatgtcaatggca 249

                   
Query: 619 acaaagtg 626
           ||||||||
Sbjct: 248 acaaagtg 241



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 60/73 (82%)
 Strand = Plus / Minus

                                                                       
Query: 319 tacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacatc 378
           |||||||||||||  |  ||||| || ||||||||||| ||||| ||||| ||| |||| 
Sbjct: 548 tacttgccaccactaacgtccttgacggcgcagatctgctcttctcccattgcacacatg 489

                        
Query: 379 acagacaggatca 391
           || ||||| ||||
Sbjct: 488 actgacagaatca 476



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  101 bits (51), Expect = 3e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                            
Query: 553      acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
                ||||||||||||||||| || || |||||||| ||||||||||| ||||| |||||||||
Sbjct: 31085889 acgtcacagttgtgggaggagggcacaatatcttcaagcttcttcccattgaagatgtca 31085830

                                       
Query: 613      atggcaacaaagtggcactttgc 635
                ||||| ||||||||||| |||||
Sbjct: 31085829 atggccacaaagtggcattttgc 31085807



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                            
Query: 337      tccttcacagcgcagatctgttcttcacccatggcagacatcac 380
                ||||||| |||||||||||| || ||||||||||||||||||||
Sbjct: 31086565 tccttcagagcgcagatctgctcctcacccatggcagacatcac 31086522



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                            
Query: 429      aagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcag 488
                ||||||| | |||||| | || ||| |||||||||||||||||   ||||| ||||||||
Sbjct: 31086382 aagcagagcctcatcactagggagcctcaggtcatccttagtgcctccactttcagtcag 31086323

                         
Query: 489      caggctgac 497
                 ||||||||
Sbjct: 31086322 gaggctgac 31086314



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                  
Query: 500      atccatcatcagttatgtcaatcagctgataatc 533
                ||||||| ||||  ||||||||||||||||||||
Sbjct: 31086027 atccatcttcagaaatgtcaatcagctgataatc 31085994



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 139      agatagatagatagataacaaa 160
                ||||||||||||||||||||||
Sbjct: 25712037 agatagatagatagataacaaa 25712058



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 137      agagatagatagatagataac 157
                |||||||||||||||||||||
Sbjct: 18170243 agagatagatagatagataac 18170263



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 131      tataatagagatagatagatagat 154
                ||||||||| ||||||||||||||
Sbjct: 22470462 tataatagaaatagatagatagat 22470439



to top

>gb|AC079887.17| Oryza sativa (japonica cultivar-group) chromosome 3 BAC OSJNBa0040E01
             genomic sequence, complete sequence
          Length = 168759

 Score =  101 bits (51), Expect = 3e-18
 Identities = 75/83 (90%)
 Strand = Plus / Plus

                                                                         
Query: 553   acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
             ||||||||||||||||| || || |||||||| ||||||||||| ||||| |||||||||
Sbjct: 10175 acgtcacagttgtgggaggagggcacaatatcttcaagcttcttcccattgaagatgtca 10234

                                    
Query: 613   atggcaacaaagtggcactttgc 635
             ||||| ||||||||||| |||||
Sbjct: 10235 atggccacaaagtggcattttgc 10257



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                        
Query: 337  tccttcacagcgcagatctgttcttcacccatggcagacatcac 380
            ||||||| |||||||||||| || ||||||||||||||||||||
Sbjct: 9499 tccttcagagcgcagatctgctcctcacccatggcagacatcac 9542



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 58/69 (84%)
 Strand = Plus / Plus

                                                                        
Query: 429  aagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcag 488
            ||||||| | |||||| | || ||| |||||||||||||||||   ||||| ||||||||
Sbjct: 9682 aagcagagcctcatcactagggagcctcaggtcatccttagtgcctccactttcagtcag 9741

                     
Query: 489  caggctgac 497
             ||||||||
Sbjct: 9742 gaggctgac 9750



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 500   atccatcatcagttatgtcaatcagctgataatc 533
             ||||||| ||||  ||||||||||||||||||||
Sbjct: 10037 atccatcttcagaaatgtcaatcagctgataatc 10070



to top

>gb|AC084282.6| Oryza sativa chromosome 3 BAC OSJNBb0048A17 genomic sequence,
            complete sequence
          Length = 128017

 Score =  101 bits (51), Expect = 3e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                        
Query: 553  acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
            ||||||||||||||||| || || |||||||| ||||||||||| ||||| |||||||||
Sbjct: 6530 acgtcacagttgtgggaggagggcacaatatcttcaagcttcttcccattgaagatgtca 6471

                                   
Query: 613  atggcaacaaagtggcactttgc 635
            ||||| ||||||||||| |||||
Sbjct: 6470 atggccacaaagtggcattttgc 6448



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 337  tccttcacagcgcagatctgttcttcacccatggcagacatcac 380
            ||||||| |||||||||||| || ||||||||||||||||||||
Sbjct: 7206 tccttcagagcgcagatctgctcctcacccatggcagacatcac 7163



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                        
Query: 429  aagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcag 488
            ||||||| | |||||| | || ||| |||||||||||||||||   ||||| ||||||||
Sbjct: 7023 aagcagagcctcatcactagggagcctcaggtcatccttagtgcctccactttcagtcag 6964

                     
Query: 489  caggctgac 497
             ||||||||
Sbjct: 6963 gaggctgac 6955



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 500  atccatcatcagttatgtcaatcagctgataatc 533
            ||||||| ||||  ||||||||||||||||||||
Sbjct: 6668 atccatcttcagaaatgtcaatcagctgataatc 6635



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
              complete sequence
          Length = 29644043

 Score =  101 bits (51), Expect = 3e-18
 Identities = 88/99 (88%), Gaps = 1/99 (1%)
 Strand = Plus / Minus

                                                                          
Query: 553    acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
              |||||||||||||||||||| || |||||||| ||||||||||||||||| || ||||||
Sbjct: 703558 acgtcacagttgtgggatgaggggacaatatcttcaagcttctttccattgaaaatgtca 703499

                                                     
Query: 613    atggcaacaaagtggcactttgcgtgggccatgcttccc 651
              ||  ||||||||||||| || |||| | |||||||||||
Sbjct: 703498 ataccaacaaagtggcatttggcgt-gaccatgcttccc 703461



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 69/77 (89%)
 Strand = Plus / Plus

                                                                            
Query: 556      tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
                |||||||||||||| ||||||||||||||||||||||| || ||||| || || || |||
Sbjct: 24265904 tcacagttgtgggacgaaggaacaatatcctcaagctttttaccattgaatatatctatg 24265963

                                 
Query: 616      gcaacaaagtggcactt 632
                ||||||||||| |||||
Sbjct: 24265964 gcaacaaagtgacactt 24265980



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 160/196 (81%), Gaps = 5/196 (2%)
 Strand = Plus / Minus

                                                                           
Query: 394     tccttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagc 453
               |||||||| ||| |||||||||||||||||||||| || |||   |||| ||| || || 
Sbjct: 7610155 tccttgccttcaccaaatccagtcttgatctggcccaggagattgtcataagttgggagt 7610096

                                                                           
Query: 454     ttcaggtcatccttagtgttgccactctcagtcagcaggctgac--ata-tccatcatca 510
                  || |||||||||||||| || |||||||| || ||||| ||  ||| |||||| || 
Sbjct: 7610095 ccaagatcatccttagtgttaccgctctcagtaagaaggctcacgaataatccatcctct 7610036

                                                                           
Query: 511     gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 570
               | ||||||||||||||| |||| |   ||||   |||| ||||| |||||||||||||||
Sbjct: 7610035 gatatgtcaatcagctggtaatttgtacggtt--catgtggaacatcacagttgtgggat 7609978

                               
Query: 571     gaaggaacaatatcct 586
               ||||||||||||||||
Sbjct: 7609977 gaaggaacaatatcct 7609962



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                                
Query: 438    atcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtca 487
              |||||||||||||||| ||| |||||||||||||||||| ||||||||||
Sbjct: 703856 atcatcagtgggaagcctcaagtcatccttagtgttgccgctctcagtca 703807



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 349    cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcc 401
              ||||||||||||||||||||||| |||||||||| || |||||  ||||||||
Sbjct: 704181 cagatctgttcttcacccatggcggacatcacagtcaagatcatatccttgcc 704129



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 108/130 (83%), Gaps = 5/130 (3%)
 Strand = Plus / Minus

                                                                           
Query: 460     tcatccttagtgttgccactctcagtcagcaggctgac--ata-tccatcatcagttatg 516
               |||||||||||||| || |||||||| || ||||| ||  ||| |||||| || | ||||
Sbjct: 7605336 tcatccttagtgttaccgctctcagtaagaaggctcacgaataatccatcctctgatatg 7605277

                                                                           
Query: 517     tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 576
               ||||||||||| |||| |   ||||   |||| ||||| |||||||||||||||||| ||
Sbjct: 7605276 tcaatcagctggtaatttgtacggtt--catgtggaacatcacagttgtgggatgaatga 7605219

                         
Query: 577     acaatatcct 586
               ||||||||||
Sbjct: 7605218 acaatatcct 7605209



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                            
Query: 349      cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 408
                |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 24264562 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 24264621

                                 
Query: 409      aatccagtcttgatctg 425
                |||||||||||||||||
Sbjct: 24264622 aatccagtcttgatctg 24264638



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                   
Query: 460      tcatccttagtgttgccactctcagtcagcaggct 494
                |||||||||||||| ||||||||||| || |||||
Sbjct: 24265579 tcatccttagtgttaccactctcagtaagaaggct 24265613



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 131      tataatagagatagatagatagata 155
                ||||||||| |||||||||||||||
Sbjct: 17717912 tataatagaaatagatagatagata 17717888



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 131      tataatagagatagatagatagata 155
                ||||||||| |||||||||||||||
Sbjct: 16008454 tataatagaaatagatagatagata 16008430



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 394     tccttgccatcagcaaatccagtcttgatctg 425
               |||||||| | | |||||||||||||||||||
Sbjct: 7605401 tccttgccttaaccaaatccagtcttgatctg 7605370



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  101 bits (51), Expect = 3e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                            
Query: 553      acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
                ||||||||||||||||| || || |||||||| ||||||||||| ||||| |||||||||
Sbjct: 31176412 acgtcacagttgtgggaggagggcacaatatcttcaagcttcttcccattgaagatgtca 31176353

                                       
Query: 613      atggcaacaaagtggcactttgc 635
                ||||| ||||||||||| |||||
Sbjct: 31176352 atggccacaaagtggcattttgc 31176330



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                            
Query: 337      tccttcacagcgcagatctgttcttcacccatggcagacatcac 380
                ||||||| |||||||||||| || ||||||||||||||||||||
Sbjct: 31177088 tccttcagagcgcagatctgctcctcacccatggcagacatcac 31177045



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                            
Query: 429      aagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcag 488
                ||||||| | |||||| | || ||| |||||||||||||||||   ||||| ||||||||
Sbjct: 31176905 aagcagagcctcatcactagggagcctcaggtcatccttagtgcctccactttcagtcag 31176846

                         
Query: 489      caggctgac 497
                 ||||||||
Sbjct: 31176845 gaggctgac 31176837



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                  
Query: 500      atccatcatcagttatgtcaatcagctgataatc 533
                ||||||| ||||  ||||||||||||||||||||
Sbjct: 31176550 atccatcttcagaaatgtcaatcagctgataatc 31176517



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 139      agatagatagatagataacaaa 160
                ||||||||||||||||||||||
Sbjct: 25803346 agatagatagatagataacaaa 25803367



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 137      agagatagatagatagataac 157
                |||||||||||||||||||||
Sbjct: 18163784 agagatagatagatagataac 18163804



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 131      tataatagagatagatagatagat 154
                ||||||||| ||||||||||||||
Sbjct: 22463491 tataatagaaatagatagatagat 22463468



to top

>dbj|AP003874.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1118_G09
          Length = 115815

 Score =  101 bits (51), Expect = 3e-18
 Identities = 88/99 (88%), Gaps = 1/99 (1%)
 Strand = Plus / Minus

                                                                         
Query: 553   acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
             |||||||||||||||||||| || |||||||| ||||||||||||||||| || ||||||
Sbjct: 42089 acgtcacagttgtgggatgaggggacaatatcttcaagcttctttccattgaaaatgtca 42030

                                                    
Query: 613   atggcaacaaagtggcactttgcgtgggccatgcttccc 651
             ||  ||||||||||||| || |||| | |||||||||||
Sbjct: 42029 ataccaacaaagtggcatttggcgt-gaccatgcttccc 41992



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                               
Query: 438   atcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtca 487
             |||||||||||||||| ||| |||||||||||||||||| ||||||||||
Sbjct: 42387 atcatcagtgggaagcctcaagtcatccttagtgttgccgctctcagtca 42338



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                  
Query: 349   cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcc 401
             ||||||||||||||||||||||| |||||||||| || |||||  ||||||||
Sbjct: 42712 cagatctgttcttcacccatggcggacatcacagtcaagatcatatccttgcc 42660



to top

>dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1513_F02
          Length = 126845

 Score =  101 bits (51), Expect = 3e-18
 Identities = 88/99 (88%), Gaps = 1/99 (1%)
 Strand = Plus / Minus

                                                                         
Query: 553   acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 612
             |||||||||||||||||||| || |||||||| ||||||||||||||||| || ||||||
Sbjct: 23365 acgtcacagttgtgggatgaggggacaatatcttcaagcttctttccattgaaaatgtca 23306

                                                    
Query: 613   atggcaacaaagtggcactttgcgtgggccatgcttccc 651
             ||  ||||||||||||| || |||| | |||||||||||
Sbjct: 23305 ataccaacaaagtggcatttggcgt-gaccatgcttccc 23268



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                               
Query: 438   atcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtca 487
             |||||||||||||||| ||| |||||||||||||||||| ||||||||||
Sbjct: 23663 atcatcagtgggaagcctcaagtcatccttagtgttgccgctctcagtca 23614



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                  
Query: 349   cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcc 401
             ||||||||||||||||||||||| |||||||||| || |||||  ||||||||
Sbjct: 23988 cagatctgttcttcacccatggcggacatcacagtcaagatcatatccttgcc 23936



to top

>gb|AY488173.1| Capsicum annuum M1C3b mRNA, partial sequence
          Length = 457

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 104/122 (85%)
 Strand = Plus / Minus

                                                                       
Query: 514 atgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaa 573
           ||||||||||||||||| |||   ||||  ||||| || || ||||| ||||| ||||||
Sbjct: 325 atgtcaatcagctgatagtctgtacggttgacatgtggcacatcacaattgtgagatgaa 266

                                                                       
Query: 574 ggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcacttt 633
           ||||||||||| ||||||||||||||||| || |||||||| || |||||||| || |||
Sbjct: 265 ggaacaatatcttcaagcttctttccattgaaaatgtcaattgccacaaagtgacatttt 206

             
Query: 634 gc 635
           ||
Sbjct: 205 gc 204



to top

>gb|AF516353.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform IV (eIF-5A) mRNA, complete cds
          Length = 772

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 158/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           ||||| ||||||||| | || |||||||| ||||| ||||| |||||||| || || |||
Sbjct: 391 tcatcggtgggaagcctgagatcatccttggtgtttccactttcagtcagaagactcaca 332

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            | ||||| ||||  || |||||||||||||||||    || | |||||||||| | |||
Sbjct: 331 aaaccatcttcagagatatcaatcagctgataatcagtacgattaacatggggagcatca 272

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || ||||||||||||||||||||||| ||||| || ||| || | || || |||||  ||
Sbjct: 271 caattgtgggatgaaggaacaatatcttcaagtttttttgcagtgaatatatcaattcca 212

                         
Query: 619 acaaagtggcactt 632
           || |||||||||||
Sbjct: 211 acgaagtggcactt 198



to top

>gb|AF516352.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform III (eIF-5A) mRNA, complete cds
          Length = 781

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 158/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           ||||| ||||||||| |||| ||||| || ||||| ||| | |||||||| || || |||
Sbjct: 387 tcatcggtgggaagcctcagatcatctttggtgtttccattttcagtcagaagactcaca 328

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            | ||||| ||||  || |||||||||||||||||    || | |||||| ||||| |||
Sbjct: 327 aagccatcttcagagatatcaatcagctgataatcagtacgattaacatgaggaacatca 268

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || ||||||||||||||||||||||| ||||| || ||| |||| || || |||||  ||
Sbjct: 267 caattgtgggatgaaggaacaatatcttcaagtttttttgcattgaatatatcaattcca 208

                         
Query: 619 acaaagtggcactt 632
           || |||||||||||
Sbjct: 207 acgaagtggcactt 194



to top

>gb|AF516351.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform II (eIF-5A) mRNA, complete cds
          Length = 828

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 158/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           ||||| ||||||||| |||| ||||| || ||||| ||| | |||||||| || || |||
Sbjct: 392 tcatcggtgggaagcctcagatcatctttggtgtttccattttcagtcagaagactcaca 333

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            | ||||| ||||  || |||||||||||||||||    || | |||||| ||||| |||
Sbjct: 332 aagccatcttcagagatatcaatcagctgataatcagtacgattaacatgaggaacatca 273

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || ||||||||||||||||||||||| ||||| || ||| |||| || || |||||  ||
Sbjct: 272 caattgtgggatgaaggaacaatatcttcaagtttttttgcattgaatatatcaattcca 213

                         
Query: 619 acaaagtggcactt 632
           || |||||||||||
Sbjct: 212 acgaagtggcactt 199



to top

>gb|AF516350.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform I (eIF-5A) mRNA, complete cds
          Length = 775

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 158/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           ||||| ||||||||| |||| ||||| || ||||| ||| | |||||||| || || |||
Sbjct: 387 tcatcggtgggaagcctcagatcatctttggtgtttccattttcagtcagaagactcaca 328

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            | ||||| ||||  || |||||||||||||||||    || | |||||| ||||| |||
Sbjct: 327 aagccatcttcagagatatcaatcagctgataatcagtacgattaacatgaggaacatca 268

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || ||||||||||||||||||||||| ||||| || ||| |||| || || |||||  ||
Sbjct: 267 caattgtgggatgaaggaacaatatcttcaagtttttttgcattgaatatatcaattcca 208

                         
Query: 619 acaaagtggcactt 632
           || |||||||||||
Sbjct: 207 acgaagtggcactt 194



to top

>emb|X63541.1|NPNEIF5A1 N.plumbaginifolia mRNA NeIF-5A1 for initiation factor 5A(1)
          Length = 702

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 212/266 (79%)
 Strand = Plus / Minus

                                                                       
Query: 364 cccatggcagacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatc 423
           ||||||||||||||||| ||||| | || |||||| || |||||||| |||   ||||||
Sbjct: 397 cccatggcagacatcactgacagaaccaagtccttcccctcagcaaaaccatctttgatc 338

                                                                       
Query: 424 tggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctca 483
            || | || |||  ||| ||||| || ||| ||| ||||||||| ||||| ||| | |||
Sbjct: 337 agggccagaagattatcgtcagttgggagcctcaagtcatccttggtgttaccattttca 278

                                                                       
Query: 484 gtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtca 543
           |||| ||| || ||| ||||||| ||||  || |||||||||||||| ||    |  |  
Sbjct: 277 gtcaacagactcacaaatccatcctcagagatatcaatcagctgatagtcagtcctattc 218

                                                                       
Query: 544 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 603
           ||||| ||||| ||||||||||| || || |||||||| || ||||||||||||||| | 
Sbjct: 217 acatgaggaacatcacagttgtgagaagagggaacaatgtcttcaagcttctttccagtg 158

                                     
Query: 604 aagatgtcaatggcaacaaagtggca 629
           || |||||||| || |||||||||||
Sbjct: 157 aaaatgtcaatagccacaaagtggca 132



to top

>gb|DQ228346.1| Solanum tuberosum clone 148H01 eukaryotic initiation factor
           5A5-like protein mRNA, complete cds
          Length = 750

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 209/263 (79%)
 Strand = Plus / Minus

                                                                       
Query: 364 cccatggcagacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatc 423
           ||||||||||||||||| ||||| | ||||||||| || || ||||| |||   |||| |
Sbjct: 483 cccatggcagacatcactgacagaaccaggtccttcccctcggcaaaaccatctttgacc 424

                                                                       
Query: 424 tggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctca 483
           ||  | || |||  ||||||||| || ||| ||| ||||||||| ||||| ||| | |||
Sbjct: 423 tgagccagaagagtatcatcagttgggagcctcaagtcatccttggtgttaccattttca 364

                                                                       
Query: 484 gtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtca 543
           |||| ||| || ||| | ||||| ||||  || ||||| |||||||||||    |  |  
Sbjct: 363 gtcaacagactcacaaagccatcctcagagatatcaataagctgataatcagtcctattc 304

                                                                       
Query: 544 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 603
           ||||| ||||| ||||| ||||| || || ||||||||||||||||||||||||||| | 
Sbjct: 303 acatgaggaacatcacaattgtgagaagagggaacaatatcctcaagcttctttccagtg 244

                                  
Query: 604 aagatgtcaatggcaacaaagtg 626
           || |||||||| || ||||||||
Sbjct: 243 aaaatgtcaattgccacaaagtg 221



to top

>gb|DQ222495.1| Solanum tuberosum clone 103C10 eukaryotic initiation factor
           5A5-like mRNA, complete cds
          Length = 757

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 209/263 (79%)
 Strand = Plus / Minus

                                                                       
Query: 364 cccatggcagacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatc 423
           ||||||||||||||||| ||||| | ||||||||| || || ||||| |||   |||| |
Sbjct: 492 cccatggcagacatcactgacagaaccaggtccttcccctcggcaaaaccatctttgacc 433

                                                                       
Query: 424 tggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctca 483
           ||  | || |||  ||||||||| || ||| ||| ||||||||| ||||| ||| | |||
Sbjct: 432 tgagccagaagagtatcatcagttgggagcctcaagtcatccttggtgttaccattttca 373

                                                                       
Query: 484 gtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtca 543
           |||| ||| || ||| | ||||| ||||  || ||||| |||||||||||    |  |  
Sbjct: 372 gtcaacagactcacaaagccatcctcagagatatcaataagctgataatcagtcctattc 313

                                                                       
Query: 544 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 603
           ||||| ||||| ||||| ||||| || || ||||||||||||||||||||||||||| | 
Sbjct: 312 acatgaggaacatcacaattgtgagaagagggaacaatatcctcaagcttctttccagtg 253

                                  
Query: 604 aagatgtcaatggcaacaaagtg 626
           || |||||||| || ||||||||
Sbjct: 252 aaaatgtcaattgccacaaagtg 230



to top

>gb|BT018311.1| Zea mays clone EL01T0207A06.c mRNA sequence
          Length = 775

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 132/159 (83%), Gaps = 1/159 (0%)
 Strand = Plus / Minus

                                                                       
Query: 490 aggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgg 549
           ||||| ||| ||||||| ||||  || |||||||||||||| ||    ||||  ||||| 
Sbjct: 360 aggctcacaaatccatcctcagaaatatcaatcagctgatactcagtacggttcacatgc 301

                                                                       
Query: 550 ggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatg 609
           |||| |||||||||||| ||||||||||||||||| |||||||| || ||||| || |||
Sbjct: 300 ggaatgtcacagttgtgtgatgaaggaacaatatcttcaagctttttcccattgaatatg 241

                                                  
Query: 610 tcaatggcaacaaagtggcactttgcgtgggccatgctt 648
           || ||||| |||||| |||| || |||| ||||||||||
Sbjct: 240 tctatggcgacaaaggggcatttggcgt-ggccatgctt 203



to top

>gb|AY496435.1| Brassica napus eukaryotic translation initiation factor-5A mRNA,
           complete cds
          Length = 658

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 544 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 603
           ||||||||||| ||||| |||||||| || |||||||||||||| ||||||||  || | 
Sbjct: 254 acatggggaacatcacaattgtgggaagagggaacaatatcctcgagcttcttagcagtg 195

                                              
Query: 604 aagatgtcaatggcaacaaagtggcactttgcgtg 638
           |||||||| || ||||||||||| |||||||||||
Sbjct: 194 aagatgtcgatagcaacaaagtgacactttgcgtg 160



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 318 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 377
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 480 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 421

                   
Query: 378 cacagaca 385
            |||||||
Sbjct: 420 gacagaca 413



to top

>gb|AY389707.1| Hyacinthus orientalis eukaryotic translation initiation factor 5A-4
           mRNA, complete cds
          Length = 794

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 196/246 (79%)
 Strand = Plus / Minus

                                                                       
Query: 351 gatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaa 410
           |||||||||||| |||||||||||||| ||||| |  |  || |||||||| ||||||||
Sbjct: 479 gatctgttcttctcccatggcagacatgacagagaccacgagctccttgccttcagcaaa 420

                                                                       
Query: 411 tccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagt 470
            |||   |||||||||  ||||||    |||||||| |||||| |||| |||||||||||
Sbjct: 419 accatctttgatctgggtaagcagggagtcatcagttggaagcctcagatcatccttagt 360

                                                                       
Query: 471 gttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgata 530
           |   ||| ||||||| |  || || ||| ||||||| |||| |||||| || || |||||
Sbjct: 359 gccaccattctcagttaagagactcacaaatccatcttcagatatgtcgatgagttgata 300

                                                                       
Query: 531 atcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaag 590
            ||   ||||  |||||| ||||| |||||||| ||||| || || |||||||| |||||
Sbjct: 299 gtcagtgcgggtaacatgaggaacatcacagttatgggaagatggcacaatatcttcaag 240

                 
Query: 591 cttctt 596
           ||||||
Sbjct: 239 cttctt 234



to top

>gb|AY587771.1| Tamarix androssowii translation initiation factor 5A mRNA, complete
           cds
          Length = 801

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                       
Query: 543 aacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatt 602
           |||||| || || ||||||||||| ||||| ||||||||||||||||||||||| ||| |
Sbjct: 322 aacatgagggacatcacagttgtgagatgatggaacaatatcctcaagcttcttgccagt 263

                                         
Query: 603 aaagatgtcaatggcaacaaagtggcactt 632
            |||||||||||  |||||||||| |||||
Sbjct: 262 gaagatgtcaataccaacaaagtgacactt 233



to top

>gb|AF516354.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform V (eIF-5A) mRNA, partial cds
          Length = 427

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 157/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           ||||| ||||||||| | || | |||||| ||||| ||||| |||||||| || || |||
Sbjct: 394 tcatcggtgggaagcctgagattatccttggtgtttccactttcagtcagaagactcaca 335

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            | ||||| ||||  || |||||||||||||||||    || | |||||||||| | |||
Sbjct: 334 aaaccatcttcagagatatcaatcagctgataatcagtacgattaacatggggagcatca 275

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || ||||||||||||||||||||||| ||||| || ||| || | || || |||||  ||
Sbjct: 274 caattgtgggatgaaggaacaatatcttcaagtttttttgcagtgaatatatcaattcca 215

                         
Query: 619 acaaagtggcactt 632
           || |||||||||||
Sbjct: 214 acgaagtggcactt 201



to top

>gb|AF416338.1|AF416338 Medicago sativa eukaryotic translation initiation factor 5A-2 mRNA,
           complete cds
          Length = 649

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 160/198 (80%)
 Strand = Plus / Minus

                                                                       
Query: 438 atcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgac 497
           ||||||||| ||||||||||| ||||| || ||  | ||| | ||||||| ||  || ||
Sbjct: 414 atcatcagtaggaagcttcagatcatctttggtacttccattgtcagtcaacaaactcac 355

                                                                       
Query: 498 atatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtc 557
           | ||||||| ||||  || ||||||| |||||||||    || |  ||||| ||||| ||
Sbjct: 354 aaatccatcttcagaaatatcaatcaactgataatcagtacgattcacatgaggaacatc 295

                                                                       
Query: 558 acagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggc 617
           ||| ||||||||||||||||||||||| ||||| || || ||||| || || ||||| ||
Sbjct: 294 acaattgtgggatgaaggaacaatatcttcaagttttttcccattgaaaatatcaatagc 235

                             
Query: 618 aacaaagtggcactttgc 635
           ||||||||| ||||||||
Sbjct: 234 aacaaagtgacactttgc 217



to top

>ref|NM_105608.2| Arabidopsis thaliana translation initiation factor AT1G69410 mRNA,
           complete cds
          Length = 763

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 163/201 (81%), Gaps = 1/201 (0%)
 Strand = Plus / Minus

                                                                       
Query: 451 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 510
           |||||||| |||||||||||| | ||| | ||||| || || || ||| | ||||| |||
Sbjct: 443 agcttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttca 384

                                                                       
Query: 511 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 570
           |  || ||||||| |||||||||    || |  ||||| ||||| ||||| |||||||| 
Sbjct: 383 gagatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaa 324

                                                                       
Query: 571 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 630
           |||||||| ||||| |||||||||||   | ||||||| ||||||||||||||||| |||
Sbjct: 323 gaaggaacgatatcttcaagcttcttagaagtaaagatatcaatggcaacaaagtgacac 264

                                
Query: 631 tttgcgtgggccatgcttccc 651
           || |||| | |||||||||||
Sbjct: 263 ttggcgt-gaccatgcttccc 244



to top

>gb|AY060530.1| Arabidopsis thaliana At1g69410/F10D13.8 mRNA, complete cds
          Length = 477

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 163/201 (81%), Gaps = 1/201 (0%)
 Strand = Plus / Minus

                                                                       
Query: 451 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 510
           |||||||| |||||||||||| | ||| | ||||| || || || ||| | ||||| |||
Sbjct: 347 agcttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttca 288

                                                                       
Query: 511 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 570
           |  || ||||||| |||||||||    || |  ||||| ||||| ||||| |||||||| 
Sbjct: 287 gagatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaa 228

                                                                       
Query: 571 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 630
           |||||||| ||||| |||||||||||   | ||||||| ||||||||||||||||| |||
Sbjct: 227 gaaggaacgatatcttcaagcttcttagaagtaaagatatcaatggcaacaaagtgacac 168

                                
Query: 631 tttgcgtgggccatgcttccc 651
           || |||| | |||||||||||
Sbjct: 167 ttggcgt-gaccatgcttccc 148



to top

>gb|AF372933.1|AF372933 Arabidopsis thaliana At1g69410/F10D13.8 mRNA, complete cds
          Length = 676

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 163/201 (81%), Gaps = 1/201 (0%)
 Strand = Plus / Minus

                                                                       
Query: 451 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 510
           |||||||| |||||||||||| | ||| | ||||| || || || ||| | ||||| |||
Sbjct: 411 agcttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttca 352

                                                                       
Query: 511 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 570
           |  || ||||||| |||||||||    || |  ||||| ||||| ||||| |||||||| 
Sbjct: 351 gagatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaa 292

                                                                       
Query: 571 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 630
           |||||||| ||||| |||||||||||   | ||||||| ||||||||||||||||| |||
Sbjct: 291 gaaggaacgatatcttcaagcttcttagaagtaaagatatcaatggcaacaaagtgacac 232

                                
Query: 631 tttgcgtgggccatgcttccc 651
           || |||| | |||||||||||
Sbjct: 231 ttggcgt-gaccatgcttccc 212



to top

>emb|BX818518.1|CNS0AE6E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL83ZE12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 723

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 163/201 (81%), Gaps = 1/201 (0%)
 Strand = Plus / Minus

                                                                       
Query: 451 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 510
           |||||||| |||||||||||| | ||| | ||||| || || || ||| | ||||| |||
Sbjct: 401 agcttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttca 342

                                                                       
Query: 511 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 570
           |  || ||||||| |||||||||    || |  ||||| ||||| ||||| |||||||| 
Sbjct: 341 gagatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaa 282

                                                                       
Query: 571 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 630
           |||||||| ||||| |||||||||||   | ||||||| ||||||||||||||||| |||
Sbjct: 281 gaaggaacgatatcttcaagcttcttagaagtaaagatatcaatggcaacaaagtgacac 222

                                
Query: 631 tttgcgtgggccatgcttccc 651
           || |||| | |||||||||||
Sbjct: 221 ttggcgt-gaccatgcttccc 202



to top

>gb|AY087040.1| Arabidopsis thaliana clone 30884 mRNA, complete sequence
          Length = 752

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 163/201 (81%), Gaps = 1/201 (0%)
 Strand = Plus / Minus

                                                                       
Query: 451 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 510
           |||||||| |||||||||||| | ||| | ||||| || || || ||| | ||||| |||
Sbjct: 443 agcttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttca 384

                                                                       
Query: 511 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 570
           |  || ||||||| |||||||||    || |  ||||| ||||| ||||| |||||||| 
Sbjct: 383 gagatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaa 324

                                                                       
Query: 571 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 630
           |||||||| ||||| |||||||||||   | ||||||| ||||||||||||||||| |||
Sbjct: 323 gaaggaacgatatcttcaagcttcttagaagtaaagatatcaatggcaacaaagtgacac 264

                                
Query: 631 tttgcgtgggccatgcttccc 651
           || |||| | |||||||||||
Sbjct: 263 ttggcgt-gaccatgcttccc 244



to top

>dbj|AP004275.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0453E05
          Length = 137364

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 69/77 (89%)
 Strand = Plus / Plus

                                                                         
Query: 556   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
             |||||||||||||| ||||||||||||||||||||||| || ||||| || || || |||
Sbjct: 77455 tcacagttgtgggacgaaggaacaatatcctcaagctttttaccattgaatatatctatg 77514

                              
Query: 616   gcaacaaagtggcactt 632
             ||||||||||| |||||
Sbjct: 77515 gcaacaaagtgacactt 77531



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                         
Query: 349   cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 408
             |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 76113 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 76172

                              
Query: 409   aatccagtcttgatctg 425
             |||||||||||||||||
Sbjct: 76173 aatccagtcttgatctg 76189



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 460   tcatccttagtgttgccactctcagtcagcaggct 494
             |||||||||||||| ||||||||||| || |||||
Sbjct: 77130 tcatccttagtgttaccactctcagtaagaaggct 77164



to top

>gb|DQ207846.1| Solanum tuberosum clone 073A09 eukaryotic initiation factor
           5A3-like mRNA, complete cds
          Length = 696

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 152/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           ||||| |||||||||   ||||||||||| ||||| ||||| ||||| || |||  ||||
Sbjct: 451 tcatcggtgggaagccggaggtcatccttggtgtttccactttcagtaagaagggagaca 392

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            | ||||| ||||  ||||||||||||||||| ||    ||||  ||||| || ||||||
Sbjct: 391 aaaccatcttcagagatgtcaatcagctgatagtcggtacggttgacatgtggcacgtca 332

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || |||||||| || ||||| ||||| || || ||||||||||| || |||||||| || 
Sbjct: 331 caattgtgggaggatggaacgatatcttcgagtttctttccattgaaaatgtcaattgcc 272

                   
Query: 619 acaaagtg 626
           ||||||||
Sbjct: 271 acaaagtg 264



to top

>gb|AF225297.1|AF225297 Euphorbia esula translation initiation factor 5A mRNA, partial cds
          Length = 725

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 547 tggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaag 606
           |||||||| ||||| |||||||| |||||||| ||||| ||||||||||||||||| |||
Sbjct: 245 tggggaacatcacaattgtgggaagaaggaacgatatcttcaagcttctttccattgaag 186

                               
Query: 607 atgtcaatggcaacaaagtg 626
           || |||||  ||||||||||
Sbjct: 185 atatcaattccaacaaagtg 166



to top

>dbj|AB004827.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A1,
           complete cds
          Length = 632

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 556 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
           ||||| ||||||||||||||||||||||| ||||||||||||||||| || ||||| || 
Sbjct: 287 tcacaattgtgggatgaaggaacaatatcttcaagcttctttccattgaaaatgtcgatt 228

                               
Query: 616 gcaacaaagtggcactttgc 635
           || |||||||| || |||||
Sbjct: 227 gccacaaagtgacattttgc 208



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                             
Query: 337 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacag 386
           ||||||||||| |||||||| ||||||||||| |||||||||||||||||
Sbjct: 506 tccttcacagcacagatctgctcttcacccattgcagacatcacagacag 457



to top

>dbj|AB004824.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A3,
           complete cds
          Length = 733

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 152/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           ||||| |||||||||   ||||||||||| ||||| ||||| ||||| || |||  ||||
Sbjct: 409 tcatcggtgggaagccggaggtcatccttggtgtttccactttcagtaagaagggagaca 350

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            | ||||| ||||  ||||||||||||||||| ||    ||||  ||||| || ||||||
Sbjct: 349 aaaccatcttcagagatgtcaatcagctgatagtcggtacggttgacatgtggcacgtca 290

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || |||||||| || ||||| ||||| || || ||||||||||| || |||||||| || 
Sbjct: 289 caattgtgggaggatggaacgatatcttcgagtttctttccattgaaaatgtcaattgcc 230

                   
Query: 619 acaaagtg 626
           ||||||||
Sbjct: 229 acaaagtg 222



to top

>dbj|AB004823.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A2,
           complete cds
          Length = 716

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 556 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
           ||||| ||||||||||||||||||||||| ||||||||||||||||| || ||||| || 
Sbjct: 301 tcacaattgtgggatgaaggaacaatatcttcaagcttctttccattgaaaatgtcgatt 242

                               
Query: 616 gcaacaaagtggcactttgc 635
           || |||||||| || |||||
Sbjct: 241 gccacaaagtgacattttgc 222



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 337 tccttcacagcgcagatctgttcttcacccatggcagacatcacagaca 385
           ||||||||||| |||||||| ||||||||||| ||||||||||||||||
Sbjct: 520 tccttcacagcacagatctgctcttcacccattgcagacatcacagaca 472



to top

>emb|AJ608752.1| Nicotiana plumbaginifolia cDNA-AFLP fragment, clone Np048
          Length = 239

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 148/183 (80%)
 Strand = Plus / Minus

                                                                       
Query: 352 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 411
           ||||| || ||||||||||| ||||| |||||||  |  ||||| || || |||||||| 
Sbjct: 187 atctgctcctcacccatggctgacatgacagacacaacaaggtcttttccctcagcaaac 128

                                                                       
Query: 412 ccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtg 471
           |||  |||||||||   ||| ||   ||||||||| |||||| | ||||||||||| |||
Sbjct: 127 ccatccttgatctgtgtaaggaggttatcatcagtaggaagcctaaggtcatccttggtg 68

                                                                       
Query: 472 ttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgataa 531
           || ||| ||||||| ||||| || ||| ||||||| ||||  |||||||| |||||||||
Sbjct: 67  ttaccattctcagtgagcagactcacaaatccatcttcagaaatgtcaataagctgataa 8

              
Query: 532 tct 534
           |||
Sbjct: 7   tct 5



to top

>dbj|AB004826.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A5,
           complete cds
          Length = 688

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 208/263 (79%)
 Strand = Plus / Minus

                                                                       
Query: 364 cccatggcagacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatc 423
           ||||||||||||||||| ||||| | ||||||||| || || ||||| |||   |||| |
Sbjct: 500 cccatggcagacatcactgacagaaccaggtccttcccctcggcaaaaccatctttgacc 441

                                                                       
Query: 424 tggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctca 483
           ||  | || |||  ||||||||| || ||| ||| ||||||||| ||||| ||| | |||
Sbjct: 440 tgagccagaagagtatcatcagttgggagcctcaagtcatccttggtgttaccattttca 381

                                                                       
Query: 484 gtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtca 543
           |||| ||  || ||| | ||||| ||||  || ||||| |||||||||||    |  |  
Sbjct: 380 gtcaacaaactcacaaagccatcctcagagatatcaataagctgataatcagtcctattc 321

                                                                       
Query: 544 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 603
           ||||| ||||| ||||| ||||| || || ||||||||||||||||||||||||||| | 
Sbjct: 320 acatgaggaacatcacaattgtgagaagagggaacaatatcctcaagcttctttccagtg 261

                                  
Query: 604 aagatgtcaatggcaacaaagtg 626
           || |||||||| || ||||||||
Sbjct: 260 aaaatgtcaattgccacaaagtg 238



to top

>ref|NM_102425.2| Arabidopsis thaliana translation initiation factor AT1G26630 mRNA,
           complete cds
          Length = 929

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 153/190 (80%)
 Strand = Plus / Minus

                                                                       
Query: 437 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 496
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 493 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtgagaaggctca 434

                                                                       
Query: 497 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 556
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 433 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 374

                                                                       
Query: 557 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 616
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 373 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 314

                     
Query: 617 caacaaagtg 626
           ||||||||||
Sbjct: 313 caacaaagtg 304



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 318 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 377
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 612 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 553

                   
Query: 378 cacagaca 385
            |||||||
Sbjct: 552 gacagaca 545



to top

>gb|AF492850.1| Arabidopsis thaliana putative initiation factor 5A mRNA, complete
           cds
          Length = 726

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 153/190 (80%)
 Strand = Plus / Minus

                                                                       
Query: 437 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 496
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 438 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtgagaaggctca 379

                                                                       
Query: 497 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 556
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 378 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 319

                                                                       
Query: 557 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 616
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 318 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 259

                     
Query: 617 caacaaagtg 626
           ||||||||||
Sbjct: 258 caacaaagtg 249



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 318 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 377
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 557 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 498

                   
Query: 378 cacagaca 385
            |||||||
Sbjct: 497 gacagaca 490



to top

>gb|AY055789.1| Arabidopsis thaliana At1g26630/T24P13_1 mRNA, complete cds
          Length = 480

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 153/190 (80%)
 Strand = Plus / Minus

                                                                       
Query: 437 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 496
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 361 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtgagaaggctca 302

                                                                       
Query: 497 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 556
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 301 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 242

                                                                       
Query: 557 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 616
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 241 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 182

                     
Query: 617 caacaaagtg 626
           ||||||||||
Sbjct: 181 caacaaagtg 172



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 318 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 377
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 480 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 421

                   
Query: 378 cacagaca 385
            |||||||
Sbjct: 420 gacagaca 413



to top

>gb|AY039588.1| Arabidopsis thaliana At1g26630/T24P13_1 mRNA, complete cds
          Length = 765

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 153/190 (80%)
 Strand = Plus / Minus

                                                                       
Query: 437 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 496
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 444 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtgagaaggctca 385

                                                                       
Query: 497 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 556
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 384 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 325

                                                                       
Query: 557 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 616
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 324 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 265

                     
Query: 617 caacaaagtg 626
           ||||||||||
Sbjct: 264 caacaaagtg 255



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 318 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 377
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 563 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 504

                   
Query: 378 cacagaca 385
            |||||||
Sbjct: 503 gacagaca 496



to top

>emb|BX814148.1|CNS0AEAE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB59ZC08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 737

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 153/190 (80%)
 Strand = Plus / Minus

                                                                       
Query: 437 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 496
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 418 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtaagaaggctca 359

                                                                       
Query: 497 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 556
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 358 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 299

                                                                       
Query: 557 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 616
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 298 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 239

                     
Query: 617 caacaaagtg 626
           ||||||||||
Sbjct: 238 caacaaagtg 229



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 318 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 377
           ||||||||||||||| | |||||| || || || ||||| || || ||||||| ||||||
Sbjct: 537 ttacttgccaccaccaacttccttgacggcacaaatctgctcctctcccatggaagacat 478

                   
Query: 378 cacagaca 385
            |||||||
Sbjct: 477 gacagaca 470



to top

>gb|AY084827.1| Arabidopsis thaliana clone 118823 mRNA, complete sequence
          Length = 781

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 153/190 (80%)
 Strand = Plus / Minus

                                                                       
Query: 437 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 496
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 492 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtgagaaggctca 433

                                                                       
Query: 497 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 556
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 432 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 373

                                                                       
Query: 557 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 616
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 372 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 313

                     
Query: 617 caacaaagtg 626
           ||||||||||
Sbjct: 312 caacaaagtg 303



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 318 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 377
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 611 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 552

                   
Query: 378 cacagaca 385
            |||||||
Sbjct: 551 gacagaca 544



to top

>dbj|AP004303.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0407H12
          Length = 167754

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 160/196 (81%), Gaps = 5/196 (2%)
 Strand = Plus / Minus

                                                                          
Query: 394    tccttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagc 453
              |||||||| ||| |||||||||||||||||||||| || |||   |||| ||| || || 
Sbjct: 115565 tccttgccttcaccaaatccagtcttgatctggcccaggagattgtcataagttgggagt 115506

                                                                          
Query: 454    ttcaggtcatccttagtgttgccactctcagtcagcaggctgac--ata-tccatcatca 510
                 || |||||||||||||| || |||||||| || ||||| ||  ||| |||||| || 
Sbjct: 115505 ccaagatcatccttagtgttaccgctctcagtaagaaggctcacgaataatccatcctct 115446

                                                                          
Query: 511    gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 570
              | ||||||||||||||| |||| |   ||||   |||| ||||| |||||||||||||||
Sbjct: 115445 gatatgtcaatcagctggtaatttgtacggtt--catgtggaacatcacagttgtgggat 115388

                              
Query: 571    gaaggaacaatatcct 586
              ||||||||||||||||
Sbjct: 115387 gaaggaacaatatcct 115372



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 108/130 (83%), Gaps = 5/130 (3%)
 Strand = Plus / Minus

                                                                          
Query: 460    tcatccttagtgttgccactctcagtcagcaggctgac--ata-tccatcatcagttatg 516
              |||||||||||||| || |||||||| || ||||| ||  ||| |||||| || | ||||
Sbjct: 110746 tcatccttagtgttaccgctctcagtaagaaggctcacgaataatccatcctctgatatg 110687

                                                                          
Query: 517    tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 576
              ||||||||||| |||| |   ||||   |||| ||||| |||||||||||||||||| ||
Sbjct: 110686 tcaatcagctggtaatttgtacggtt--catgtggaacatcacagttgtgggatgaatga 110629

                        
Query: 577    acaatatcct 586
              ||||||||||
Sbjct: 110628 acaatatcct 110619



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 394    tccttgccatcagcaaatccagtcttgatctg 425
              |||||||| | | |||||||||||||||||||
Sbjct: 110811 tccttgccttaaccaaatccagtcttgatctg 110780



to top

>ref|NM_101261.1| Arabidopsis thaliana EIF-5A; translation initiation factor
           AT1G13950 (EIF-5A) mRNA, complete cds
          Length = 705

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                       
Query: 493 ctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggga 552
           |||||||||||||| ||||  ||||||||||||||||||||    ||||  ||||| |||
Sbjct: 360 ctgacatatccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgagga 301

                                           
Query: 553 acgtcacagttgtgggatgaaggaacaatatc 584
           || ||||| |||||||| ||||||||||||||
Sbjct: 300 acatcacaattgtgggaagaaggaacaatatc 269



to top

>gb|AC122160.21| Medicago truncatula clone mth2-23d6, complete sequence
          Length = 125105

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                         
Query: 556   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
             ||||| |||||||| |||||||||||||| ||||| || || ||||| ||||| ||||| 
Sbjct: 13072 tcacaattgtgggacgaaggaacaatatcttcaagttttttcccattgaagatatcaata 13131

                                 
Query: 616   gcaacaaagtggcactttgc 635
             ||||||||||| ||||||||
Sbjct: 13132 gcaacaaagtgacactttgc 13151



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                            
Query: 337   tccttcacagcgcagatctgttcttcacccatggcagacatcacaga 383
             ||||||| ||| || ||||| ||||||||||| |||||||| |||||
Sbjct: 11864 tccttcagagcacatatctgctcttcacccatcgcagacatgacaga 11910



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 563  tgtgggatgaaggaacaata 582
            ||||||||||||||||||||
Sbjct: 7736 tgtgggatgaaggaacaata 7755



to top

>gb|AC152068.17| Medicago truncatula clone mth2-29p8, complete sequence
          Length = 118589

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                         
Query: 556   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
             ||||| |||||||| |||||||||||||| ||||| || || ||||| ||||| ||||| 
Sbjct: 46225 tcacaattgtgggacgaaggaacaatatcttcaagttttttcccattgaagatatcaata 46166

                                 
Query: 616   gcaacaaagtggcactttgc 635
             ||||||||||| ||||||||
Sbjct: 46165 gcaacaaagtgacactttgc 46146



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 337   tccttcacagcgcagatctgttcttcacccatggcagacatcacaga 383
             ||||||| ||| || ||||| ||||||||||| |||||||| |||||
Sbjct: 47433 tccttcagagcacatatctgctcttcacccatcgcagacatgacaga 47387



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 563   tgtgggatgaaggaacaata 582
             ||||||||||||||||||||
Sbjct: 51562 tgtgggatgaaggaacaata 51543



to top

>gb|AY117272.1| Arabidopsis thaliana putative initiation factor 5A-4 (At1g13950)
           mRNA, complete cds
          Length = 508

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                       
Query: 493 ctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggga 552
           |||||||||||||| ||||  ||||||||||||||||||||    ||||  ||||| |||
Sbjct: 305 ctgacatatccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgagga 246

                                           
Query: 553 acgtcacagttgtgggatgaaggaacaatatc 584
           || ||||| |||||||| ||||||||||||||
Sbjct: 245 acatcacaattgtgggaagaaggaacaatatc 214



to top

>gb|AY063780.1| Arabidopsis thaliana putative initiation factor 5A-4 (At1g13950)
           mRNA, complete cds
          Length = 676

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                       
Query: 493 ctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggga 552
           |||||||||||||| ||||  ||||||||||||||||||||    ||||  ||||| |||
Sbjct: 345 ctgacatatccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgagga 286

                                           
Query: 553 acgtcacagttgtgggatgaaggaacaatatc 584
           || ||||| |||||||| ||||||||||||||
Sbjct: 285 acatcacaattgtgggaagaaggaacaatatc 254



to top

>gb|AF296084.1|AF296084 Lycopersicon esculentum eukaryotic translation initiation factor
           5A-2 mRNA, complete cds
          Length = 779

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 151/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           ||||| ||||||||| | ||||||||||| ||||| ||||| ||||| || ||   ||||
Sbjct: 404 tcatcggtgggaagcctgaggtcatccttggtgtttccactttcagtaagaagtgagaca 345

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            | ||||| ||||  || |||||||||||||| ||    |||| |||||| || || |||
Sbjct: 344 aaaccatcttcagagatatcaatcagctgatagtcggtacggttaacatgtggcacatca 285

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           || |||||||| || ||||| ||||| || || ||||||||||| || |||||||| || 
Sbjct: 284 caattgtgggaggacggaacgatatcttccagtttctttccattgaaaatgtcaattgcc 225

                   
Query: 619 acaaagtg 626
           ||||||||
Sbjct: 224 acaaagtg 217



to top

>gb|AF296082.1|AF296082 Arabidopsis thaliana eukaryotic translation initiation factor 5A
           mRNA, complete cds
          Length = 702

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                       
Query: 493 ctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggga 552
           |||||||||||||| ||||  ||||||||||||||||||||    ||||  ||||| |||
Sbjct: 360 ctgacatatccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgagga 301

                                           
Query: 553 acgtcacagttgtgggatgaaggaacaatatc 584
           || ||||| |||||||| ||||||||||||||
Sbjct: 300 acatcacaattgtgggaagaaggaacaatatc 269



to top

>emb|BX816465.1|CNS0ABU4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH4ZG03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1411

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 83/96 (86%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                       
Query: 556 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
           ||||| |||||||| |||||||| ||||| |||||||||||   | ||||||| ||||||
Sbjct: 500 tcacaattgtgggaagaaggaacgatatcttcaagcttcttagaagtaaagatatcaatg 441

                                               
Query: 616 gcaacaaagtggcactttgcgtgggccatgcttccc 651
           ||||||||||| ||||| |||| | |||||||||||
Sbjct: 440 gcaacaaagtgacacttggcgt-gaccatgcttccc 406



to top

>emb|BX817162.1|CNS0ABMR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH8ZF05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1461

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 83/96 (86%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                       
Query: 556 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
           ||||| |||||||| |||||||| ||||| |||||||||||   | ||||||| ||||||
Sbjct: 500 tcacaattgtgggaagaaggaacgatatcttcaagcttcttagaagtaaagatatcaatg 441

                                               
Query: 616 gcaacaaagtggcactttgcgtgggccatgcttccc 651
           ||||||||||| ||||| |||| | |||||||||||
Sbjct: 440 gcaacaaagtgacacttggcgt-gaccatgcttccc 406



to top

>emb|BX817272.1|CNS0AAJ3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL10ZA11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 649

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                       
Query: 493 ctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggga 552
           |||||||||||||| ||||  ||||||||||||||||||||    ||||  ||||| |||
Sbjct: 338 ctgacatatccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgagga 279

                                           
Query: 553 acgtcacagttgtgggatgaaggaacaatatc 584
           || ||||| |||||||| ||||||||||||||
Sbjct: 278 acatcacaattgtgggaagaaggaacaatatc 247



to top

>gb|AC073178.9|AC073178 Arabidopsis thaliana chromosome 1 BAC F10D13 genomic sequence, complete
             sequence
          Length = 107214

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 83/96 (86%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                         
Query: 556   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
             ||||| |||||||| |||||||| ||||| |||||||||||   | ||||||| ||||||
Sbjct: 33098 tcacaattgtgggaagaaggaacgatatcttcaagcttcttagaagtaaagatatcaatg 33039

                                                 
Query: 616   gcaacaaagtggcactttgcgtgggccatgcttccc 651
             ||||||||||| ||||| |||| | |||||||||||
Sbjct: 33038 gcaacaaagtgacacttggcgt-gaccatgcttccc 33004



to top

>gb|AC018364.5|AC018364 Arabidopsis thaliana chromosome 1 BAC F23O10 genomic sequence,
            complete sequence
          Length = 93802

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 83/96 (86%), Gaps = 1/96 (1%)
 Strand = Plus / Plus

                                                                        
Query: 556  tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
            ||||| |||||||| |||||||| ||||| |||||||||||   | ||||||| ||||||
Sbjct: 7131 tcacaattgtgggaagaaggaacgatatcttcaagcttcttagaagtaaagatatcaatg 7190

                                                
Query: 616  gcaacaaagtggcactttgcgtgggccatgcttccc 651
            ||||||||||| ||||| |||| | |||||||||||
Sbjct: 7191 gcaacaaagtgacacttggcgt-gaccatgcttccc 7225



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                            
Query: 556      tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
                ||||||||||| || || || |||||||| || ||||||||  || ||||||||||||| 
Sbjct: 19505067 tcacagttgtgagaagatggcacaatatcttcgagcttcttggcagtaaagatgtcaatt 19505008

                                       
Query: 616      gcaacaaagtggcactttgcgtg 638
                ||||||||||||||||| |||||
Sbjct: 19505007 gcaacaaagtggcacttggcgtg 19504985



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                            
Query: 331      ccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatc 390
                ||||| |||||||  ||||||||||| || || |||||||||||||| |||| ||  | |
Sbjct: 19506016 ccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcaccacc 19505957

                                                   
Query: 391      aggtccttgccatcagcaaatccagtcttgatctg 425
                |||||||| || ||  ||||||||  |||||||||
Sbjct: 19505956 aggtccttcccttctccaaatccatccttgatctg 19505922



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                        
Query: 438      atcatcagtgggaagcttcaggtcatccttagtgttgcca 477
                ||||||||| || ||| | ||||||||||| |||||||||
Sbjct: 19505358 atcatcagtagggagcctgaggtcatccttggtgttgcca 19505319



to top

>dbj|D10399.1|RIC225 Oryza sativa mRNA for initiation factor eIF-4D (225 gene), partial
           sequence
          Length = 433

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 556 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
           ||||||||||| || || || |||||||| || ||||||||  || ||||||||||||| 
Sbjct: 291 tcacagttgtgagaagatggcacaatatcttcgagcttcttggcagtaaagatgtcaatt 232

                                  
Query: 616 gcaacaaagtggcactttgcgtg 638
           ||||||||||||||||| |||||
Sbjct: 231 gcaacaaagtggcacttggcgtg 209



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                            
Query: 556      tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
                ||||||||||| || || || |||||||| || ||||||||  || ||||||||||||| 
Sbjct: 19431280 tcacagttgtgagaagatggcacaatatcttcgagcttcttggcagtaaagatgtcaatt 19431221

                                       
Query: 616      gcaacaaagtggcactttgcgtg 638
                ||||||||||||||||| |||||
Sbjct: 19431220 gcaacaaagtggcacttggcgtg 19431198



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                            
Query: 331      ccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatc 390
                ||||| |||||||  ||||||||||| || || |||||||||||||| |||| ||  | |
Sbjct: 19432229 ccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcaccacc 19432170

                                                   
Query: 391      aggtccttgccatcagcaaatccagtcttgatctg 425
                |||||||| || ||  ||||||||  |||||||||
Sbjct: 19432169 aggtccttcccttctccaaatccatccttgatctg 19432135



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                        
Query: 438      atcatcagtgggaagcttcaggtcatccttagtgttgcca 477
                ||||||||| || ||| | ||||||||||| |||||||||
Sbjct: 19431571 atcatcagtagggagcctgaggtcatccttggtgttgcca 19431532



to top

>emb|AL731759.2|CNS07YPA Oryza sativa chromosome 12, . BAC OSJNBa0009K11 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 144596

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                         
Query: 556   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
             ||||||||||| || || || |||||||| || ||||||||  || ||||||||||||| 
Sbjct: 37248 tcacagttgtgagaagatggcacaatatcttcgagcttcttggcagtaaagatgtcaatt 37189

                                    
Query: 616   gcaacaaagtggcactttgcgtg 638
             ||||||||||||||||| |||||
Sbjct: 37188 gcaacaaagtggcacttggcgtg 37166



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                         
Query: 331   ccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatc 390
             ||||| |||||||  ||||||||||| || || |||||||||||||| |||| ||  | |
Sbjct: 38197 ccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcaccacc 38138

                                                
Query: 391   aggtccttgccatcagcaaatccagtcttgatctg 425
             |||||||| || ||  ||||||||  |||||||||
Sbjct: 38137 aggtccttcccttctccaaatccatccttgatctg 38103



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                     
Query: 438   atcatcagtgggaagcttcaggtcatccttagtgttgcca 477
             ||||||||| || ||| | ||||||||||| |||||||||
Sbjct: 37539 atcatcagtagggagcctgaggtcatccttggtgttgcca 37500



to top

>emb|X63543.1|NTNEIF5A3 N.tabacum NeIF-5A3 gene for initiation factor 5A(3)
          Length = 2443

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                        
Query: 556  tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
            ||||||||||| || || ||||||||||| ||||||||||||||| | || |||||||| 
Sbjct: 1556 tcacagttgtgagaagagggaacaatatcttcaagcttctttccagtgaaaatgtcaata 1497

                          
Query: 616  gcaacaaagtggca 629
            || |||||||||||
Sbjct: 1496 gccacaaagtggca 1483



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 364  cccatggcagacatcacagacaggatcaggtccttgccatcagcaaa 410
            ||||||||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 2317 cccatggcagacatcactgacagaaccaggtccttcccctcagcaaa 2271



to top

>gb|AF296086.1|AF296086 Lycopersicon esculentum eukaryotic translation initiation factor
           5A-4 mRNA, complete cds
          Length = 760

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                             
Query: 337 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacag 386
           ||||||||||| |||||||| ||||||||||| |||||||||||||||||
Sbjct: 518 tccttcacagcacagatctgctcttcacccattgcagacatcacagacag 469



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 502 ccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacag 561
           ||||| |||| |||||||||||||||||| ||    || |  ||||| || || ||||| 
Sbjct: 353 ccatcttcagatatgtcaatcagctgatagtcagtacgattgacatgtggcacatcacaa 294

                                                                       
Query: 562 ttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaaca 621
           ||||||||||||||||||||||| |||||||| ||| |||| || ||||| || || |||
Sbjct: 293 ttgtgggatgaaggaacaatatcttcaagcttttttgcattgaaaatgtcgattgccaca 234

                         
Query: 622 aagtggcactttgc 635
           ||||| || |||||
Sbjct: 233 aagtgacattttgc 220



to top

>dbj|AP004534.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT14P20, TM0087,
             complete sequence
          Length = 124300

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                         
Query: 571   gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 630
             |||||||||||||||||||||||||| ||| | ||||| |||||  ||||||||||||||
Sbjct: 10155 gaaggaacaatatcctcaagcttcttgccagtgaagatatcaattccaacaaagtggcac 10214

               
Query: 631   tt 632
             ||
Sbjct: 10215 tt 10216



to top

>gb|AY961927.1| Picea abies eukaryotic translation initiation factor 5A (eIF5A)
           mRNA, partial cds
          Length = 714

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 481 tcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcgg 540
           |||| |||||| || ||| ||||||| || | ||||||||||| |||| ||||   ||| 
Sbjct: 587 tcagccagcagactcacaaatccatcctcggatatgtcaatcaactgaaaatcagtgcga 528

                                                                       
Query: 541 tcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttcca 600
             |||||| || ||||||||||| || || || || |||||||| |||||||| || |||
Sbjct: 527 gtaacatgtgggacgtcacagttatgagaagatgggacaatatcttcaagctttttacca 468

                                           
Query: 601 ttaaagatgtcaatggcaacaaagtggcactt 632
           ||||| || ||||| |||||||| ||||||||
Sbjct: 467 ttaaaaatatcaattgcaacaaaatggcactt 436



to top

>gb|BT016590.1| Zea mays clone Contig423 mRNA sequence
          Length = 945

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 139/171 (81%), Gaps = 2/171 (1%)
 Strand = Plus / Minus

                                                                       
Query: 460 tcatccttagtgttgccactctca-gtcagcaggctgacatatccatcatcagttatgtc 518
           |||||||||||||||||| ||| | || || ||||| ||| ||||||| || | ||| ||
Sbjct: 516 tcatccttagtgttgcca-tctgaagtaagaaggctcacaaatccatcctctgatatatc 458

                                                                       
Query: 519 aatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaac 578
           ||||||||| || ||    ||||  ||||| ||||  ||||||||||| || ||||||||
Sbjct: 457 aatcagctggtactcagtacggttcacatgtggaatatcacagttgtgtgacgaaggaac 398

                                                              
Query: 579 aatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggca 629
           |||||| || ||||| || || || || ||||| |||||||||||||||||
Sbjct: 397 aatatcttcgagctttttcccgttgaatatgtctatggcaacaaagtggca 347



to top

>gb|BT017712.1| Zea mays clone EL01N0446G03.c mRNA sequence
          Length = 800

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 139/171 (81%), Gaps = 2/171 (1%)
 Strand = Plus / Minus

                                                                       
Query: 460 tcatccttagtgttgccactctca-gtcagcaggctgacatatccatcatcagttatgtc 518
           |||||||||||||||||| ||| | || || ||||| ||| ||||||| || | ||| ||
Sbjct: 404 tcatccttagtgttgcca-tctgaagtaagaaggctcacaaatccatcctctgatatatc 346

                                                                       
Query: 519 aatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaac 578
           ||||||||| || ||    ||||  ||||| ||||  ||||||||||| || ||||||||
Sbjct: 345 aatcagctggtactcagtacggttcacatgtggaatatcacagttgtgtgacgaaggaac 286

                                                              
Query: 579 aatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggca 629
           |||||| || ||||| || || || || ||||| |||||||||||||||||
Sbjct: 285 aatatcttcgagctttttcccgttgaatatgtctatggcaacaaagtggca 235



to top

>emb|BX814371.1|CNS0ABYU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 689

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 544 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 603
           ||||| ||||| ||||| |||||||| || ||||||||||| |||||||||||  || | 
Sbjct: 305 acatgtggaacatcacaattgtgggaagatggaacaatatcttcaagcttcttagcagtg 246

                                  
Query: 604 aagatgtcaatggcaacaaagtg 626
           ||||| ||||| |||||||||||
Sbjct: 245 aagatatcaatagcaacaaagtg 223



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 318 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 377
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 532 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 473

                   
Query: 378 cacagaca 385
            |||||||
Sbjct: 472 gacagaca 465



to top

>gb|AF034943.1|AF034943 Zea mays translation initiation factor 5A (TIF5A) mRNA, complete
           cds
          Length = 831

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 139/171 (81%), Gaps = 2/171 (1%)
 Strand = Plus / Minus

                                                                       
Query: 460 tcatccttagtgttgccactctca-gtcagcaggctgacatatccatcatcagttatgtc 518
           |||||||||||||||||| ||| | || || ||||| ||| ||||||| || | ||| ||
Sbjct: 409 tcatccttagtgttgcca-tctgaagtaagaaggctcacaaatccatcctctgatatatc 351

                                                                       
Query: 519 aatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaac 578
           ||||||||| || ||    ||||  ||||| ||||  ||||||||||| || ||||||||
Sbjct: 350 aatcagctggtactcagtacggttcacatgcggaatatcacagttgtgtgacgaaggaac 291

                                                              
Query: 579 aatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggca 629
           |||||| || ||||| || || || || ||||| |||||||||||||||||
Sbjct: 290 aatatcttcgagctttttcccgttgaatatgtctatggcaacaaagtggca 240



to top

>gb|AY961932.1| Picea abies eukaryotic translation initiation factor 5A 2 (eIF5A)
           mRNA, complete cds
          Length = 835

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                       
Query: 543 aacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatt 602
           |||||| || ||||||||||| || || || || |||||||| |||||||| || |||||
Sbjct: 455 aacatgtgggacgtcacagttatgagaagatgggacaatatcttcaagctttttaccatt 396

                                         
Query: 603 aaagatgtcaatggcaacaaagtggcactt 632
           ||| || ||||| |||||||| ||||||||
Sbjct: 395 aaaaatatcaattgcaacaaaatggcactt 366



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 330 accgatttccttcacagcgcagatctgttcttcacccatggcagacatcacag 382
           |||||| ||||||| ||| || ||||| || || ||||| |||||||||||||
Sbjct: 671 accgatatccttcagagcacaaatctgctcctctcccattgcagacatcacag 619



to top

>gb|AF516355.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform VI (eIF-5A) mRNA, complete cds
          Length = 695

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 154/194 (79%)
 Strand = Plus / Minus

                                                                       
Query: 439 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 498
           |||||||| |||||| ||||||||||||||||||| ||| | |||||||| |  || |||
Sbjct: 381 tcatcagttggaagcctcaggtcatccttagtgttcccattttcagtcagtaaactcaca 322

                                                                       
Query: 499 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 558
            ||||||| ||||  || ||||| ||||| || ||    ||    ||||||||||| |||
Sbjct: 321 aatccatcctcagaaatatcaattagctggtagtcggtacgagtgacatggggaacatca 262

                                                                       
Query: 559 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 618
           ||||| ||||| || || |||||||| |||||||| ||  |||| |||||||| ||  ||
Sbjct: 261 cagttatgggaggaggggacaatatcttcaagctttttggcattgaagatgtctattcca 202

                         
Query: 619 acaaagtggcactt 632
           || || ||||||||
Sbjct: 201 acgaaatggcactt 188



to top

>gb|AY961929.1| Picea abies eukaryotic translation initiation factor 5A hypusine
           3-like mRNA sequence
          Length = 771

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 138/173 (79%)
 Strand = Plus / Minus

                                                                       
Query: 460 tcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtca 519
           |||||||| ||||| ||| | |||| |||||| || ||| ||||||| || | |||||||
Sbjct: 466 tcatccttggtgtttccattatcagccagcagactcacaaatccatcctcggatatgtca 407

                                                                       
Query: 520 atcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaaca 579
           |||| |||| ||||   |||   |||||| || ||||||||||| || || || || |||
Sbjct: 406 atcaactgaaaatcagtgcgagtaacatgtgggacgtcacagttatgagaagatgggaca 347

                                                                
Query: 580 atatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactt 632
           ||||| |||||| |  | |||||||| || ||||| |||||||| ||||||||
Sbjct: 346 atatcttcaagcgttgtaccattaaaaatatcaattgcaacaaaatggcactt 294



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 330 accgatttccttcacagcgcagatctgttcttcacccatggcagacatcacag 382
           |||||| ||||||| ||| || ||||| || || ||||| |||||||||||||
Sbjct: 596 accgatatccttcagagcacaaatctgctcctctcccattgcagacatcacag 544



to top

>gb|DQ407749.1| Gymnadenia conopsea eukaryotic translation initiation factor 5A
           mRNA, complete cds
          Length = 889

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 225/289 (77%)
 Strand = Plus / Minus

                                                                       
Query: 347 cgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcag 406
           |||||||||| || |||||||| || |||||||| ||||| | ||  ||||| || ||  
Sbjct: 582 cgcagatctgctcctcacccatcgccgacatcaccgacagcaccaaatccttcccttctc 523

                                                                       
Query: 407 caaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcct 466
           |||||||   ||| |||||||  |||||| |||| || ||||| ||| | || |||||||
Sbjct: 522 caaatccttcctttatctggctgagcagagcatcctcggtggggagcctgagatcatcct 463

                                                                       
Query: 467 tagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagct 526
           | ||||| ||| |||||||||| ||||| | | | |||||    | ||| ||||||||||
Sbjct: 462 tggtgttaccattctcagtcagaaggctaagaaagccatctgatgatatatcaatcagct 403

                                                                       
Query: 527 gataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcct 586
           |||| ||    || |  ||||| ||||| ||||| || || || || || ||||||||||
Sbjct: 402 gatagtcagtacgattcacatgaggaacatcacaattatgagaagatggcacaatatcct 343

                                                            
Query: 587 caagcttctttccattaaagatgtcaatggcaacaaagtggcactttgc 635
           ||||||||||  || ||||||| ||||| || |||||||| || |||||
Sbjct: 342 caagcttcttggcagtaaagatatcaattgcgacaaagtgacattttgc 294



to top

>ref|NM_186716.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 771

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 108/130 (83%), Gaps = 5/130 (3%)
 Strand = Plus / Minus

                                                                       
Query: 460 tcatccttagtgttgccactctcagtcagcaggctgac--ata-tccatcatcagttatg 516
           |||||||||||||| || |||||||| || ||||| ||  ||| |||||| || | ||||
Sbjct: 662 tcatccttagtgttaccgctctcagtaagaaggctcacgaataatccatcctctgatatg 603

                                                                       
Query: 517 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 576
           ||||||||||| |||| |   ||||   |||| ||||| |||||||||||||||||| ||
Sbjct: 602 tcaatcagctggtaatttgtacggtt--catgtggaacatcacagttgtgggatgaatga 545

                     
Query: 577 acaatatcct 586
           ||||||||||
Sbjct: 544 acaatatcct 535



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 394 tccttgccatcagcaaatccagtcttgatctg 425
           |||||||| | | |||||||||||||||||||
Sbjct: 727 tccttgccttaaccaaatccagtcttgatctg 696



to top

>gb|AF296083.1|AF296083 Lycopersicon esculentum eukaryotic translation initiation factor
           5A-1 mRNA, complete cds
          Length = 715

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 544 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 603
           ||||| ||||| ||||| ||||| || || ||||||||||||||||| ||||||||| | 
Sbjct: 312 acatgaggaacatcacaattgtgagaagagggaacaatatcctcaagtttctttccagtg 253

                      
Query: 604 aagatgtcaat 614
           || ||||||||
Sbjct: 252 aaaatgtcaat 242



to top

>gb|AC006535.7|AC006535 Genomic sequence for Arabidopsis thaliana BAC T24P13 from chromosome
            I, complete sequence
          Length = 98630

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                        
Query: 556  tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 615
            ||||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| 
Sbjct: 6331 tcacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaata 6272

                       
Query: 616  gcaacaaagtg 626
            |||||||||||
Sbjct: 6271 gcaacaaagtg 6261



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 318  ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 377
            ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 6856 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 6797

                    
Query: 378  cacagaca 385
             |||||||
Sbjct: 6796 gacagaca 6789



to top

>ref|NM_102426.3| Arabidopsis thaliana unknown protein AT1G26640 mRNA, complete cds
          Length = 1762

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                        
Query: 318  ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 377
            ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 1655 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 1714

                    
Query: 378  cacagaca 385
             |||||||
Sbjct: 1715 gacagaca 1722



to top

>gb|AF516356.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform VII (eIF-5A) mRNA, complete cds
          Length = 895

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 544 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 603
           ||||| ||||| |||||||| ||||| || ||||||||||| |||||||| ||  |||| 
Sbjct: 277 acatgaggaacatcacagttatgggaggagggaacaatatcttcaagctttttggcattg 218

                   
Query: 604 aagatgtc 611
           ||||||||
Sbjct: 217 aagatgtc 210



to top

>gb|AY961931.1| Picea abies eukaryotic translation initiation factor 5A 4 (eIF5A)
           mRNA, complete cds
          Length = 676

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 82/99 (82%), Gaps = 1/99 (1%)
 Strand = Plus / Minus

                                                                       
Query: 550 ggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatg 609
           ||||| |||||||| || || |||||||||||||| || ||||| |||  | |||| || 
Sbjct: 412 ggaacatcacagttatgagaggaaggaacaatatcttcgagcttttttgaagtaaatata 353

                                                  
Query: 610 tcaatggcaacaaagtggcactttgcgtgggccatgctt 648
           |||||||| ||||| ||||| ||||| | ||||||||||
Sbjct: 352 tcaatggctacaaaatggcattttgcat-ggccatgctt 315



to top

>gb|AC007576.3| Arabidopsis thaliana chromosome I BAC F7A19 genomic sequence, complete
             sequence
          Length = 112126

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 496   acatatccatcatcagttatgtcaatcagctgataatc 533
             ||||||||||| ||||  ||||||||||||||||||||
Sbjct: 17348 acatatccatcttcagaaatgtcaatcagctgataatc 17311



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 556   tcacagttgtgggatgaaggaacaatatc 584
             ||||| |||||||| ||||||||||||||
Sbjct: 17195 tcacaattgtgggaagaaggaacaatatc 17167



to top

>gb|AC068197.4|AC068197 Genomic sequence for Arabidopsis thaliana BAC F16A14 from chromosome I,
             complete sequence
          Length = 99547

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 496   acatatccatcatcagttatgtcaatcagctgataatc 533
             ||||||||||| ||||  ||||||||||||||||||||
Sbjct: 49560 acatatccatcttcagaaatgtcaatcagctgataatc 49523



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 556   tcacagttgtgggatgaaggaacaatatc 584
             ||||| |||||||| ||||||||||||||
Sbjct: 49407 tcacaattgtgggaagaaggaacaatatc 49379



to top

>gb|AC117827.6| Mus musculus chromosome 1, clone RP24-88L2, complete sequence
          Length = 213655

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 139   agatagatagatagataacaaagta 163
             |||||||||||||||||||||||||
Sbjct: 15731 agatagatagatagataacaaagta 15707



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 135   atagagatagatagatagata 155
             |||||||||||||||||||||
Sbjct: 15775 atagagatagatagatagata 15755



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 137   agagatagatagatagataa 156
             ||||||||||||||||||||
Sbjct: 15928 agagatagatagatagataa 15909



to top

>gb|AC151350.2| Xenopus tropicalis clone ISB-400N1, complete sequence
          Length = 88948

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 130   ttataatagagatagatagatagat 154
             |||||||||||||||||||||||||
Sbjct: 21663 ttataatagagatagatagatagat 21687



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 135   atagagatagatagatagata 155
             |||||||||||||||||||||
Sbjct: 21701 atagagatagatagatagata 21721



to top

>emb|CR392002.14| Zebrafish DNA sequence from clone DKEY-61D19 in linkage group 2,
             complete sequence
          Length = 52053

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 139   agatagatagatagataacaaagta 163
             |||||||||||||||||||||||||
Sbjct: 34208 agatagatagatagataacaaagta 34184



to top

>emb|AL391134.13| Human DNA sequence from clone RP11-245M24 on chromosome Xp11.22-11.3
            Contains the 3' end of a nove  gene and a keratin 8 (K8,
            KO, CK8, CYK8, K2C8, CARD2) (KRT8) pseudogene, complete
            sequence
          Length = 58094

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 131  tataatagagatagatagatagata 155
            |||||||||||||||||||||||||
Sbjct: 5668 tataatagagatagatagatagata 5692



to top

>emb|BX547935.12| Zebrafish DNA sequence from clone CH211-207C1 in linkage group 16,
              complete sequence
          Length = 195252

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 131    tataatagagatagatagatagata 155
              |||||||||||||||||||||||||
Sbjct: 178914 tataatagagatagatagatagata 178890



to top

>emb|BX950219.10| Mouse DNA sequence from clone RP23-303E24 on chromosome 4, complete
              sequence
          Length = 167874

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 131    tataatagagatagatagatagata 155
              |||||||||||||||||||||||||
Sbjct: 161774 tataatagagatagatagatagata 161750



to top

>gb|AC102666.13| Mus musculus chromosome 1, clone RP23-444A8, complete sequence
          Length = 169085

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 131   tataatagagatagatagatagata 155
             |||||||||||||||||||||||||
Sbjct: 30933 tataatagagatagatagatagata 30909



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 135   atagagatagatagatagata 155
             |||||||||||||||||||||
Sbjct: 31250 atagagatagatagatagata 31230



to top

>emb|CT030739.10| Mouse DNA sequence from clone RP24-496K8 on chromosome 13, complete
             sequence
          Length = 192075

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 132   ataatagagatagatagatagataa 156
             |||||||||||||||||||||||||
Sbjct: 75863 ataatagagatagatagatagataa 75839



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 139    agatagatagatagataaca 158
              ||||||||||||||||||||
Sbjct: 146974 agatagatagatagataaca 146993



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 139    agatagatagatagataaca 158
              ||||||||||||||||||||
Sbjct: 115839 agatagatagatagataaca 115820



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 139   agatagatagatagataaca 158
             ||||||||||||||||||||
Sbjct: 75756 agatagatagatagataaca 75737



to top

>gb|AC133097.3| Mus musculus BAC clone RP23-287O2 from 1, complete sequence
          Length = 199276

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 139   agatagatagatagataacaaagta 163
             |||||||||||||||||||||||||
Sbjct: 12182 agatagatagatagataacaaagta 12206



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 135   atagagatagatagatagata 155
             |||||||||||||||||||||
Sbjct: 12138 atagagatagatagatagata 12158



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 137   agagatagatagatagataa 156
             ||||||||||||||||||||
Sbjct: 11985 agagatagatagatagataa 12004



to top

>gb|AC107677.7| Mus musculus chromosome 3, clone RP23-235F22, complete sequence
          Length = 157746

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 132   ataatagagatagatagatagata 155
             ||||||||||||||||||||||||
Sbjct: 73188 ataatagagatagatagatagata 73165



to top

>gb|AC156576.3| Mus musculus BAC clone RP23-7C22 from chromosome 13, complete sequence
          Length = 205345

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 132   ataatagagatagatagatagata 155
             ||||||||||||||||||||||||
Sbjct: 48774 ataatagagatagatagatagata 48797



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 132    ataatagagatagatagatagata 155
              |||| |||||||||||||||||||
Sbjct: 105856 ataaaagagatagatagatagata 105879



to top

>gb|AC122820.4| Mus musculus BAC clone RP23-200M5 from chromosome 6, complete sequence
          Length = 215238

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 132   ataatagagatagatagatagata 155
             ||||||||||||||||||||||||
Sbjct: 58932 ataatagagatagatagatagata 58955



to top

>gb|AC124486.4| Mus musculus BAC clone RP23-451E1 from chromosome 12, complete sequence
          Length = 183140

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 132   ataatagagatagatagatagata 155
             ||||||||||||||||||||||||
Sbjct: 71003 ataatagagatagatagatagata 71026



to top

>gb|AC124501.3| Mus musculus BAC clone RP23-412F10 from chromosome 6, complete sequence
          Length = 210057

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 132   ataatagagatagatagatagata 155
             ||||||||||||||||||||||||
Sbjct: 84493 ataatagagatagatagatagata 84470



to top

>gb|AC101142.9| Mus musculus chromosome 13, clone RP23-170P21, complete sequence
          Length = 176563

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 132   ataatagagatagatagatagata 155
             ||||||||||||||||||||||||
Sbjct: 10502 ataatagagatagatagatagata 10479



to top

>emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chromosome X Contains the 3'
              end of the IL3RA gene for interleukin 3 receptor, alpha
              (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra,
              MGC34174), the SLC25A6 gene for solute carrier family 25
              (mitochondrial carrier; adenine nucleotide translocator),
              member 6 (ANT3, ANT3Y, MGC17525), the ASMTL gene for
              acetylserotonin O-methyltransferase-like (ASMTLX), a novel
              gene (LOC286530), a novel gene (FLJ13330) and six CpG
              islands, complete sequence
          Length = 162377

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 132    ataatagagatagatagatagata 155
              ||||||||||||||||||||||||
Sbjct: 130783 ataatagagatagatagatagata 130760



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 132    ataatagagatagatagatagata 155
              |||||||| |||||||||||||||
Sbjct: 130362 ataatagaaatagatagatagata 130339



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 132    ataatagagatagatagatagata 155
              |||||||| |||||||||||||||
Sbjct: 129700 ataatagaaatagatagatagata 129677



to top

>gb|AC164168.3| Mus musculus 6 BAC RP23-343D21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 236103

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 132    ataatagagatagatagatagata 155
              ||||||||||||||||||||||||
Sbjct: 166712 ataatagagatagatagatagata 166689



to top

>gb|AC164662.6| Mus musculus 10 BAC RP24-279D11 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 154482

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 128   tattataatagagatagatagatagata 155
             |||| |||||||||||||||||||||||
Sbjct: 83143 tattctaatagagatagatagatagata 83170



to top

>gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270O7, complete sequence
          Length = 188834

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 132    ataatagagatagatagatagata 155
              ||||||||||||||||||||||||
Sbjct: 155238 ataatagagatagatagatagata 155215



to top

>gb|AC084407.10| Mus Musculus Strain C57BL6/J Chromosome 11 Clone RP23-271O13, complete
              sequence
          Length = 239837

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 132    ataatagagatagatagatagata 155
              ||||||||||||||||||||||||
Sbjct: 185071 ataatagagatagatagatagata 185094



to top

>gb|AC154817.2| Mus musculus BAC clone RP23-72G6 from chromosome 13, complete sequence
          Length = 143739

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 132   ataatagagatagatagatagata 155
             ||||||||||||||||||||||||
Sbjct: 43116 ataatagagatagatagatagata 43139



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   tagagatagatagatagata 155
             ||||||||||||||||||||
Sbjct: 21632 tagagatagatagatagata 21651



to top

>gb|AC153496.4| Mus musculus 10 BAC RP23-373D1 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 149839

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 128   tattataatagagatagatagatagata 155
             |||| |||||||||||||||||||||||
Sbjct: 47986 tattctaatagagatagatagatagata 47959



to top

>emb|AL929209.17| Mouse DNA sequence from clone RP23-415C3 on chromosome 2, complete
             sequence
          Length = 210790

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 132   ataatagagatagatagatagata 155
             ||||||||||||||||||||||||
Sbjct: 96395 ataatagagatagatagatagata 96372



to top

>gb|AC140301.3| Mus musculus BAC clone RP23-435M8 from 5, complete sequence
          Length = 197633

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 132   ataatagagatagatagatagata 155
             ||||||||||||||||||||||||
Sbjct: 68677 ataatagagatagatagatagata 68700



to top

>emb|AL606704.20| Mouse DNA sequence from clone RP23-375B1 on chromosome 11, complete
             sequence
          Length = 71109

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 132   ataatagagatagatagatagata 155
             ||||||||||||||||||||||||
Sbjct: 19350 ataatagagatagatagatagata 19373



to top

>emb|AL672188.6| Mouse DNA sequence from clone RP23-53B2 on chromosome X, complete
             sequence
          Length = 150121

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 132   ataatagagatagatagatagata 155
             ||||||||||||||||||||||||
Sbjct: 20026 ataatagagatagatagatagata 20049



to top

>gb|AY961930.1| Picea abies eukaryotic translation initiation factor 5A (eIF5A)
           mRNA, complete cds
          Length = 848

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 101/127 (79%)
 Strand = Plus / Minus

                                                                       
Query: 407 caaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcct 466
           ||||||||| |||||||||| | |||||    |||||||| || ||||| || |||||||
Sbjct: 480 caaatccagccttgatctgggccagcagttggtcatcagtaggcagcttgagatcatcct 421

                                                                       
Query: 467 tagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagct 526
           | || |  |||   |||||||||||||| ||| | ||||| ||||  || ||||| ||||
Sbjct: 420 tggtctgtccagattcagtcagcaggctaacaaaaccatcctcagaaatatcaattagct 361

                  
Query: 527 gataatc 533
           |||||||
Sbjct: 360 gataatc 354



to top

>gb|AC118009.7| Mus musculus chromosome 8, clone RP23-442H2, complete sequence
          Length = 208458

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 133  taatagagatagatagatagata 155
            |||||||||||||||||||||||
Sbjct: 6748 taatagagatagatagatagata 6726



to top

>gb|AC122239.4| Mus musculus BAC clone RP23-143K14 from chromosome 8, complete
            sequence
          Length = 197109

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 133  taatagagatagatagatagata 155
            |||||||||||||||||||||||
Sbjct: 5725 taatagagatagatagatagata 5747



to top

>gb|AC142328.1| Pan troglodytes BAC clone RP43-24E4 from 7, complete sequence
          Length = 192006

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 132   ataatagagatagatagatagat 154
             |||||||||||||||||||||||
Sbjct: 86219 ataatagagatagatagatagat 86241



to top

>emb|AJ391219.1|APY391219 Aethia pygmaea microsatellite DNA, clone AU06B11
          Length = 411

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 139 agatagatagatagataacaaag 161
           |||||||||||||||||||||||
Sbjct: 126 agatagatagatagataacaaag 148



to top

>emb|AL591521.8| Human DNA sequence from clone RP5-965F6 on chromosome 1 Contains the 5'
             end of a novel gene and a thioredoxin (TXN) pseudogene,
             complete sequence
          Length = 97110

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 133   taatagagatagatagatagata 155
             |||||||||||||||||||||||
Sbjct: 91120 taatagagatagatagatagata 91142



to top

>emb|AL589740.4| Human DNA sequence from clone RP11-436D23 on chromosome 6 Contains part
             of a novel gene, complete sequence
          Length = 187863

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 139   agatagatagatagataacaaag 161
             |||||||||||||||||||||||
Sbjct: 84702 agatagatagatagataacaaag 84680



to top

>emb|AL512510.13| Human DNA sequence from clone RP11-537P24 on chromosome 6 Contains a CpG
              island, complete sequence
          Length = 170970

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 135    atagagatagatagatagataac 157
              |||||||||||||||||||||||
Sbjct: 153550 atagagatagatagatagataac 153528



to top

>gb|AC098719.3| Mus musculus clone RP23-2M3, complete sequence
          Length = 219626

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 134  aatagagatagatagatagataa 156
            |||||||||||||||||||||||
Sbjct: 1197 aatagagatagatagatagataa 1175



to top

>gb|AC024887.22| Homo sapiens 3 BAC RP11-307B9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 99040

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 133   taatagagatagatagatagata 155
             |||||||||||||||||||||||
Sbjct: 65009 taatagagatagatagatagata 65031



to top

>gb|AC112230.5| Homo sapiens BAC clone RP11-85D18 from 2, complete sequence
          Length = 196480

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 104   ccactcagttccaattccaaagg 126
             |||||||||||||||||||||||
Sbjct: 18065 ccactcagttccaattccaaagg 18087



to top

>gb|AF054116.1|AF054116 Rattus norvegicus polymorphic marker D5UIA10 sequence
          Length = 531

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 129 attataatagagatagatagatagata 155
           |||||| ||||||||||||||||||||
Sbjct: 157 attatattagagatagatagatagata 131



to top

>gb|AC149588.4| Mus musculus BAC clone RP23-366I10 from 15, complete sequence
          Length = 200656

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 134   aatagagatagatagatagataa 156
             |||||||||||||||||||||||
Sbjct: 37374 aatagagatagatagatagataa 37396



to top

>gb|AC124097.6| Mus musculus chromosome 15, clone RP23-431H12, complete sequence
          Length = 203639

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 31456 agatagatagatagataacaaa 31435



to top

>gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, complete sequence
          Length = 201694

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 69131 agatagatagatagataacaaa 69110



to top

>gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, complete sequence
          Length = 171669

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 124512 aatagagatagatagatagata 124533



to top

>gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome 17, complete sequence
          Length = 199737

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 135    atagagatagatagatagataa 156
              ||||||||||||||||||||||
Sbjct: 101330 atagagatagatagatagataa 101351



to top

>gb|AC162466.6| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 186817

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 139  agatagatagatagataacaaa 160
            ||||||||||||||||||||||
Sbjct: 3206 agatagatagatagataacaaa 3185



to top

>gb|AC115930.10| Mus musculus chromosome 3, clone RP24-534H10, complete sequence
          Length = 158041

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 131868 aatagagatagatagatagata 131847



to top

>gb|AC099644.6| Mus musculus chromosome 15, clone RP24-359B20, complete sequence
          Length = 135063

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 46734 agatagatagatagataacaaa 46755



to top

>ref|NM_001013019.1| Mus musculus RIKEN cDNA 1110067I12 gene (1110067I12Rik), mRNA
          Length = 2685

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 134  aatagagatagatagatagata 155
            ||||||||||||||||||||||
Sbjct: 2614 aatagagatagatagatagata 2635



to top

>gb|AC161210.5| Mus musculus chromosome 3, clone RP23-71N6, complete sequence
          Length = 158006

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 108336 aatagagatagatagatagata 108315



to top

>gb|AF153595.1| Sebastes alutus microsatellite Sal1,6 sequence
          Length = 663

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 139 agatagatagatagataacaaa 160
           ||||||||||||||||||||||
Sbjct: 201 agatagatagatagataacaaa 222



to top

>gb|AY324145.1| Desmognathus auriculatus clone Dau11 microsatellite sequence
          Length = 366

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 134 aatagagatagatagatagata 155
           ||||||||||||||||||||||
Sbjct: 190 aatagagatagatagatagata 211



to top

>gb|U93889.1|MNU93889 Megaptera novaeangliae clone GATA019 microsatellite sequence
          Length = 997

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 134 aatagagatagatagatagata 155
           ||||||||||||||||||||||
Sbjct: 611 aatagagatagatagatagata 590



to top

>gb|AY024187.1| Oryza sativa microsatellite MRG6512 containing (TATC)X21, closest
           to marker RG908, genomic sequence
          Length = 284

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 139 agatagatagatagataacaaa 160
           ||||||||||||||||||||||
Sbjct: 117 agatagatagatagataacaaa 96



to top

>gb|AY024166.1| Oryza sativa microsatellite MRG6491 containing (TATC)X7, genomic
           sequence
          Length = 228

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 139 agatagatagatagataacaaa 160
           ||||||||||||||||||||||
Sbjct: 117 agatagatagatagataacaaa 96



to top

>gb|AY023432.1| Oryza sativa microsatellite MRG5757 containing (TAT)X39, genomic
           sequence
          Length = 317

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 139 agatagatagatagataacaaa 160
           ||||||||||||||||||||||
Sbjct: 33  agatagatagatagataacaaa 12



to top

>gb|AY023429.1| Oryza sativa microsatellite MRG5754 containing (TAT)X36, genomic
           sequence
          Length = 308

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 139 agatagatagatagataacaaa 160
           ||||||||||||||||||||||
Sbjct: 33  agatagatagatagataacaaa 12



to top

>gb|AC145809.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0023E20, complete sequence
          Length = 130827

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 42400 agatagatagatagataacaaa 42379



to top

>gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete
             sequence
          Length = 136150

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 11368 aatagagatagatagatagata 11347



to top

>gb|AC149301.1| Solanum demissum chromosome 5 clone PGEC517A09 map MAP_LOC, complete
              sequence
          Length = 133983

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 102992 aatagagatagatagatagata 103013



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 102837 aatagagatagatagatagata 102858



to top

>gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, complete sequence
          Length = 198736

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 131020 aatagagatagatagatagata 130999



to top

>gb|AY730340.1| Solanum tuberosum strain P6/210 clone BAC BA87d17, complete sequence
          Length = 75612

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 134  aatagagatagatagatagata 155
            ||||||||||||||||||||||
Sbjct: 4056 aatagagatagatagatagata 4035



to top

>gb|AC142496.2| Homo sapiens chromosome X clone RP1-8N8 map p11.23, complete sequence
          Length = 119525

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 135    atagagatagatagatagataa 156
              ||||||||||||||||||||||
Sbjct: 101520 atagagatagatagatagataa 101499



to top

>gb|AY526337.1| Panulirus argus clone Par3(4D19) microsatellite sequence
          Length = 229

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 134 aatagagatagatagatagata 155
           ||||||||||||||||||||||
Sbjct: 61  aatagagatagatagatagata 82



to top

>gb|AC115878.12| Mus musculus chromosome 15, clone RP24-358G9, complete sequence
          Length = 173049

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 44941 aatagagatagatagatagata 44962



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 135   atagagatagatagatagataa 156
             ||||||||||||||||||||||
Sbjct: 44920 atagagatagatagatagataa 44941



to top

>gb|AC133874.10| Mus musculus chromosome 19, clone RP23-81N16, complete sequence
          Length = 215113

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 206509 aatagagatagatagatagata 206530



to top

>gb|AC100986.9| Mus musculus chromosome 3, clone RP23-77E5, complete sequence
          Length = 112141

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 57598 aatagagatagatagatagata 57619



to top

>gb|AC134611.4| Mus musculus BAC clone RP23-98D8 from chromosome 15, complete sequence
          Length = 198894

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 42475 aatagagatagatagatagata 42454



to top

>gb|AC120845.11| Mus musculus chromosome 3, clone RP23-468E4, complete sequence
          Length = 174129

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 139  agatagatagatagataacaaa 160
            ||||||||||||||||||||||
Sbjct: 9821 agatagatagatagataacaaa 9842



to top

>gb|AC133649.2| Mus musculus BAC clone RP23-341M13 from chromosome 19, complete
             sequence
          Length = 187971

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 135   atagagatagatagatagataa 156
             ||||||||||||||||||||||
Sbjct: 59180 atagagatagatagatagataa 59159



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 135   atagagatagatagatagata 155
             |||||||||||||||||||||
Sbjct: 59054 atagagatagatagatagata 59034



to top

>gb|AC147380.2| Mus musculus BAC clone RP24-119J10 from chromosome 17, complete
             sequence
          Length = 156475

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 135   atagagatagatagatagataa 156
             ||||||||||||||||||||||
Sbjct: 10253 atagagatagatagatagataa 10274



to top

>gb|AC139335.3| Mus musculus BAC clone RP23-376N11 from chromosome 10, complete
             sequence
          Length = 195132

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 130   ttataatagagatagatagatagata 155
             |||||||| |||||||||||||||||
Sbjct: 35274 ttataatatagatagatagatagata 35299



to top

>gb|AC102195.14| Mus musculus chromosome 18, clone RP24-430B21, complete sequence
          Length = 173604

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 18630 aatagagatagatagatagata 18609



to top

>gb|AC162285.6| Mus musculus chromosome 7, clone RP23-312O8, complete sequence
          Length = 190344

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 139 agatagatagatagataacaaa 160
           ||||||||||||||||||||||
Sbjct: 802 agatagatagatagataacaaa 781



to top

>gb|AC165348.3| Mus musculus BAC clone RP23-300C11 from chromosome 3, complete sequence
          Length = 198637

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 11456 aatagagatagatagatagata 11435



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 135    atagagatagatagatagata 155
              |||||||||||||||||||||
Sbjct: 154901 atagagatagatagatagata 154921



to top

>gb|AC164603.4| Mus musculus chromosome 8, clone RP24-114E3, complete sequence
          Length = 164927

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 91634 aatagagatagatagatagata 91655



to top

>gb|DQ168326.1| Solanum tuberosum clone 149E01 metallocarboxypeptidase inhibitor
           precursor, mRNA, complete cds
          Length = 546

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 135 atagagatagatagatagataa 156
           ||||||||||||||||||||||
Sbjct: 353 atagagatagatagatagataa 332



to top

>gb|DQ168312.1| Solanum tuberosum clone 024H10 metallocarboxypeptidase inhibitor
           precursor, mRNA, complete cds
          Length = 532

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 135 atagagatagatagatagataa 156
           ||||||||||||||||||||||
Sbjct: 347 atagagatagatagatagataa 326



to top

>gb|AC164102.2| Mus musculus BAC clone RP23-7E23 from chromosome 13, complete
            sequence
          Length = 234552

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 134  aatagagatagatagatagata 155
            ||||||||||||||||||||||
Sbjct: 5967 aatagagatagatagatagata 5946



to top

>gb|AC137991.3| Oryza sativa chromosome 3 BAC OSJNBa0034D21 genomic sequence, complete
              sequence
          Length = 190834

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 139    agatagatagatagataacaaa 160
              ||||||||||||||||||||||
Sbjct: 132859 agatagatagatagataacaaa 132838



to top

>gb|AC139863.5| Mus musculus chromosome 14, clone RP23-19M21, complete sequence
          Length = 194221

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 40249 agatagatagatagataacaaa 40228



to top

>gb|AC118227.12| Mus musculus chromosome 15, clone RP23-379H6, complete sequence
          Length = 200663

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 139    agatagatagatagataacaaa 160
              ||||||||||||||||||||||
Sbjct: 169580 agatagatagatagataacaaa 169601



to top

>emb|BX908756.12| Zebrafish DNA sequence from clone CH211-190D13 in linkage group 1,
            complete sequence
          Length = 134952

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 134  aatagagatagatagatagata 155
            ||||||||||||||||||||||
Sbjct: 8866 aatagagatagatagatagata 8887



to top

>emb|AL133390.7| Human DNA sequence from clone RP1-317G22 on chromosome 1, complete
             sequence
          Length = 71872

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 16978 aatagagatagatagatagata 16957



to top

>gb|AC124444.4| Mus musculus BAC clone RP24-185P7 from chromosome 7, complete sequence
          Length = 184996

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 139    agatagatagatagataacaaa 160
              ||||||||||||||||||||||
Sbjct: 160072 agatagatagatagataacaaa 160093



to top

>gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosome 7, complete sequence
          Length = 152908

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 73011 aatagagatagatagatagata 72990



to top

>gb|AC118607.12| Mus musculus chromosome 14, clone RP23-479D1, complete sequence
          Length = 218552

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 44612 aatagagatagatagatagata 44633



to top

>gb|AC121996.3| Mus musculus BAC clone RP24-312F5 from chromosome 3, complete sequence
          Length = 169912

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 139    agatagatagatagataacaaa 160
              ||||||||||||||||||||||
Sbjct: 158216 agatagatagatagataacaaa 158195



to top

>gb|AC129217.3| Mus musculus BAC clone RP24-458M20 from chromosome 19, complete
             sequence
          Length = 175796

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 87314 aatagagatagatagatagata 87335



to top

>gb|AC127563.4| Mus musculus BAC clone RP24-283E13 from chromosome 10, complete sequence
          Length = 150502

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 139    agatagatagatagataacaaa 160
              ||||||||||||||||||||||
Sbjct: 115480 agatagatagatagataacaaa 115501



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 135  atagagatagatagatagata 155
            |||||||||||||||||||||
Sbjct: 8824 atagagatagatagatagata 8804



to top

>gb|AC124523.5| Mus musculus BAC clone RP23-399P19 from chromosome 6, complete sequence
          Length = 188084

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 135   atagagatagatagatagataa 156
             ||||||||||||||||||||||
Sbjct: 62452 atagagatagatagatagataa 62473



to top

>gb|AC112792.4| Mus musculus BAC clone RP23-192J17 from 18, complete sequence
          Length = 219784

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 173490 aatagagatagatagatagata 173469



to top

>gb|AC124752.4| Mus musculus BAC clone RP23-283G18 from 13, complete sequence
          Length = 215435

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 171786 aatagagatagatagatagata 171807



to top

>gb|AC122880.4| Mus musculus BAC clone RP23-77F18 from 8, complete sequence
          Length = 189549

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 16333 aatagagatagatagatagata 16354



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 135   atagagatagatagatagata 155
             |||||||||||||||||||||
Sbjct: 91303 atagagatagatagatagata 91323



to top

>gb|AC122912.2| Mus musculus BAC clone RP23-61E5 from 7, complete sequence
          Length = 255062

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 139    agatagatagatagataacaaa 160
              ||||||||||||||||||||||
Sbjct: 192604 agatagatagatagataacaaa 192583



to top

>gb|AC114006.3| Mus musculus BAC clone RP23-185F9 from 17, complete sequence
          Length = 202882

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 135   atagagatagatagatagataa 156
             ||||||||||||||||||||||
Sbjct: 47664 atagagatagatagatagataa 47643



to top

>gb|AC122027.1| Mus musculus BAC clone RP24-390L20 from 1, complete sequence
          Length = 150136

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 130946 aatagagatagatagatagata 130925



to top

>gb|AC114823.4| Mus musculus BAC clone RP23-209L10 from 2, complete sequence
          Length = 170884

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 163149 aatagagatagatagatagata 163170



to top

>gb|AC107369.9| Mus musculus chromosome 15, clone RP23-368M2, complete sequence
          Length = 216082

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 73052 agatagatagatagataacaaa 73073



to top

>gb|AC113025.9| Mus musculus chromosome 6, clone RP23-196D12, complete sequence
          Length = 223925

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 139    agatagatagatagataacaaagtac 164
              ||||||||||||||||||||| ||||
Sbjct: 184816 agatagatagatagataacaacgtac 184841



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 135    atagagatagatagatagata 155
              |||||||||||||||||||||
Sbjct: 188012 atagagatagatagatagata 188032



to top

>gb|AC093714.2| Homo sapiens BAC clone RP11-458K10 from 7, complete sequence
          Length = 142751

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 12939 aatagagatagatagatagata 12918



to top

>gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, complete sequence
          Length = 218079

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 80728 aatagagatagatagatagata 80749



to top

>gb|AC100590.9| Mus musculus chromosome 10, clone RP23-156N5, complete sequence
          Length = 195389

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 37205 agatagatagatagataacaaa 37226



to top

>gb|AC107781.9| Mus musculus, clone RP23-56O1, complete sequence
          Length = 174437

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 29/30 (96%), Gaps = 1/30 (3%)
 Strand = Plus / Plus

                                            
Query: 127    gtattata-atagagatagatagatagata 155
              |||||||| |||||||||||||||||||||
Sbjct: 133194 gtattatatatagagatagatagatagata 133223



to top

>emb|AL391840.6| Human DNA sequence from clone RP11-342L8 on chromosome 6 Contains a
             gene for a novel protein and a CpG island, complete
             sequence
          Length = 109737

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 47690 agatagatagatagataacaaa 47711



to top

>gb|AC159970.4| Mus musculus chromosome 3, clone RP23-301J11, complete sequence
          Length = 191207

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 66114 agatagatagatagataacaaa 66093



to top

>emb|AL022161.1|HS380C13 Human DNA sequence from clone RP3-380C13 on chromosome Xq22.1-22.3
             Contains a calmodulin 2 (phosphorylase kinase, delta)
             (CALM2) pseudogene, complete sequence
          Length = 139444

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 135   atagagatagatagatagataa 156
             ||||||||||||||||||||||
Sbjct: 99980 atagagatagatagatagataa 99959



to top

>gb|AC073153.16| Mus musculus Strain C57BL6/J chromosome 19 BAC, RP23-49P8 Complete
              Sequence, complete sequence
          Length = 220143

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 142683 aatagagatagatagatagata 142662



to top

>gb|AC165148.2| Mus musculus BAC clone RP24-278K24 from chromosome 14, complete sequence
          Length = 197531

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 125924 aatagagatagatagatagata 125945



to top

>emb|CR352297.14| Zebrafish DNA sequence from clone CH211-165L15 in linkage group 8,
             complete sequence
          Length = 159143

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 130   ttataatagagatagatagatagata 155
             |||||| |||||||||||||||||||
Sbjct: 13214 ttataagagagatagatagatagata 13239



to top

>emb|CR384099.6| Zebrafish DNA sequence from clone DKEY-266I18 in linkage group 24,
             complete sequence
          Length = 121857

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 23155 agatagatagatagataacaaa 23176



to top

>emb|BX323089.13| Zebrafish DNA sequence from clone DKEYP-10D2 in linkage group 21,
            complete sequence
          Length = 87960

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 134  aatagagatagatagatagata 155
            ||||||||||||||||||||||
Sbjct: 6964 aatagagatagatagatagata 6985



to top

>emb|AL713925.10| Mouse DNA sequence from clone RP23-298B18 on chromosome 11, complete
             sequence
          Length = 81699

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 18011 aatagagatagatagatagata 17990



to top

>emb|AL646093.9| Mouse DNA sequence from clone RP23-55I2 on chromosome 11 Contains the
            Kcnj12 gene for potassium inwardly-rectifying channel
            subfamily J member 12, a ribosomal protein L27a (Rpl27a)
            pseudogene, the Tnfrsf13b gene for tumor necrosis factor
            receptor superfamily member 13b, the Usp22 gene for
            ubiquitin specific protease 22, a ribosomal protein S13
            (Rps13) pseudogene, the Aldh3a1 gene for aldehyde
            dehydrogenase family 3 subfamily A1, the 3' end of one
            variant of the Aldh3a2 gene for aldehyde dehydrogenase
            family 3 subfamily A2 and three CpG islands, complete
            sequence
          Length = 241400

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 139  agatagatagatagataacaaa 160
            ||||||||||||||||||||||
Sbjct: 7540 agatagatagatagataacaaa 7519



to top

>emb|AL669858.8| Mouse DNA sequence from clone RP23-51G7 on chromosome 11 Contains a
              ribosomal protein L15 (Rpl15) pseudogene, the Otx1 gene for
              orthodenticle homolog 1, the 3' end of a novel gene and two
              CpG islands, complete sequence
          Length = 240514

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 139    agatagatagatagataacaaa 160
              ||||||||||||||||||||||
Sbjct: 152206 agatagatagatagataacaaa 152185



to top

>emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chromosome 11 Contains a
              novel pseudogene, complete sequence
          Length = 203319

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 168420 aatagagatagatagatagata 168399



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 139    agatagatagatagataaca 158
              ||||||||||||||||||||
Sbjct: 120120 agatagatagatagataaca 120101



to top

>emb|BX276104.14| Mouse DNA sequence from clone RP24-313E3 on chromosome 4, complete
              sequence
          Length = 152376

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 134    aatagagatagatagatagata 155
              ||||||||||||||||||||||
Sbjct: 130296 aatagagatagatagatagata 130317



to top

>emb|AL928592.13| Mouse DNA sequence from clone RP24-168J7 on chromosome 4 Contains a
             novel pseudogene and a novel gene, complete sequence
          Length = 126611

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 51383 agatagatagatagataacaaa 51404



to top

>emb|BX511109.4| Zebrafish DNA sequence from clone DKEY-288G16 in linkage group 7,
              complete sequence
          Length = 124061

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 139    agatagatagatagataacaaa 160
              ||||||||||||||||||||||
Sbjct: 109679 agatagatagatagataacaaa 109658



to top

>gb|AC124771.4| Mus musculus BAC clone RP23-28G12 from chromosome 1, complete
            sequence
          Length = 209463

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 134  aatagagatagatagatagata 155
            ||||||||||||||||||||||
Sbjct: 3554 aatagagatagatagatagata 3533



to top

>emb|AL929566.30| Zebrafish DNA sequence from clone CH211-159C13 in linkage group 8,
             complete sequence
          Length = 137166

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 18227 agatagatagatagataacaaa 18206



to top

>emb|CR293511.11| Zebrafish DNA sequence from clone DKEY-93H22 in linkage group 1,
             complete sequence
          Length = 178953

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 139   agatagatagatagataacaaa 160
             ||||||||||||||||||||||
Sbjct: 26029 agatagatagatagataacaaa 26050



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 135   atagagatagatagatagata 155
             |||||||||||||||||||||
Sbjct: 46356 atagagatagatagatagata 46376



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 135   atagagatagatagatagata 155
             |||||||||||||||||||||
Sbjct: 46266 atagagatagatagatagata 46286



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 135   atagagatagatagatagata 155
             |||||||||||||||||||||
Sbjct: 43469 atagagatagatagatagata 43489



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   tagagatagatagatagata 155
             ||||||||||||||||||||
Sbjct: 46505 tagagatagatagatagata 46524



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   tagagatagatagatagata 155
             ||||||||||||||||||||
Sbjct: 46439 tagagatagatagatagata 46458



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   tagagatagatagatagata 155
             ||||||||||||||||||||
Sbjct: 46189 tagagatagatagatagata 46208



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   tagagatagatagatagata 155
             ||||||||||||||||||||
Sbjct: 19797 tagagatagatagatagata 19816



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 136  tagagatagatagatagata 155
            ||||||||||||||||||||
Sbjct: 5825 tagagatagatagatagata 5844



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 136  tagagatagatagatagata 155
            ||||||||||||||||||||
Sbjct: 5775 tagagatagatagatagata 5794



to top

>emb|BX629347.20| Zebrafish DNA sequence from clone DKEY-103K21 in linkage group 12,
             complete sequence
          Length = 200079

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 130   ttataatagagatagatagatagata 155
             |||||||| |||||||||||||||||
Sbjct: 17241 ttataataaagatagatagatagata 17216



to top

>gb|DQ402491.1| Liposcelis decolor microsatellite Lip135 sequence
          Length = 256

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 134 aatagagatagatagatagata 155
           ||||||||||||||||||||||
Sbjct: 154 aatagagatagatagatagata 133



to top

>emb|AL844587.19| Zebrafish DNA sequence from clone DKEY-7E14 in linkage group 12, complete
              sequence
          Length = 254964

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 130    ttataatagagatagatagatagata 155
              |||||||| |||||||||||||||||
Sbjct: 170931 ttataataaagatagatagatagata 170906



to top

>gb|AC008249.14| Homo sapiens 3 BAC RP11-211P13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 184203

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 134   aatagagatagatagatagata 155
             ||||||||||||||||||||||
Sbjct: 71619 aatagagatagatagatagata 71598


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,901,371
Number of Sequences: 3902068
Number of extensions: 6901371
Number of successful extensions: 1046686
Number of sequences better than 10.0: 2092
Number of HSP's better than 10.0 without gapping: 2105
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 913837
Number of HSP's gapped (non-prelim): 132707
length of query: 651
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 628
effective length of database: 17,143,297,704
effective search space: 10765990958112
effective search space used: 10765990958112
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top