ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags12a01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC024791.1| Caenorhabditis elegans cosmid Y47G6A, complete se... 42 1.1
2gb|AC122752.10| Mus musculus chromosome 8, clone RP24-358A6, com... 40 4.2
3gb|AC101691.7| Mus musculus chromosome 19, clone RP23-220B4, com... 40 4.2
4gb|AC123253.4| Rattus norvegicus 12 BAC CH230-230N7 (Children's ... 40 4.2
5emb|AL162730.26| Human DNA sequence from clone RP11-265B8 on chr... 40 4.2
6gb|AY032730.2| Mus musculus strain 129 steroidogenic acute regul... 40 4.2

>gb|AC024791.1| Caenorhabditis elegans cosmid Y47G6A, complete sequence
          Length = 194322

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 111   aaaaaacgttgtgaaattaaa 131
             |||||||||||||||||||||
Sbjct: 34180 aaaaaacgttgtgaaattaaa 34160



to top

>gb|AC122752.10| Mus musculus chromosome 8, clone RP24-358A6, complete sequence
          Length = 155477

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 237   ggccggttcgctcatctgtgatga 260
             |||||||| |||||||||||||||
Sbjct: 21933 ggccggtttgctcatctgtgatga 21956



to top

>gb|AC101691.7| Mus musculus chromosome 19, clone RP23-220B4, complete sequence
          Length = 175552

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 123    gaaattaaagaaaggnaaattaa 145
              ||||||||||||||| |||||||
Sbjct: 103568 gaaattaaagaaagggaaattaa 103546



to top

>gb|AC123253.4| Rattus norvegicus 12 BAC CH230-230N7 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 231202

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 196    agcaagctgcagtcggctca 215
              ||||||||||||||||||||
Sbjct: 116307 agcaagctgcagtcggctca 116288



to top

>emb|AL162730.26| Human DNA sequence from clone RP11-265B8 on chromosome 9 Contains the
             3' end of the PIP5K1B gene for
             phosphatidylinositol-4-phosphate 5-kinase, type I, beta
             (MSS4, STM7), the PRKACG gene for protein kinase,
             cAMP-dependent, catalytic, gamma (KAPG), the FRDA gene for
             Friedreich ataxia (FA, FARR), a novel gene and three CpG
             islands, complete sequence
          Length = 171381

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   ttcgctcatctgtgatgatt 262
             ||||||||||||||||||||
Sbjct: 74852 ttcgctcatctgtgatgatt 74833



to top

>gb|AY032730.2| Mus musculus strain 129 steroidogenic acute regulatory protein
           (Star) gene, exons 1 through 7 and complete cds; nuclear
           gene for mitochondrial product
          Length = 4617

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 237 ggccggttcgctcatctgtgatga 260
           |||||||| |||||||||||||||
Sbjct: 883 ggccggtttgctcatctgtgatga 906


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,615,645
Number of Sequences: 3902068
Number of extensions: 1615645
Number of successful extensions: 28755
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28749
Number of HSP's gapped (non-prelim): 6
length of query: 321
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 299
effective length of database: 17,147,199,772
effective search space: 5127012731828
effective search space used: 5127012731828
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top