ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags11k21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_507189.1| PREDICTED Oryza sativa (japonica cultivar-group... 117 5e-23
2dbj|AK069354.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 5e-23
3dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 92 3e-15
4dbj|AP005485.3| Oryza sativa (japonica cultivar-group) genomic D... 92 3e-15
5emb|BX119959.7| Mouse DNA sequence from clone RP23-346N16 on chr... 48 0.035
6gb|AC007364.3| Homo sapiens BAC clone RP11-329H24 from 2, comple... 44 0.55
7gb|AC103993.8| Homo sapiens chromosome 8, clone RP11-67H2, compl... 44 0.55
8dbj|AP005355.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 44 0.55
9gb|AC119214.6| Mus musculus chromosome 8, clone RP24-199K4, comp... 42 2.2
10gb|BC081896.1| Rattus norvegicus cyclin-dependent kinase-like 1 ... 42 2.2
11gb|AC087240.17| Homo sapiens 12p BAC RP11-752F20 (Roswell Park C... 42 2.2
12gb|AC158352.5| Mus musculus chromosome 8, clone RP24-325B16, com... 42 2.2
13ref|NM_001025121.1| Rattus norvegicus cyclin-dependent kinase-li... 42 2.2
14gb|AC121769.4| Mus musculus BAC clone RP23-340N4 from chromosome... 42 2.2
15gb|AF013593.2| Homo sapiens chromosome X multiple clones map q28... 42 2.2
16emb|CR318592.7| Zebrafish DNA sequence from clone CH211-51F17 in... 42 2.2
17gb|AC100386.29| Mus musculus chromosome 10, clone RP23-132J19, c... 42 2.2
18emb|AL731724.8| Mouse DNA sequence from clone RP23-1F19 on chrom... 42 2.2
19gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence 40 8.5
20gb|AC104642.11| Trypanosoma brucei chromosome 3 clone RPCI93-27C... 40 8.5
21gb|AC096938.8| Rattus norvegicus 16 BAC CH230-49B24 (Children's ... 40 8.5
22gb|AC124998.10| Mus musculus chromosome 10, clone RP24-350B12, c... 40 8.5
23gb|AC003083.2| Homo sapiens BAC clone CTB-60N22 from 7, complete... 40 8.5
24gb|AC122452.4| Mus musculus BAC clone RP24-255M5 from chromosome... 40 8.5
25gb|AC110166.17| Mus musculus chromosome 16, clone RP23-80O10, co... 40 8.5
26emb|CR407567.2| Human DNA sequence from clone RP11-312O7 on chro... 40 8.5
27emb|BX537114.2| Human DNA sequence from clone RP11-289H16 on chr... 40 8.5
28emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chr... 40 8.5
29emb|AL161626.20| Human DNA sequence from clone RP11-214N16 on ch... 40 8.5
30emb|AL109806.22|HSJ1153D9 Human DNA sequence from clone RP5-1153... 40 8.5
31emb|AL078463.11|HSJ365I19 Human DNA sequence from clone RP3-365I... 40 8.5
32emb|AL035209.1|HS7H11 Human DNA sequence from clone XX-D7H11 on ... 40 8.5
33gb|BT009427.1| Triticum aestivum clone wlmk1.pk0030.f2:fis, full... 40 8.5
34ref|XM_967274.1| PREDICTED: Tribolium castaneum similar to Lamin... 40 8.5
35emb|AL603707.5| Mouse DNA sequence from clone RP23-422L16 on chr... 40 8.5
36emb|AL161571.2|ATCHRIV67 Arabidopsis thaliana DNA chromosome 4, ... 40 8.5
37emb|AL078467.1|ATF27G19 Arabidopsis thaliana DNA chromosome 4, B... 40 8.5
38emb|CR855273.7| Zebrafish DNA sequence from clone DKEYP-34E1 in ... 40 8.5
39emb|CR589924.4| Human DNA sequence from clone WI2-929E21 on chro... 40 8.5
40gb|AC084393.20| Homo sapiens 12q BAC RP11-453E3 (Roswell Park Ca... 40 8.5
41gb|AF218854.1|AF218854 Mus musculus cytochrome P450 arachidonic ... 40 8.5
42ref|XM_692521.1| PREDICTED: Danio rerio similar to Neurabin-II (... 40 8.5
43gb|AY916779.1| Homo sapiens membrane cofactor protein (CD46, tro... 40 8.5
44gb|AF335470.1|AF335470 Mus musculus myosin light chain kinase (M... 40 8.5
45emb|BX322616.8| Zebrafish DNA sequence from clone DKEY-21K24 in ... 40 8.5
46emb|AL109844.14|HSJ636L22 Human DNA sequence from clone RP4-636L... 40 8.5
47dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.5
48gb|AC109912.10| Homo sapiens 3 BAC RP11-640G21 (Roswell Park Can... 40 8.5
49dbj|AP002913.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.5
50gb|AC144755.3| Didelphis virginiana clone LB3-224H2, complete se... 40 8.5
51gb|AC154813.2| Mus musculus BAC clone RP24-532J13 from 16, compl... 40 8.5
52gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 40 8.5
53emb|AL807387.10| Mouse DNA sequence from clone RP23-24J10 on chr... 40 8.5
54gb|AC156500.2| Mus musculus BAC clone RP24-126J12 from chromosom... 40 8.5
55gb|DP000023.1| Didelphis virginiana target 1 genomic scaffold 40 8.5
56emb|AL683816.6| Mouse DNA sequence from clone RP23-120E8 on chro... 40 8.5

>ref|XM_507189.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1136_D12.120
            patrial mRNA
          Length = 1756

 Score =  117 bits (59), Expect = 5e-23
 Identities = 137/163 (84%)
 Strand = Plus / Minus

                                                                        
Query: 294  cctagtttgacattgtactccagtccgcaacagcatttaataggatcaggaactaccttc 353
            ||||||| ||| |||||||||| |||||||| |||||| |  | ||||| |||| |||||
Sbjct: 1538 cctagttcgaccttgtactccaatccgcaacggcattttactgcatcagaaactcccttc 1479

                                                                        
Query: 354  attttaatgatccgttcttcaagagactggaagtactgagcttctccagctctatcacct 413
            |||| | | || ||||||||||||||||| ||||||| |  |||||||||| ||||| ||
Sbjct: 1478 atttcatttatacgttcttcaagagactgaaagtactcaatttctccagctttatcagct 1419

                                                       
Query: 414  tgtagagccttgtattcctcctccaaggactttgtatccatct 456
            |||||||| |||| ||||||||| ||||| ||  |||||||||
Sbjct: 1418 tgtagagctttgtgttcctcctctaaggatttcatatccatct 1376



to top

>dbj|AK069354.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023018H14, full
            insert sequence
          Length = 2338

 Score =  117 bits (59), Expect = 5e-23
 Identities = 137/163 (84%)
 Strand = Plus / Minus

                                                                        
Query: 294  cctagtttgacattgtactccagtccgcaacagcatttaataggatcaggaactaccttc 353
            ||||||| ||| |||||||||| |||||||| |||||| |  | ||||| |||| |||||
Sbjct: 2120 cctagttcgaccttgtactccaatccgcaacggcattttactgcatcagaaactcccttc 2061

                                                                        
Query: 354  attttaatgatccgttcttcaagagactggaagtactgagcttctccagctctatcacct 413
            |||| | | || ||||||||||||||||| ||||||| |  |||||||||| ||||| ||
Sbjct: 2060 atttcatttatacgttcttcaagagactgaaagtactcaatttctccagctttatcagct 2001

                                                       
Query: 414  tgtagagccttgtattcctcctccaaggactttgtatccatct 456
            |||||||| |||| ||||||||| ||||| ||  |||||||||
Sbjct: 2000 tgtagagctttgtgttcctcctctaaggatttcatatccatct 1958



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 94/110 (85%)
 Strand = Plus / Minus

                                                                            
Query: 347      taccttcattttaatgatccgttcttcaagagactggaagtactgagcttctccagctct 406
                ||||||||||| | | || ||||||||||||||||| ||||||| |  |||||||||| |
Sbjct: 13943023 taccttcatttcatttatacgttcttcaagagactgaaagtactcaatttctccagcttt 13942964

                                                                  
Query: 407      atcaccttgtagagccttgtattcctcctccaaggactttgtatccatct 456
                |||| |||||||||| |||| ||||||||| ||||| ||  |||||||||
Sbjct: 13942963 atcagcttgtagagctttgtgttcctcctctaaggatttcatatccatct 13942914



to top

>dbj|AP005485.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1136_D12
          Length = 105521

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 94/110 (85%)
 Strand = Plus / Minus

                                                                         
Query: 347   taccttcattttaatgatccgttcttcaagagactggaagtactgagcttctccagctct 406
             ||||||||||| | | || ||||||||||||||||| ||||||| |  |||||||||| |
Sbjct: 87418 taccttcatttcatttatacgttcttcaagagactgaaagtactcaatttctccagcttt 87359

                                                               
Query: 407   atcaccttgtagagccttgtattcctcctccaaggactttgtatccatct 456
             |||| |||||||||| |||| ||||||||| ||||| ||  |||||||||
Sbjct: 87358 atcagcttgtagagctttgtgttcctcctctaaggatttcatatccatct 87309



to top

>emb|BX119959.7| Mouse DNA sequence from clone RP23-346N16 on chromosome X, complete
              sequence
          Length = 193860

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 149    tggcttttctttcttacttcttcc 172
              ||||||||||||||||||||||||
Sbjct: 117884 tggcttttctttcttacttcttcc 117861



to top

>gb|AC007364.3| Homo sapiens BAC clone RP11-329H24 from 2, complete sequence
          Length = 200908

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 152    cttttctttcttacttcttccttgtt 177
              ||||||||||||||||||||| ||||
Sbjct: 181164 cttttctttcttacttcttccatgtt 181139



to top

>gb|AC103993.8| Homo sapiens chromosome 8, clone RP11-67H2, complete sequence
          Length = 147742

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ttttctttcttacttcttcctt 174
             ||||||||||||||||||||||
Sbjct: 34248 ttttctttcttacttcttcctt 34227



to top

>dbj|AP005355.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1189A8, complete
             sequence
          Length = 151101

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ttttctttcttacttcttcctt 174
             ||||||||||||||||||||||
Sbjct: 45947 ttttctttcttacttcttcctt 45926



to top

>gb|AC119214.6| Mus musculus chromosome 8, clone RP24-199K4, complete sequence
          Length = 156548

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 461   tactgcagcagggaagctagc 481
             |||||||||||||||||||||
Sbjct: 26679 tactgcagcagggaagctagc 26699



to top

>gb|BC081896.1| Rattus norvegicus cyclin-dependent kinase-like 1 (CDC2-related
            kinase) (predicted), mRNA (cDNA clone MGC:93810
            IMAGE:7110321), complete cds
          Length = 1861

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 38   tcttccttgttggtttgtcat 58
            |||||||||||||||||||||
Sbjct: 1022 tcttccttgttggtttgtcat 1002



to top

>gb|AC087240.17| Homo sapiens 12p BAC RP11-752F20 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 198068

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 143   agtacttggcttttctttctt 163
             |||||||||||||||||||||
Sbjct: 85311 agtacttggcttttctttctt 85331



to top

>gb|AC158352.5| Mus musculus chromosome 8, clone RP24-325B16, complete sequence
          Length = 166845

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 461    tactgcagcagggaagctagc 481
              |||||||||||||||||||||
Sbjct: 119062 tactgcagcagggaagctagc 119082



to top

>ref|NM_001025121.1| Rattus norvegicus cyclin-dependent kinase-like 1 (CDC2-related
            kinase) (predicted) (Cdkl1_predicted), mRNA
          Length = 1861

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 38   tcttccttgttggtttgtcat 58
            |||||||||||||||||||||
Sbjct: 1022 tcttccttgttggtttgtcat 1002



to top

>gb|AC121769.4| Mus musculus BAC clone RP23-340N4 from chromosome 5, complete sequence
          Length = 186413

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   tcttcaagagactggaagtac 389
             |||||||||||||||||||||
Sbjct: 60380 tcttcaagagactggaagtac 60360



to top

>gb|AF013593.2| Homo sapiens chromosome X multiple clones map q28, complete sequence
          Length = 85806

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 151   gcttttctttcttacttcttccttg 175
             |||||||||||| ||||||||||||
Sbjct: 38127 gcttttctttctcacttcttccttg 38103



to top

>emb|CR318592.7| Zebrafish DNA sequence from clone CH211-51F17 in linkage group 19,
             complete sequence
          Length = 124310

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 44    ttgttggtttgtcatttcatt 64
             |||||||||||||||||||||
Sbjct: 36233 ttgttggtttgtcatttcatt 36213



to top

>gb|AC100386.29| Mus musculus chromosome 10, clone RP23-132J19, complete sequence
          Length = 216928

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     ttggtcttttcttcttatact 37
              |||||||||||||||||||||
Sbjct: 104476 ttggtcttttcttcttatact 104456



to top

>emb|AL731724.8| Mouse DNA sequence from clone RP23-1F19 on chromosome 2, complete
              sequence
          Length = 205917

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 51     tttgtcatttcattggtaaat 71
              |||||||||||||||||||||
Sbjct: 118174 tttgtcatttcattggtaaat 118194



to top

>gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence
          Length = 1653225

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 16     cttggtcttttcttcttatacttcttcc 43
              ||||||||||||||||| | ||||||||
Sbjct: 757484 cttggtcttttcttcttcttcttcttcc 757511



to top

>gb|AC104642.11| Trypanosoma brucei chromosome 3 clone RPCI93-27C5, complete sequence
          Length = 126762

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 16    cttggtcttttcttcttatacttcttcc 43
             ||||||||||||||||| | ||||||||
Sbjct: 66432 cttggtcttttcttcttcttcttcttcc 66459



to top

>gb|AC096938.8| Rattus norvegicus 16 BAC CH230-49B24 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 220401

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 423    ttgtattcctcctccaagga 442
              ||||||||||||||||||||
Sbjct: 178896 ttgtattcctcctccaagga 178915



to top

>gb|AC124998.10| Mus musculus chromosome 10, clone RP24-350B12, complete sequence
          Length = 185801

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 491    gctctcctgctcaagggtct 510
              ||||||||||||||||||||
Sbjct: 110156 gctctcctgctcaagggtct 110137



to top

>gb|AC003083.2| Homo sapiens BAC clone CTB-60N22 from 7, complete sequence
          Length = 136823

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 169    ttccttgttggtttgttatt 188
              ||||||||||||||||||||
Sbjct: 122588 ttccttgttggtttgttatt 122607



to top

>gb|AC122452.4| Mus musculus BAC clone RP24-255M5 from chromosome 16, complete sequence
          Length = 181463

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 465    gcagcagggaagctagcagt 484
              ||||||||||||||||||||
Sbjct: 162895 gcagcagggaagctagcagt 162876



to top

>gb|AC110166.17| Mus musculus chromosome 16, clone RP23-80O10, complete sequence
          Length = 131042

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 465   gcagcagggaagctagcagt 484
             ||||||||||||||||||||
Sbjct: 95975 gcagcagggaagctagcagt 95956



to top

>emb|CR407567.2| Human DNA sequence from clone RP11-312O7 on chromosome 1 Contains a
             novel gene (MGC57827) and a CpG island, complete sequence
          Length = 90590

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    gtacttggtcttttcttctt 32
             ||||||||||||||||||||
Sbjct: 38914 gtacttggtcttttcttctt 38895



to top

>emb|BX537114.2| Human DNA sequence from clone RP11-289H16 on chromosome 1 Contains
           part of the gene for a novel protein similar to formin
           binding protein 2 (FNBP2) and a novel gene, complete
           sequence
          Length = 156399

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 13  gtacttggtcttttcttctt 32
           ||||||||||||||||||||
Sbjct: 577 gtacttggtcttttcttctt 596



to top

>emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chromosome 1 Contains four
             novel genes, a novel gene (MGC57827), a ribosomal protein
             L22 (RPL22) pseudogene, a histone 2 H3c (HIST2H3C)
             pseudogene, the HIST2H2BB gene for histone 2 H2bb, the
             FCGR1B gene for Fc fragment of IgG high affinity Ib
             receptor for (CD64) and three CpG islands, complete
             sequence
          Length = 189539

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    gtacttggtcttttcttctt 32
             ||||||||||||||||||||
Sbjct: 64969 gtacttggtcttttcttctt 64950



to top

>emb|AL161626.20| Human DNA sequence from clone RP11-214N16 on chromosome 9 Contains the
             3' end of the GCNT1 gene for glucosaminyl (N-acetyl)
             transferase 1 core 2
             (beta-1,6-N-acetylglucosaminyltransferase), a
             peptidylprolyl isomerase A (cyclophilin A) (PPIA)
             pseudogene and the 3' end of the KIAA0376 gene, complete
             sequence
          Length = 183858

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   gcttaataccttaatatgga 229
             ||||||||||||||||||||
Sbjct: 35957 gcttaataccttaatatgga 35976



to top

>emb|AL109806.22|HSJ1153D9 Human DNA sequence from clone RP5-1153D9 on chromosome 20 Contains the
             C20orf43 gene, the C20orf106 gene, the C20orf107 gene and
             the C20orf105 gene for a novel protein similar to beta
             1,6-N-acetylglucosaminyltransferase, complete sequence
          Length = 94121

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   acttcctacattataaatct 121
             ||||||||||||||||||||
Sbjct: 11367 acttcctacattataaatct 11386



to top

>emb|AL078463.11|HSJ365I19 Human DNA sequence from clone RP3-365I19 on chromosome 1 Contains part of
              the gene for a novel protein similar to formin binding
              protein 2 (FNBP2), complete sequence
          Length = 144444

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 13     gtacttggtcttttcttctt 32
              ||||||||||||||||||||
Sbjct: 135910 gtacttggtcttttcttctt 135891



to top

>emb|AL035209.1|HS7H11 Human DNA sequence from clone XX-D7H11 on chromosome 1q32.2-32.3
            Contains the 3' end of the MCP gene for membrane cofactor
            protein (CD46, trophoblast-lymphocyte cross-reactive
            antigen) and the 3' end of a novel gene, complete
            sequence
          Length = 77551

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 140  aatagtacttggcttttctt 159
            ||||||||||||||||||||
Sbjct: 3180 aatagtacttggcttttctt 3199



to top

>gb|BT009427.1| Triticum aestivum clone wlmk1.pk0030.f2:fis, full insert mRNA
            sequence
          Length = 1973

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 53   tgtcatttcattggtaaatg 72
            ||||||||||||||||||||
Sbjct: 1961 tgtcatttcattggtaaatg 1942



to top

>ref|XM_967274.1| PREDICTED: Tribolium castaneum similar to Lamin-B receptor (Integral
            nuclear envelope inner membrane protein) (LMN2R)
            (LOC661090), mRNA
          Length = 2769

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 51   tttgtcatttcattggtaaa 70
            ||||||||||||||||||||
Sbjct: 2258 tttgtcatttcattggtaaa 2239



to top

>emb|AL603707.5| Mouse DNA sequence from clone RP23-422L16 on chromosome 11 Contains the
              3' end of the Sat2 gene for spermidine/spermine N1-acetyl
              transferase 2, a ribosomal potein S15A (Rps15a) pseudogene,
              a ubiquitin-like 5 (Ubl5) pseudogene, the Fxr2h gene for
              autosomal homolog of fragile X mental retardation gene 2,
              the Sox15 gene for SRY-box containing gene 15, the Mpdu1
              gene for mannose-P-dolichol utilization defect 1, the Cd68
              gene for CD68 antigen, the Eif4a1 gene for eukaryotic
              translation initiation factor 4A1, the gene for
              sentrin/SUMO-specific protease Smt3ip1, the Tnfsf13 and
              Tnfsf12 genes for tumor necrosis factor (ligand)
              superfamily members 13 and 12, three novel genes, a
              ribosomal protein L13 (Rpl13) pseudogene, the Polr2a gene
              for polymerase (RNA) II (DNA directed) polypeptide A, the
              Amac1 gene for acyl-malonyl condensing enzyme, the gene for
              a novel BTB/POZ domain containing C2H2 type zinc finger
              protein, the Chrnb1 gene for nicotinic cholinergic receptor
              beta polypeptide 1 (muscle), the Fgf11 gene for fibroblast
              growth factor 11, a novel pseudogene, the gene for the
              ortholog of human and rat neuroligin 2 NLGN2, the gene for
              a novel protein of unknown function (DUF423) family member,
              the Plscr3 gene for phospholipid scramblase 3, the 3' end
              of the Tnk1 gene for non-receptor tyrosine kinase 1 and
              nine CpG islands, complete sequence
          Length = 234182

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 147    cttggcttttctttcttacttctt 170
              ||||||||||||||||| ||||||
Sbjct: 141731 cttggcttttctttctttcttctt 141754



to top

>emb|AL161571.2|ATCHRIV67 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 67
          Length = 200001

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    cttttcttcttatacttctt 41
             ||||||||||||||||||||
Sbjct: 28197 cttttcttcttatacttctt 28178



to top

>emb|AL078467.1|ATF27G19 Arabidopsis thaliana DNA chromosome 4, BAC clone F27G19 (ESSA project)
          Length = 82381

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    cttttcttcttatacttctt 41
             ||||||||||||||||||||
Sbjct: 41303 cttttcttcttatacttctt 41284



to top

>emb|CR855273.7| Zebrafish DNA sequence from clone DKEYP-34E1 in linkage group 24,
             complete sequence
          Length = 161081

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 173   ttgttggtttgttatttcattggt 196
             ||||||||||||| ||||||||||
Sbjct: 81572 ttgttggtttgttctttcattggt 81549



to top

>emb|CR589924.4| Human DNA sequence from clone WI2-929E21 on chromosome 1, complete
             sequence
          Length = 42303

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    gtacttggtcttttcttctt 32
             ||||||||||||||||||||
Sbjct: 38790 gtacttggtcttttcttctt 38809



to top

>gb|AC084393.20| Homo sapiens 12q BAC RP11-453E3 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 182489

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 140   aatagtacttggcttttctt 159
             ||||||||||||||||||||
Sbjct: 40604 aatagtacttggcttttctt 40623



to top

>gb|AF218854.1|AF218854 Mus musculus cytochrome P450 arachidonic acid epoxygenase (Cyp2j5) gene
             sequence
          Length = 17094

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 155   ttctttcttacttcttcctt 174
             ||||||||||||||||||||
Sbjct: 11844 ttctttcttacttcttcctt 11825



to top

>ref|XM_692521.1| PREDICTED: Danio rerio similar to Neurabin-II (Neural tissue-specific
            F-actin binding protein II) (Protein phosphatase 1
            regulatory subunit 9B) (Spinophilin) (p130) (PP1bp134)
            (LOC569155), mRNA
          Length = 1848

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 494  ctcctgctcaagggtctgct 513
            ||||||||||||||||||||
Sbjct: 1578 ctcctgctcaagggtctgct 1559



to top

>gb|AY916779.1| Homo sapiens membrane cofactor protein (CD46, trophoblast-lymphocyte
             cross-reactive antigen) (MCP) gene, complete cds
          Length = 46973

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 140   aatagtacttggcttttctt 159
             ||||||||||||||||||||
Sbjct: 37925 aatagtacttggcttttctt 37944



to top

>gb|AF335470.1|AF335470 Mus musculus myosin light chain kinase (Mylk) gene, partial cds
          Length = 180102

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 465    gcagcagggaagctagcagt 484
              ||||||||||||||||||||
Sbjct: 131764 gcagcagggaagctagcagt 131783



to top

>emb|BX322616.8| Zebrafish DNA sequence from clone DKEY-21K24 in linkage group 25,
             complete sequence
          Length = 232304

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 23    ttttcttcttatacttcttccttg 46
             |||||||||| |||||||||||||
Sbjct: 69833 ttttcttcttctacttcttccttg 69856



to top

>emb|AL109844.14|HSJ636L22 Human DNA sequence from clone RP4-636L22 on chromosome 1, complete
             sequence
          Length = 136815

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    gtacttggtcttttcttctt 32
             ||||||||||||||||||||
Sbjct: 67841 gtacttggtcttttcttctt 67822



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 486     atgttgctctcctgctcaag 505
               ||||||||||||||||||||
Sbjct: 2152090 atgttgctctcctgctcaag 2152071



to top

>gb|AC109912.10| Homo sapiens 3 BAC RP11-640G21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 86114

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 144   gtacttggcttttctttctt 163
             ||||||||||||||||||||
Sbjct: 10050 gtacttggcttttctttctt 10031



to top

>dbj|AP002913.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0480E02
          Length = 141862

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   atgttgctctcctgctcaag 505
             ||||||||||||||||||||
Sbjct: 73202 atgttgctctcctgctcaag 73183



to top

>gb|AC144755.3| Didelphis virginiana clone LB3-224H2, complete sequence
          Length = 116584

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 24    tttcttcttatacttcttcc 43
             ||||||||||||||||||||
Sbjct: 96443 tttcttcttatacttcttcc 96462



to top

>gb|AC154813.2| Mus musculus BAC clone RP24-532J13 from 16, complete sequence
          Length = 175991

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 465  gcagcagggaagctagcagt 484
            ||||||||||||||||||||
Sbjct: 4396 gcagcagggaagctagcagt 4377



to top

>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 25      ttcttcttatacttcttcct 44
               ||||||||||||||||||||
Sbjct: 1472362 ttcttcttatacttcttcct 1472343



to top

>emb|AL807387.10| Mouse DNA sequence from clone RP23-24J10 on chromosome 4, complete
              sequence
          Length = 241148

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 153    ttttctttcttacttcttcc 172
              ||||||||||||||||||||
Sbjct: 205600 ttttctttcttacttcttcc 205581



to top

>gb|AC156500.2| Mus musculus BAC clone RP24-126J12 from chromosome 9, complete sequence
          Length = 152842

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 394    cttctccagctctatcacct 413
              ||||||||||||||||||||
Sbjct: 103824 cttctccagctctatcacct 103843



to top

>gb|DP000023.1| Didelphis virginiana target 1 genomic scaffold
          Length = 1751794

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 24      tttcttcttatacttcttcc 43
               ||||||||||||||||||||
Sbjct: 1575308 tttcttcttatacttcttcc 1575327



to top

>emb|AL683816.6| Mouse DNA sequence from clone RP23-120E8 on chromosome 4, complete
              sequence
          Length = 216639

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 155    ttctttcttacttcttcctt 174
              ||||||||||||||||||||
Sbjct: 123497 ttctttcttacttcttcctt 123516


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,550,603
Number of Sequences: 3902068
Number of extensions: 6550603
Number of successful extensions: 133611
Number of sequences better than 10.0: 56
Number of HSP's better than 10.0 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 133351
Number of HSP's gapped (non-prelim): 260
length of query: 625
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 602
effective length of database: 17,143,297,704
effective search space: 10320265217808
effective search space used: 10320265217808
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top