ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags11j11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT008914.1| Triticum aestivum clone wpa1c.pk002.f9:fis, full insert mRNA sequence Length = 1493 Score = 749 bits (378), Expect = 0.0 Identities = 521/568 (91%), Gaps = 1/568 (0%) Strand = Plus / Minus Query: 1 gtaagaaccctaacatggaaaacttgagaaggacagaaacgaattcatctgctcactgac 60 ||||||||| |||||||||||||||||||| ||||||||||||||||||||| |||||| Sbjct: 1429 gtaagaaccataacatggaaaacttgagaacaacagaaacgaattcatctgctgactgac 1370 Query: 61 gatcacaacatcctgcctgactactgctgggcgcactgcaccctctgcccgccgccgccc 120 ||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||| || Sbjct: 1369 gatcacaacatcctgcctgcctactgctgggcgcactgcacccgctggccgccgccaccg 1310 Query: 121 ggcatatcctcgtcctcgtcataggcctcctgcgcctgctgctgctgttgcctccgcatc 180 ||||| |||||||||||||| ||||||||||| ||||||||||||||| ||||||||||| Sbjct: 1309 ggcatgtcctcgtcctcgtcgtaggcctcctgtgcctgctgctgctgtcgcctccgcatc 1250 Query: 181 tcttcctcaatgtctatatcgtaggccatcgtctcctcgcactcgtctagctccatgtct 240 || ||||| ||||| || ||||||||||||||||||||||||||||| ||||||||||| Sbjct: 1249 tcctcctcgatgtcaatgtcgtaggccatcgtctcctcgcactcgtccagctccatgtcc 1190 Query: 241 gtgtactgcgatgccggcttgggcgggaggaccgtctcgagggccttgcactggtccaag 300 ||||||||||| |||||||||||||| ||||| |||||||| |||||||||||||||| | Sbjct: 1189 gtgtactgcgacgccggcttgggcggcaggacagtctcgagcgccttgcactggtccagg 1130 Query: 301 ctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggc 360 |||||||||||||| ||| | ||||||||||||||||| ||||||||||||||||| ||| Sbjct: 1129 ctcagcgagtcgggaaaatcaaccgtgaagtggatgtacagcttgcccttcatgaacggc 1070 Query: 361 ctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaact 420 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| Sbjct: 1069 ctctggtacatgggcatgccctcgtcgttgatcgccttgaacgaatcaggcttgacgact 1010 Query: 421 tccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattgg 480 || || ||||||||||||||||||||||| ||||| ||||||||||| |||||||| ||| Sbjct: 1009 tcgccagggttggacttgatgagcagctgcctgccgtccaaatgagccaggacatactgg 950 Query: 481 aagccacagagggcctccgtcagggtcagggtgtgctcatagaagangtcgtcagccttn 540 |||||||| || ||||| |||||||||||||||||||| ||||||| ||| || |||| Sbjct: 949 aagccacacagtgcctcggtcagggtcagggtgtgctcgtagaagaggtcatcgcccttc 890 Query: 541 cgcttgaatttgggggtgctccttctgc 568 ||||||||||| |||||||||||||||| Sbjct: 889 cgcttgaattt-ggggtgctccttctgc 863
>gb|AY103727.1| Zea mays PCO082317 mRNA sequence Length = 1504 Score = 361 bits (182), Expect = 2e-96 Identities = 413/488 (84%), Gaps = 7/488 (1%) Strand = Plus / Minus Query: 81 ctactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtc 140 |||||||||||||||||||||||||||| ||||||| |||||| ||||| |||||||| Sbjct: 1319 ctactgctgggcgcactgcaccctctgcgcgccgcc---cggcatgtcctcatcctcgtc 1263 Query: 141 ataggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatc 200 ||||||||||| ||||||||||| ||||||||||||| | || |||| | || Sbjct: 1262 gtaggcctcctgg---tgctgctgctgccgcctccgcatctccgcttcgatgttcacgtc 1206 Query: 201 gtaggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggctt 260 |||| ||||||||||||||||||||| ||||||||||| ||||||||||| ||||||| Sbjct: 1205 atagggcatcgtctcctcgcactcgtccagctccatgtcggtgtactgcgacaccggctt 1146 Query: 261 gggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaac 320 ||||||||| || | ||| |||||||||||||| ||| |||||||||||| ||||| | Sbjct: 1145 gggcgggagcacagcctccagggccttgcactgctccgggctcagcgagtccgggaactc 1086 Query: 321 caccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgcc 380 ||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| Sbjct: 1085 caccgagaagtggatgtacagcttgcccttcatgaacggcctctggtacatgggcatgcc 1026 Query: 381 ctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgat 440 |||||||||||||||||||| ||||||||||| |||||||| || || || || ||||| Sbjct: 1025 ttcgtcgttgatcgccttgaaagaatcaggcttcacaacttcgcccggatttgatttgat 966 Query: 441 gagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccgt 500 |||||||| ||| |||||| |||| | ||| | ||||||||||| || | || || Sbjct: 965 cagcagctgcctgttatccaagtgagtcacaacaaactggaagccacacagagattcagt 906 Query: 501 cagggtcagggtgtgctcatagaagangtcgtcagccttncgcttgaatttgggggtgct 560 || ||||||||||||||| ||||||| ||| || |||| | |||||| || ||| |||| Sbjct: 905 caaggtcagggtgtgctcgtagaagaggtcatcgccctttctcttgaactt-gggatgct 847 Query: 561 ccttctgc 568 |||||||| Sbjct: 846 ccttctgc 839
>dbj|AK104315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-E04, full insert sequence Length = 1532 Score = 359 bits (181), Expect = 6e-96 Identities = 411/487 (84%), Gaps = 1/487 (0%) Strand = Plus / Minus Query: 82 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 141 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 1342 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 1283 Query: 142 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 201 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 1282 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 1223 Query: 202 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 261 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 1222 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 1163 Query: 262 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 321 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 1162 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 1103 Query: 322 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 381 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 1102 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 1043 Query: 382 tcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgatg 441 |||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 1042 tcgtcgttgacagccttgaatgaatcaggcttgacaacttcaccgggcttggacttgata 983 Query: 442 agcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccgtc 501 |||||||| ||| ||||| |||| || ||| | ||||||||||| |||||||| || Sbjct: 982 agcagctgcctgttgtccaagtgagtgagaacaaactggaagccacaaagggcctcagtg 923 Query: 502 agggtcagggtgtgctcatagaagangtcgtcagccttncgcttgaatttgggggtgctc 561 ||| ||||||||||||| ||||||| ||| || |||| | |||||| || ||| ||||| Sbjct: 922 aggttcagggtgtgctcgtagaagaggtcatctccctttctcttgaactt-gggatgctc 864 Query: 562 cttctgc 568 ||||||| Sbjct: 863 cttctgc 857
>dbj|AK061049.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-G01, full insert sequence Length = 1558 Score = 359 bits (181), Expect = 6e-96 Identities = 411/487 (84%), Gaps = 1/487 (0%) Strand = Plus / Minus Query: 82 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 141 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 1349 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 1290 Query: 142 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 201 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 1289 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 1230 Query: 202 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 261 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 1229 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 1170 Query: 262 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 321 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 1169 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 1110 Query: 322 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 381 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 1109 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 1050 Query: 382 tcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgatg 441 |||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 1049 tcgtcgttgacagccttgaatgaatcaggcttgacaacttcaccgggcttggacttgata 990 Query: 442 agcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccgtc 501 |||||||| ||| ||||| |||| || ||| | ||||||||||| |||||||| || Sbjct: 989 agcagctgcctgttgtccaagtgagtgagaacaaactggaagccacaaagggcctcagtg 930 Query: 502 agggtcagggtgtgctcatagaagangtcgtcagccttncgcttgaatttgggggtgctc 561 ||| ||||||||||||| ||||||| ||| || |||| | |||||| || ||| ||||| Sbjct: 929 aggttcagggtgtgctcgtagaagaggtcatctccctttctcttgaactt-gggatgctc 871 Query: 562 cttctgc 568 ||||||| Sbjct: 870 cttctgc 864
>gb|BT017684.1| Zea mays clone EL01N0443H09.c mRNA sequence Length = 1401 Score = 281 bits (142), Expect = 1e-72 Identities = 403/488 (82%), Gaps = 7/488 (1%) Strand = Plus / Minus Query: 81 ctactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtc 140 |||||||||||||||||||||||||||||| ||||| |||| ||| || |||||||| Sbjct: 1160 ctactgctgggcgcactgcaccctctgcccaccgcct---ggcacatcatcatcctcgtc 1104 Query: 141 ataggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatc 200 ||||||||||| || |||||||| ||||||||||||| || || |||| | || Sbjct: 1103 gtaggcctcctgg---tggtgctgctgccgcctccgcatctcctcttcgatgttcacgtc 1047 Query: 201 gtaggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggctt 260 ||| | ||| ||||||||||||||||||||||||||||| |||||||| ||| | ||||| Sbjct: 1046 gtacgtcattgtctcctcgcactcgtctagctccatgtcagtgtactgtgatactggctt 987 Query: 261 gggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaac 320 ||||||||| || ||| |||||||||||||| ||| ||||| |||||| ||||| | Sbjct: 986 gggcgggagaacaacctccagggccttgcactgctccgggctcaacgagtccgggaactc 927 Query: 321 caccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgcc 380 ||||| ||||| ||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 926 caccgaaaagtgaatgtacagcttgcccttcatgaagggcctctgatacatgggcatgcc 867 Query: 381 ctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgat 440 || |||||||| |||||||| ||||||||||| |||||||| || ||||| || ||||| Sbjct: 866 ttcatcgttgattgccttgaaagaatcaggcttcacaacttcaccagggttcgatttgat 807 Query: 441 gagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccgt 500 |||||||| ||| |||||| |||| || ||| | |||| ||||| || | || || Sbjct: 806 cagcagctgcctgttatccaagtgagtcagaacaaactggagcccacacagagattcagt 747 Query: 501 cagggtcagggtgtgctcatagaagangtcgtcagccttncgcttgaatttgggggtgct 560 || |||||| |||||||| ||||||| ||| || |||| | |||||| || ||| |||| Sbjct: 746 caaggtcagtgtgtgctcgtagaagaggtcatcgccctttctcttgaactt-gggatgct 688 Query: 561 ccttctgc 568 |||||||| Sbjct: 687 ccttctgc 680
>gb|AC084296.12| Oryza sativa chromosome 3 BAC OSJNBb0024J04 genomic sequence, complete sequence Length = 145507 Score = 258 bits (130), Expect = 2e-65 Identities = 277/326 (84%) Strand = Plus / Minus Query: 82 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 141 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 59321 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 59262 Query: 142 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 201 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 59261 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 59202 Query: 202 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 261 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 59201 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 59142 Query: 262 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 321 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 59141 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 59082 Query: 322 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 381 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 59081 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 59022 Query: 382 tcgtcgttgatcgccttgaatgaatc 407 |||||||||| |||||||||||||| Sbjct: 59021 tcgtcgttgacagccttgaatgaatc 58996 Score = 103 bits (52), Expect = 6e-19 Identities = 135/162 (83%), Gaps = 1/162 (0%) Strand = Plus / Minus Query: 407 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 466 |||||||||||||||| ||||| ||||||||||| |||||||| ||| ||||| |||| Sbjct: 58867 caggcttgacaacttcaccgggcttggacttgataagcagctgcctgttgtccaagtgag 58808 Query: 467 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 526 || ||| | ||||||||||| |||||||| || ||| ||||||||||||| ||||||| Sbjct: 58807 tgagaacaaactggaagccacaaagggcctcagtgaggttcagggtgtgctcgtagaaga 58748 Query: 527 ngtcgtcagccttncgcttgaatttgggggtgctccttctgc 568 ||| || |||| | |||||| || ||| |||||||||||| Sbjct: 58747 ggtcatctccctttctcttgaactt-gggatgctccttctgc 58707 Score = 54.0 bits (27), Expect = 5e-04 Identities = 61/72 (84%), Gaps = 4/72 (5%) Strand = Plus / Plus Query: 340 agcttgcccttcatgaagggcctctggtacatgggcatgccc----tcgtcgttgatcgc 395 ||||| ||||||||||| |||| ||||||||| |||| |||| |||||||||| || Sbjct: 81589 agcttccccttcatgaatggccgctggtacatcggcacgccctcgatcgtcgttgacagc 81648 Query: 396 cttgaatgaatc 407 |||||||||||| Sbjct: 81649 cttgaatgaatc 81660
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 258 bits (130), Expect = 2e-65 Identities = 277/326 (84%) Strand = Plus / Minus Query: 82 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 141 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 32407193 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 32407134 Query: 142 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 201 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 32407133 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 32407074 Query: 202 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 261 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 32407073 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 32407014 Query: 262 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 321 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 32407013 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 32406954 Query: 322 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 381 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 32406953 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 32406894 Query: 382 tcgtcgttgatcgccttgaatgaatc 407 |||||||||| |||||||||||||| Sbjct: 32406893 tcgtcgttgacagccttgaatgaatc 32406868 Score = 103 bits (52), Expect = 6e-19 Identities = 135/162 (83%), Gaps = 1/162 (0%) Strand = Plus / Minus Query: 407 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 466 |||||||||||||||| ||||| ||||||||||| |||||||| ||| ||||| |||| Sbjct: 32406739 caggcttgacaacttcaccgggcttggacttgataagcagctgcctgttgtccaagtgag 32406680 Query: 467 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 526 || ||| | ||||||||||| |||||||| || ||| ||||||||||||| ||||||| Sbjct: 32406679 tgagaacaaactggaagccacaaagggcctcagtgaggttcagggtgtgctcgtagaaga 32406620 Query: 527 ngtcgtcagccttncgcttgaatttgggggtgctccttctgc 568 ||| || |||| | |||||| || ||| |||||||||||| Sbjct: 32406619 ggtcatctccctttctcttgaactt-gggatgctccttctgc 32406579 Score = 93.7 bits (47), Expect = 6e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 320 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 379 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 24843932 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 24843873 Query: 380 cctcgtcgttgatcgccttgaat 402 |||| ||||| || ||||||||| Sbjct: 24843872 cctcatcgtttattgccttgaat 24843850 Score = 63.9 bits (32), Expect = 5e-07 Identities = 98/120 (81%) Strand = Plus / Minus Query: 407 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 466 ||||||| |||||||| |||||||| ||||| ||||||||||||||| |||| ||| | Sbjct: 24843762 caggcttaacaacttcaccggggtttgacttaatgagcagctgtctgttgtccagatgtg 24843703 Query: 467 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 526 |||||| ||||||| ||||| || || || ||||| | | |||||||||||| |||| Sbjct: 24843702 tcaggacaaattggaaaccacaaagtgcttcagtcagagataaggtgtgctcataaaaga 24843643 Score = 54.0 bits (27), Expect = 5e-04 Identities = 61/72 (84%), Gaps = 4/72 (5%) Strand = Plus / Plus Query: 340 agcttgcccttcatgaagggcctctggtacatgggcatgccc----tcgtcgttgatcgc 395 ||||| ||||||||||| |||| ||||||||| |||| |||| |||||||||| || Sbjct: 32429461 agcttccccttcatgaatggccgctggtacatcggcacgccctcgatcgtcgttgacagc 32429520 Query: 396 cttgaatgaatc 407 |||||||||||| Sbjct: 32429521 cttgaatgaatc 32429532
>emb|AJ457802.1|OSA457802 Oryza sativa (japonica cultivar-group) partial mRNA for putative DnaJ protein (dnaJ gene) Length = 552 Score = 258 bits (130), Expect = 2e-65 Identities = 277/326 (84%) Strand = Plus / Minus Query: 82 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 141 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 326 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 267 Query: 142 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 201 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 266 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 207 Query: 202 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 261 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 206 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 147 Query: 262 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 321 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 146 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 87 Query: 322 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 381 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 86 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 27 Query: 382 tcgtcgttgatcgccttgaatgaatc 407 |||||||||| |||||||||||||| Sbjct: 26 tcgtcgttgacagccttgaatgaatc 1
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 258 bits (130), Expect = 2e-65 Identities = 277/326 (84%) Strand = Plus / Minus Query: 82 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 141 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 32497703 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 32497644 Query: 142 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 201 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 32497643 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 32497584 Query: 202 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 261 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 32497583 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 32497524 Query: 262 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 321 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 32497523 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 32497464 Query: 322 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 381 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 32497463 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 32497404 Query: 382 tcgtcgttgatcgccttgaatgaatc 407 |||||||||| |||||||||||||| Sbjct: 32497403 tcgtcgttgacagccttgaatgaatc 32497378 Score = 103 bits (52), Expect = 6e-19 Identities = 135/162 (83%), Gaps = 1/162 (0%) Strand = Plus / Minus Query: 407 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 466 |||||||||||||||| ||||| ||||||||||| |||||||| ||| ||||| |||| Sbjct: 32497249 caggcttgacaacttcaccgggcttggacttgataagcagctgcctgttgtccaagtgag 32497190 Query: 467 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 526 || ||| | ||||||||||| |||||||| || ||| ||||||||||||| ||||||| Sbjct: 32497189 tgagaacaaactggaagccacaaagggcctcagtgaggttcagggtgtgctcgtagaaga 32497130 Query: 527 ngtcgtcagccttncgcttgaatttgggggtgctccttctgc 568 ||| || |||| | |||||| || ||| |||||||||||| Sbjct: 32497129 ggtcatctccctttctcttgaactt-gggatgctccttctgc 32497089 Score = 93.7 bits (47), Expect = 6e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 320 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 379 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 24935255 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 24935196 Query: 380 cctcgtcgttgatcgccttgaat 402 |||| ||||| || ||||||||| Sbjct: 24935195 cctcatcgtttattgccttgaat 24935173 Score = 63.9 bits (32), Expect = 5e-07 Identities = 98/120 (81%) Strand = Plus / Minus Query: 407 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 466 ||||||| |||||||| |||||||| ||||| ||||||||||||||| |||| ||| | Sbjct: 24935085 caggcttaacaacttcaccggggtttgacttaatgagcagctgtctgttgtccagatgtg 24935026 Query: 467 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 526 |||||| ||||||| ||||| || || || ||||| | | |||||||||||| |||| Sbjct: 24935025 tcaggacaaattggaaaccacaaagtgcttcagtcagagataaggtgtgctcataaaaga 24934966 Score = 54.0 bits (27), Expect = 5e-04 Identities = 61/72 (84%), Gaps = 4/72 (5%) Strand = Plus / Plus Query: 340 agcttgcccttcatgaagggcctctggtacatgggcatgccc----tcgtcgttgatcgc 395 ||||| ||||||||||| |||| ||||||||| |||| |||| |||||||||| || Sbjct: 32519971 agcttccccttcatgaatggccgctggtacatcggcacgccctcgatcgtcgttgacagc 32520030 Query: 396 cttgaatgaatc 407 |||||||||||| Sbjct: 32520031 cttgaatgaatc 32520042
>gb|BT024164.1| Zea mays clone EL01N0426F11 mRNA sequence Length = 1761 Score = 143 bits (72), Expect = 7e-31 Identities = 186/224 (83%) Strand = Plus / Minus Query: 303 cagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcct 362 ||||||||||||||| |||||||||| || ||||||||||| ||||||||||||||||| Sbjct: 1174 cagcgagtcggggaactccaccgtgaaatgaatgtagagcttccccttcatgaagggcct 1115 Query: 363 ctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttc 422 |||||| || ||||| ||||||||||| || ||||||||| ||||| || |||||||| Sbjct: 1114 ctggtaaatcggcatcccctcgtcgtttattgccttgaattggtcaggtttaacaacttc 1055 Query: 423 cccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattggaa 482 |||||||| || ||||| || ||||| ||| |||| ||| | || ||| ||||||| Sbjct: 1054 gccggggtttgatttgatcagaagctgcctgttgtccagatgtgtaagaacaaattggaa 995 Query: 483 gccacagagggcctccgtcagggtcagggtgtgctcatagaaga 526 ||||| || || || ||||| | ||||||||||||||| |||| Sbjct: 994 cccacatagagcttcggtcagagacagggtgtgctcataaaaga 951
>gb|AY224432.1| Oryza sativa (japonica cultivar-group) isolate 20618 DNAJ-like protein mRNA, complete cds Length = 1254 Score = 141 bits (71), Expect = 3e-30 Identities = 173/207 (83%) Strand = Plus / Minus Query: 320 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 379 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 1018 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 959 Query: 380 cctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttga 439 |||| ||||| || ||||||||| |||||||| |||||||| |||||||| ||||| | Sbjct: 958 cctcatcgtttattgccttgaattggtcaggcttaacaacttcaccggggtttgacttaa 899 Query: 440 tgagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccg 499 |||||||||||||| |||| ||| | |||||| ||||||| ||||| || || || | Sbjct: 898 tgagcagctgtctgttgtccagatgtgtcaggacaaattggaaaccacaaagtgcttcag 839 Query: 500 tcagggtcagggtgtgctcatagaaga 526 |||| | | |||||||||||| |||| Sbjct: 838 tcagagataaggtgtgctcataaaaga 812
>dbj|AK105028.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-012-E01, full insert sequence Length = 1667 Score = 141 bits (71), Expect = 3e-30 Identities = 173/207 (83%) Strand = Plus / Minus Query: 320 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 379 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 1145 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 1086 Query: 380 cctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttga 439 |||| ||||| || ||||||||| |||||||| |||||||| |||||||| ||||| | Sbjct: 1085 cctcatcgtttattgccttgaattggtcaggcttaacaacttcaccggggtttgacttaa 1026 Query: 440 tgagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccg 499 |||||||||||||| |||| ||| | |||||| ||||||| ||||| || || || | Sbjct: 1025 tgagcagctgtctgttgtccagatgtgtcaggacaaattggaaaccacaaagtgcttcag 966 Query: 500 tcagggtcagggtgtgctcatagaaga 526 |||| | | |||||||||||| |||| Sbjct: 965 tcagagataaggtgtgctcataaaaga 939
>dbj|AK070556.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023062J10, full insert sequence Length = 2409 Score = 141 bits (71), Expect = 3e-30 Identities = 173/207 (83%) Strand = Plus / Minus Query: 320 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 379 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 1840 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 1781 Query: 380 cctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttga 439 |||| ||||| || ||||||||| |||||||| |||||||| |||||||| ||||| | Sbjct: 1780 cctcatcgtttattgccttgaattggtcaggcttaacaacttcaccggggtttgacttaa 1721 Query: 440 tgagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccg 499 |||||||||||||| |||| ||| | |||||| ||||||| ||||| || || || | Sbjct: 1720 tgagcagctgtctgttgtccagatgtgtcaggacaaattggaaaccacaaagtgcttcag 1661 Query: 500 tcagggtcagggtgtgctcatagaaga 526 |||| | | |||||||||||| |||| Sbjct: 1660 tcagagataaggtgtgctcataaaaga 1634
>gb|AY104862.1| Zea mays PCO104800 mRNA sequence Length = 1031 Score = 135 bits (68), Expect = 2e-28 Identities = 254/316 (80%) Strand = Plus / Minus Query: 211 gtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttgggcgggagg 270 ||||||||||| || |||| |||||||||||| || || | ||||| ||||| || Sbjct: 522 gtctcctcgcattcatctatctccatgtctgtcagcttggacgaaggctttggcggaagt 463 Query: 271 accgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaaccaccgtgaag 330 |||| |||||| ||||||||||| || ||||||||||||||| |||||||||| Sbjct: 462 accgactcgagagccttgcactgctctggtgccagcgagtcggggaactccaccgtgaaa 403 Query: 331 tggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccctcgtcgttg 390 || ||||||||||| ||||||||||||||||||||||| || ||||| |||||||| || Sbjct: 402 tgaatgtagagcttccccttcatgaagggcctctggtaaataggcatcccctcgtcattt 343 Query: 391 atcgccttgaatgaatcaggcttgacaacttccccggggttggacttgatgagcagctgt 450 |||||||||||| ||||| || |||||||| |||||||| || ||||| || ||||| Sbjct: 342 atcgccttgaattggtcaggtttaacaacttcgccggggtttgatttgatcagaagctgc 283 Query: 451 ctgccatccaaatgagctaggacatattggaagccacagagggcctccgtcagggtcagg 510 ||| |||| || | || ||| ||||||| ||||| || || || ||||| | |||| Sbjct: 282 ctgttgtccaggtgtgtaagaacaaattggaacccacatagagcttcggtcagagacagg 223 Query: 511 gtgtgctcatagaaga 526 ||||||||||| |||| Sbjct: 222 gtgtgctcataaaaga 207
>dbj|AK102263.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033088M01, full insert sequence Length = 1819 Score = 133 bits (67), Expect = 7e-28 Identities = 172/207 (83%) Strand = Plus / Minus Query: 320 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 379 |||||| ||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 1180 ccaccgcgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 1121 Query: 380 cctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttga 439 |||| ||||| || ||||||||| |||||||| |||||||| |||||||| ||||| | Sbjct: 1120 cctcatcgtttattgccttgaattggtcaggcttaacaacttcaccggggtttgacttaa 1061 Query: 440 tgagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccg 499 |||||||||||||| |||| ||| | |||||| ||||||| ||||| || || || | Sbjct: 1060 tgagcagctgtctgttgtccagatgtgtcaggacaaattggaaaccacaaagtgcttcag 1001 Query: 500 tcagggtcagggtgtgctcatagaaga 526 |||| | | |||||||||||| |||| Sbjct: 1000 tcagagataaggtgtgctcataaaaga 974
>gb|AF169022.1|AF169022 Glycine max seed maturation protein PM37 (PM37) mRNA, complete cds Length = 1533 Score = 117 bits (59), Expect = 4e-23 Identities = 164/199 (82%) Strand = Plus / Minus Query: 320 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 379 |||| |||||||| ||||| || || ||||||||||| |||||||| ||||||||||| | Sbjct: 1116 ccacagtgaagtgaatgtaaagtttccccttcatgaatggcctctgatacatgggcattc 1057 Query: 380 cctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttga 439 |||| || || || |||||| ||||||||||||| |||||||||||||| || || || | Sbjct: 1056 cctcatcatttatagccttgtatgaatcaggcttcacaacttccccgggatttgatttaa 997 Query: 440 tgagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccg 499 | || ||||| | || |||||| |||| || ||| ||||||||||||| | |||||| | Sbjct: 996 taagaagctgacggctatccaagtgagtcagcacaaattggaagccacacaaggcctcgg 937 Query: 500 tcagggtcagggtgtgctc 518 | |||| || |||||||| Sbjct: 936 taagggacaaagtgtgctc 918 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 82 tactgctgggcgcactgcaccctctg 107 ||||||||||||||||| |||||||| Sbjct: 1348 tactgctgggcgcactgtaccctctg 1323
>emb|X67695.1|CSCSDJ C.sativus mRNA for cs DnaJ-1 Length = 1688 Score = 113 bits (57), Expect = 6e-22 Identities = 120/141 (85%) Strand = Plus / Minus Query: 326 tgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccctcgt 385 ||||||||||||| || |||||||||||||| |||||||||||||| ||||| ||||| | Sbjct: 1104 tgaagtggatgtaaagtttgcccttcatgaatggcctctggtacataggcataccctcat 1045 Query: 386 cgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgatgagca 445 |||| || ||||||||| |||||||| || ||||| ||||| || |||||||| | Sbjct: 1044 cgtttatggccttgaattggtcaggcttcactacttcaccgggaagtgatttgatgagta 985 Query: 446 gctgtctgccatccaaatgag 466 |||||| |||||||||||||| Sbjct: 984 gctgtcggccatccaaatgag 964
>gb|AY109456.1| Zea mays CL1808_1 mRNA sequence Length = 2488 Score = 113 bits (57), Expect = 6e-22 Identities = 202/251 (80%) Strand = Plus / Minus Query: 303 cagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcct 362 ||||||||| ||||| |||||||||| |||||||| ||||| ||||||||||| ||||| Sbjct: 1850 cagcgagtcagggaactccaccgtgaaatggatgtacagcttccccttcatgaaaggcct 1791 Query: 363 ctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttc 422 |||||| || ||||| ||||| || || |||||||||||| ||||| || |||||||| Sbjct: 1790 ctggtaaattggcatcccctcatcattaatcgccttgaattggtcaggtttaacaacttc 1731 Query: 423 cccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattggaa 482 || |||| || |||||||| ||||| ||| |||| ||| | || ||| ||||||| Sbjct: 1730 accagggtctgatttgatgagaagctgcctgttgtccagatgtgtaagaacaaattggaa 1671 Query: 483 gccacagagggcctccgtcagggtcagggtgtgctcatagaagangtcgtcagccttncg 542 ||||| || || || ||||| | || ||||||||||||||||| || ||| |||| | Sbjct: 1670 cccacatagtgcttcggtcagagacaaggtgtgctcatagaagagatcttcaccctttct 1611 Query: 543 cttgaatttgg 553 |||||||||| Sbjct: 1610 tttgaatttgg 1600
>gb|BT016912.1| Zea mays clone Contig745 mRNA sequence Length = 982 Score = 107 bits (54), Expect = 4e-20 Identities = 199/248 (80%) Strand = Plus / Plus Query: 306 cgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctg 365 |||||| ||||| |||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 614 cgagtcagggaactccaccgtgaaatggatgtacagcttccccttcatgaaaggcctctg 673 Query: 366 gtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttcccc 425 ||| || ||||| ||||| || || |||||||||||| ||||| || |||||||| || Sbjct: 674 gtaaattggcatcccctcatcattaatcgccttgaattggtcaggtttaacaacttcacc 733 Query: 426 ggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattggaagcc 485 |||| || |||||||| ||||| ||| |||| ||| | || ||| ||||||| || Sbjct: 734 agggtctgatttgatgagaagctgcctgttgtccagatgtgtaagaacaaattggaaccc 793 Query: 486 acagagggcctccgtcagggtcagggtgtgctcatagaagangtcgtcagccttncgctt 545 ||| || || || ||||| | || ||||||||||||||||| || ||| |||| | || Sbjct: 794 acatagtgcttcggtcagagacaaggtgtgctcatagaagagatcttcaccctttctttt 853 Query: 546 gaatttgg 553 |||||||| Sbjct: 854 gaatttgg 861
>ref|NM_122127.2| Arabidopsis thaliana ATJ2 AT5G22060 (ATJ2) mRNA, complete cds Length = 1565 Score = 105 bits (53), Expect = 2e-19 Identities = 128/153 (83%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 1173 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 1114 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 ||| ||||| || ||||| ||||| || | ||||||||| |||||||||| ||||| || Sbjct: 1113 cctttggtatattggcattccctcatcacttatcgccttgtatgaatcaggtttgacgac 1054 Query: 420 ttccccggggttggacttgatgagcagctgtct 452 || ||||| ||||| |||||||| |||||||| Sbjct: 1053 ctctccgggcttggatttgatgagaagctgtct 1021
>ref|NM_114279.2| Arabidopsis thaliana ATJ3 AT3G44110 (ATJ3) transcript variant AT3G44110.1 mRNA, complete cds Length = 1746 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1203 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 1144 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 1143 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 1084 Query: 420 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 479 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 1083 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 1024 Query: 480 gaagccaca 488 ||||||||| Sbjct: 1023 gaagccaca 1015
>gb|BT017212.1| Zea mays clone EL01N0372B09.c mRNA sequence Length = 891 Score = 105 bits (53), Expect = 2e-19 Identities = 90/101 (89%), Gaps = 1/101 (0%) Strand = Plus / Minus Query: 303 cagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcct 362 ||||||||||||||| |||||||||| || ||||||||||| ||||||||||||||||| Sbjct: 390 cagcgagtcggggaactccaccgtgaaatgaatgtagagcttccccttcatgaagggcct 331 Query: 363 ctggtacatgggc-atgccctcgtcgttgatcgccttgaat 402 |||||| || ||| || ||||||||||| || ||||||||| Sbjct: 330 ctggtaaatcggcaatcccctcgtcgtttattgccttgaat 290
>gb|AY113878.1| Arabidopsis thaliana putative DnaJ-like protein atj3 (At3g44110) mRNA, complete cds Length = 1294 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1041 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 982 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 981 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 922 Query: 420 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 479 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 921 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 862 Query: 480 gaagccaca 488 ||||||||| Sbjct: 861 gaagccaca 853
>gb|AY035087.1| Arabidopsis thaliana putative dnaJ protein homolog atj3 (At3g44110) mRNA, complete cds Length = 1653 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1157 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 1098 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 1097 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 1038 Query: 420 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 479 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 1037 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 978 Query: 480 gaagccaca 488 ||||||||| Sbjct: 977 gaagccaca 969
>gb|AY045655.1| Arabidopsis thaliana AT3g44110/F26G5_60 mRNA, complete cds Length = 1692 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1174 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 1115 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 1114 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 1055 Query: 420 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 479 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 1054 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 995 Query: 480 gaagccaca 488 ||||||||| Sbjct: 994 gaagccaca 986
>emb|BX831588.1|CNS0A0V0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH17ZB05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1489 Score = 105 bits (53), Expect = 2e-19 Identities = 128/153 (83%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 1137 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 1078 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 ||| ||||| || ||||| ||||| || | ||||||||| |||||||||| ||||| || Sbjct: 1077 cctttggtatattggcattccctcatcacttatcgccttgtatgaatcaggtttgacgac 1018 Query: 420 ttccccggggttggacttgatgagcagctgtct 452 || ||||| ||||| |||||||| |||||||| Sbjct: 1017 ctctccgggcttggatttgatgagaagctgtct 985
>emb|BX830687.1|CNS0A0QX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS14ZE01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1491 Score = 105 bits (53), Expect = 2e-19 Identities = 128/153 (83%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 1133 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 1074 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 ||| ||||| || ||||| ||||| || | ||||||||| |||||||||| ||||| || Sbjct: 1073 cctttggtatattggcattccctcatcacttatcgccttgtatgaatcaggtttgacgac 1014 Query: 420 ttccccggggttggacttgatgagcagctgtct 452 || ||||| ||||| |||||||| |||||||| Sbjct: 1013 ctctccgggcttggatttgatgagaagctgtct 981
>dbj|AK118386.1| Arabidopsis thaliana At5g22060 mRNA for putative DNAJ PROTEIN HOMOLOG ATJ, complete cds, clone: RAFL19-64-P10 Length = 1451 Score = 105 bits (53), Expect = 2e-19 Identities = 128/153 (83%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 1119 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 1060 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 ||| ||||| || ||||| ||||| || | ||||||||| |||||||||| ||||| || Sbjct: 1059 cctttggtatattggcattccctcatcacttatcgccttgtatgaatcaggtttgacgac 1000 Query: 420 ttccccggggttggacttgatgagcagctgtct 452 || ||||| ||||| |||||||| |||||||| Sbjct: 999 ctctccgggcttggatttgatgagaagctgtct 967
>gb|U22340.1|ATU22340 Arabidopsis thaliana DnaJ homolog (atj) mRNA, complete cds Length = 1642 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1140 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 1081 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 1080 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 1021 Query: 420 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 479 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 1020 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 961 Query: 480 gaagccaca 488 ||||||||| Sbjct: 960 gaagccaca 952
>gb|U64912.1|ATU64912 Arabidopsis thaliana farnesylated protein ATFP9 mRNA, partial cds Length = 270 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 258 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 199 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 198 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 139 Query: 420 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 479 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 138 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 79 Query: 480 gaagccaca 488 ||||||||| Sbjct: 78 gaagccaca 70
>gb|AF124139.1|AF124139 Lycopersicon esculentum DnaJ-like protein mRNA, complete cds Length = 1566 Score = 103 bits (52), Expect = 6e-19 Identities = 121/144 (84%) Strand = Plus / Minus Query: 310 tcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtac 369 ||||||||| | || |||||||| ||||| | |||||||||||||| ||||| |||||| Sbjct: 1111 tcggggaaatcaacagtgaagtgaatgtacattttgcccttcatgaacggcctttggtac 1052 Query: 370 atgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccgggg 429 || ||||| || || |||||||| ||||| || |||||||||||||||||| || || Sbjct: 1051 atcggcattccttcatcgttgatagccttaaactgatcaggcttgacaacttcgccaggt 992 Query: 430 ttggacttgatgagcagctgtctg 453 | |||||| ||||||||||||||| Sbjct: 991 tgggacttaatgagcagctgtctg 968
>gb|AC124955.34| Medicago truncatula clone mth2-12l24, complete sequence Length = 115804 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 309 gtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggta 368 ||||||||| |||| |||||||| ||||| |||||||||||||| || ||||||||||| Sbjct: 64040 gtcggggaattccacggtgaagtgaatgtaaagcttgcccttcataaatggcctctggta 63981 Query: 369 catgggcatgccctcgtcgttgatcgccttgaatgaatc 407 ||| ||||| ||||||||||| || |||||| ||||||| Sbjct: 63980 catcggcattccctcgtcgttaatagccttgtatgaatc 63942 Score = 44.1 bits (22), Expect = 0.49 Identities = 31/34 (91%) Strand = Plus / Minus Query: 407 caggcttgacaacttccccggggttggacttgat 440 |||||||||||||||| |||||||| || ||||| Sbjct: 63713 caggcttgacaacttctccggggtttgatttgat 63680
>gb|AC147405.7| Medicago truncatula clone mth2-146n5, complete sequence Length = 147062 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Plus Query: 309 gtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggta 368 ||||||||| |||| |||||||| ||||| |||||||||||||| || ||||||||||| Sbjct: 83023 gtcggggaattccacggtgaagtgaatgtaaagcttgcccttcataaatggcctctggta 83082 Query: 369 catgggcatgccctcgtcgttgatcgccttgaatgaatc 407 ||| ||||| ||||||||||| || |||||| ||||||| Sbjct: 83083 catcggcattccctcgtcgttaatagccttgtatgaatc 83121 Score = 44.1 bits (22), Expect = 0.49 Identities = 31/34 (91%) Strand = Plus / Plus Query: 407 caggcttgacaacttccccggggttggacttgat 440 |||||||||||||||| |||||||| || ||||| Sbjct: 83350 caggcttgacaacttctccggggtttgatttgat 83383
>gb|AC130810.14| Medicago truncatula clone mth2-36b14, complete sequence Length = 117901 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Plus Query: 309 gtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggta 368 ||||||||| |||| |||||||| ||||| |||||||||||||| || ||||||||||| Sbjct: 8629 gtcggggaattccacggtgaagtgaatgtaaagcttgcccttcataaatggcctctggta 8688 Query: 369 catgggcatgccctcgtcgttgatcgccttgaatgaatc 407 ||| ||||| ||||||||||| || |||||| ||||||| Sbjct: 8689 catcggcattccctcgtcgttaatagccttgtatgaatc 8727 Score = 44.1 bits (22), Expect = 0.49 Identities = 31/34 (91%) Strand = Plus / Plus Query: 407 caggcttgacaacttccccggggttggacttgat 440 |||||||||||||||| |||||||| || ||||| Sbjct: 8956 caggcttgacaacttctccggggtttgatttgat 8989
>gb|AY088078.1| Arabidopsis thaliana clone 40976 mRNA, complete sequence Length = 1595 Score = 97.6 bits (49), Expect = 4e-17 Identities = 154/189 (81%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||| |||||| ||||| |||| |||||||||||||||||||| || |||||||| || Sbjct: 1183 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacctttcatgaatgg 1124 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 1123 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 1064 Query: 420 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 479 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 1063 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 1004 Query: 480 gaagccaca 488 ||||||||| Sbjct: 1003 gaagccaca 995
>gb|L36113.1|ATHATJ Arabidopsis thaliana chaperone protein (atj) mRNA, complete cds Length = 1443 Score = 97.6 bits (49), Expect = 4e-17 Identities = 127/153 (83%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 1107 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 1048 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 419 || ||||| || ||||| ||||| || | ||||||||| |||||||||| ||||| || Sbjct: 1047 actttggtatattggcattccctcatcacttatcgccttgtatgaatcaggtttgacgac 988 Query: 420 ttccccggggttggacttgatgagcagctgtct 452 || ||||| ||||| |||||||| |||||||| Sbjct: 987 ctctccgggcttggatttgatgagaagctgtct 955
>gb|BT016805.1| Zea mays clone Contig638 mRNA sequence Length = 1814 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 306 cgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctg 365 |||||| ||||| |||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 1195 cgagtcagggaactccaccgtgaaatggatgtacagcttccccttcatgaaaggcctctg 1136 Query: 366 gtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttcccc 425 ||| || ||||| ||||| || || |||||||||||| ||||| || |||||||| || Sbjct: 1135 gtaaattggcatcccctcatcattaatcgccttgaattggtcaggtttaacaacttcacc 1076 Query: 426 ggggttggacttgatgagcagctg 449 |||| || |||||||| ||||| Sbjct: 1075 agggtctgatttgatgagaagctg 1052 Score = 44.1 bits (22), Expect = 0.49 Identities = 31/34 (91%) Strand = Plus / Minus Query: 209 tcgtctcctcgcactcgtctagctccatgtctgt 242 ||||||||||||| || |||| |||||||||||| Sbjct: 1292 tcgtctcctcgcattcatctatctccatgtctgt 1259
>gb|AC145811.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0088L13 map near C50029S, complete sequence Length = 129900 Score = 93.7 bits (47), Expect = 6e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 320 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 379 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 79167 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 79108 Query: 380 cctcgtcgttgatcgccttgaat 402 |||| ||||| || ||||||||| Sbjct: 79107 cctcatcgtttattgccttgaat 79085 Score = 63.9 bits (32), Expect = 5e-07 Identities = 98/120 (81%) Strand = Plus / Minus Query: 407 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 466 ||||||| |||||||| |||||||| ||||| ||||||||||||||| |||| ||| | Sbjct: 78997 caggcttaacaacttcaccggggtttgacttaatgagcagctgtctgttgtccagatgtg 78938 Query: 467 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 526 |||||| ||||||| ||||| || || || ||||| | | |||||||||||| |||| Sbjct: 78937 tcaggacaaattggaaaccacaaagtgcttcagtcagagataaggtgtgctcataaaaga 78878
>gb|AC133862.6| Medicago truncatula clone mth2-30d7, complete sequence Length = 130054 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 310 tcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtac 369 |||||||| |||| |||||||| ||||| ||||||||||||||||| |||||||||||| Sbjct: 70069 tcggggaactccacagtgaagtgaatgtaaagcttgcccttcatgaaaggcctctggtac 70010 Query: 370 atgggcatgccctcgtcgttgatcgccttgaatgaatc 407 || ||||| || || || ||||| |||||| ||||||| Sbjct: 70009 attggcattccttcatcattgattgccttgtatgaatc 69972 Score = 40.1 bits (20), Expect = 7.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 211 gtctcctcgcactcgtctagctccatgtctgt 242 |||||||| ||||| || |||||||||||||| Sbjct: 70168 gtctcctcacactcatccagctccatgtctgt 70137
>gb|AC124957.18| Medicago truncatula clone mth2-15k14, complete sequence Length = 140624 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Plus Query: 310 tcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtac 369 |||||||| |||| |||||||| ||||| ||||||||||||||||| |||||||||||| Sbjct: 75433 tcggggaactccacagtgaagtgaatgtaaagcttgcccttcatgaaaggcctctggtac 75492 Query: 370 atgggcatgccctcgtcgttgatcgccttgaatgaatc 407 || ||||| || || || ||||| |||||| ||||||| Sbjct: 75493 attggcattccttcatcattgattgccttgtatgaatc 75530 Score = 40.1 bits (20), Expect = 7.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 211 gtctcctcgcactcgtctagctccatgtctgt 242 |||||||| ||||| || |||||||||||||| Sbjct: 75334 gtctcctcacactcatccagctccatgtctgt 75365
>gb|AF053468.1|AF053468 Zea mays DnaJ-related protein ZMDJ1 (mdJ1) gene, complete cds Length = 3748 Score = 89.7 bits (45), Expect = 9e-15 Identities = 84/97 (86%) Strand = Plus / Minus Query: 306 cgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctg 365 |||||| ||||| |||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 3351 cgagtcagggaactccaccgtgaaatggatgtacagcttccccttcatgaaaggcctctg 3292 Query: 366 gtacatgggcatgccctcgtcgttgatcgccttgaat 402 ||| || ||||| ||||| || || |||||||||||| Sbjct: 3291 gtaaattggcatcccctcatcattaatcgccttgaat 3255 Score = 40.1 bits (20), Expect = 7.7 Identities = 63/78 (80%) Strand = Plus / Minus Query: 476 attggaagccacagagggcctccgtcagggtcagggtgtgctcatagaagangtcgtcag 535 ||||||| ||||| || || || ||||| | || ||||||||||||||||| || ||| Sbjct: 3099 attggaacccacatagtgcttcggtcagagacaaggtgtgctcatagaagagatcttcac 3040 Query: 536 ccttncgcttgaatttgg 553 |||| | |||||||||| Sbjct: 3039 cctttcttttgaatttgg 3022
>emb|AL353814.1|ATF26G5 Arabidopsis thaliana DNA chromosome 3, BAC clone F26G5 Length = 102873 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 50638 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 50697 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatc 407 ||||||||| || ||||| || || ||| | || |||||| ||||||| Sbjct: 50698 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatc 50745
>gb|AF032883.1|AF032883 Arabidopsis thaliana DnaJ homolog AtJ3 (ATJ3) gene, complete cds Length = 2403 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1916 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 1857 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatc 407 ||||||||| || ||||| || || ||| | || |||||| ||||||| Sbjct: 1856 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatc 1809
>dbj|AK220968.1| Arabidopsis thaliana mRNA for dnaJ protein homolog atj3, complete cds, clone: RAFL22-56-D08 Length = 493 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Minus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 72 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 13 Query: 360 cctctggta 368 ||||||||| Sbjct: 12 cctctggta 4
>gb|L09124.1|ATPANJ1X Atriplex nummularia homologous sequence (ANJ1) mRNA Length = 1672 Score = 81.8 bits (41), Expect = 2e-12 Identities = 95/113 (84%) Strand = Plus / Minus Query: 310 tcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtac 369 |||||||| |||| ||||| |||||||| | ||||||||||||||| ||||| ||||| Sbjct: 1087 tcggggaactccactgtgaaatggatgtacatcttgcccttcatgaacggcctttggtat 1028 Query: 370 atgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttc 422 || ||||| ||||| || | || ||||||||| |||||||||||||||||| Sbjct: 1027 ataggcataccctcatcctcaattgccttgaattgatcaggcttgacaacttc 975
>emb|X69436.1|APDNAJ A.porrum dnaJ mRNA for DNA J protein (partial) Length = 1210 Score = 77.8 bits (39), Expect = 4e-11 Identities = 132/163 (80%) Strand = Plus / Minus Query: 304 agcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctc 363 ||||| ||||||||| | ||| ||| |||||||| | ||| ||| ||||||| ||||| Sbjct: 974 agcgaatcggggaaatcaaccaagaactggatgtacaacttccccctcatgaatggcctt 915 Query: 364 tggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttcc 423 || ||||| ||||| || ||||| ||||||||||||||| ||| ||||| || || || Sbjct: 914 tgatacattggcattccttcgtcattgatcgccttgaattgatctggcttaaccacctct 855 Query: 424 ccggggttggacttgatgagcagctgtctgccatccaaatgag 466 || ||||| |||||||| || || || ||||||||||| |||| Sbjct: 854 ccagggttagacttgataaggagttgcctgccatccaagtgag 812
>gb|DQ083229.1| Oryza sativa (indica cultivar-group) clone 2B3E80 mRNA sequence Length = 568 Score = 77.8 bits (39), Expect = 4e-11 Identities = 129/159 (81%) Strand = Plus / Minus Query: 368 acatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccgg 427 |||| ||||| ||||| ||||| || ||||||||| |||||||| |||||||| |||| Sbjct: 568 acattggcattccctcatcgtttattgccttgaattggtcaggcttaacaacttcaccgg 509 Query: 428 ggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattggaagccac 487 |||| ||||| ||||||||||||||| |||| ||| | |||||| ||||||| |||| Sbjct: 508 ggtttgacttaatgagcagctgtctgttgtccagatgtgtcaggacaaattggaaaccac 449 Query: 488 agagggcctccgtcagggtcagggtgtgctcatagaaga 526 | || || || ||||| | | |||||||||||| |||| Sbjct: 448 aaagtgcttcagtcagagataaggtgtgctcataaaaga 410
>gb|AF239932.1|AF239932 Euphorbia esula DnaJ protein mRNA, complete cds Length = 1698 Score = 77.8 bits (39), Expect = 4e-11 Identities = 114/139 (82%) Strand = Plus / Minus Query: 326 tgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccctcgt 385 ||||||| ||||| | ||| ||| |||| || |||||||||||||| ||||| ||||| | Sbjct: 1099 tgaagtgaatgtacaacttacccctcataaatggcctctggtacattggcatcccctcat 1040 Query: 386 cgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgatgagca 445 | || || ||||||||| ||||||||| ||||||||||| || | |||||| ||||| | Sbjct: 1039 catttatagccttgaattgatcaggcttcacaacttccccaggctgggactttatgagga 980 Query: 446 gctgtctgccatccaaatg 464 | || || ||||| ||||| Sbjct: 979 gttgccttccatctaaatg 961
>emb|AL589883.1|ATT6G21 Arabidopsis thaliana DNA chromosome 5, BAC clone T6G21 (ESSA project) Length = 149788 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Plus Query: 300 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 359 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 71732 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 71791 Query: 360 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatc 407 ||| ||||| || ||||| ||||| || | ||||||||| ||||||| Sbjct: 71792 cctttggtatattggcattccctcatcacttatcgccttgtatgaatc 71839
>emb|AJ299254.1|NTA299254 Nicotiana tabacum mRNA for putative DNAJ protein Length = 1631 Score = 69.9 bits (35), Expect = 9e-09 Identities = 98/119 (82%) Strand = Plus / Minus Query: 343 ttgcccttcatgaagggcctctggtacatgggcatgccctcgtcgttgatcgccttgaat 402 |||||| |||| || |||||||| ||||| ||| | ||||| || ||||| ||||||||| Sbjct: 1041 ttgcccctcataaatggcctctgatacattggcgttccctcatcattgattgccttgaat 982 Query: 403 gaatcaggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaa 461 |||||| || |||||||||||| | || || || ||||| || |||||||||||||| Sbjct: 981 tgatcaggtttaacaacttccccgagatttgattttatgaggagttgtctgccatccaa 923
>gb|AY491517.1| Capsicum annuum DnaJ-like protein mRNA, partial sequence Length = 742 Score = 67.9 bits (34), Expect = 3e-08 Identities = 76/90 (84%) Strand = Plus / Minus Query: 364 tggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttcc 423 |||||||| ||||| || || |||||||| ||||| || |||||||||||||||||| Sbjct: 738 tggtacatcggcattccttcatcgttgatagccttaaactgatcaggcttgacaacttcg 679 Query: 424 ccggggttggacttgatgagcagctgtctg 453 || || | |||||| ||||||||||||||| Sbjct: 678 ccaggttgggacttaatgagcagctgtctg 649
>ref|NM_180322.1| Arabidopsis thaliana ATJ3 AT3G44110 (ATJ3) transcript variant AT3G44110.2 mRNA, complete cds Length = 1579 Score = 60.0 bits (30), Expect = 8e-06 Identities = 114/142 (80%) Strand = Plus / Minus Query: 347 ccttcatgaagggcctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaat 406 |||||||||| ||||||||||| || ||||| || || ||| | || |||||| |||||| Sbjct: 1156 ccttcatgaatggcctctggtatatcggcattccttcatcgcttattgccttgtatgaat 1097 Query: 407 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 466 |||| || || || ||||| || || || || ||||| || |||||||||||| |||| Sbjct: 1096 caggtttcacgacctccccaggattagatttaatgagaagacttctgccatccaagtgag 1037 Query: 467 ctaggacatattggaagccaca 488 || ||| ||||||||||||| Sbjct: 1036 tcagaacaaattggaagccaca 1015
>gb|AF154638.1| Nicotiana tabacum clone PR13 mRNA sequence Length = 722 Score = 58.0 bits (29), Expect = 3e-05 Identities = 81/97 (83%), Gaps = 1/97 (1%) Strand = Plus / Minus Query: 358 ggcctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggc-ttgac 416 ||||| |||||||| ||||| || || |||||||| ||||| || ||||||| ||||| Sbjct: 206 ggcctttggtacattggcattccttcatcgttgatagccttaaactgatcaggcattgac 147 Query: 417 aacttccccggggttggacttgatgagcagctgtctg 453 |||||| || || | ||||||||| |||||||||||| Sbjct: 146 aacttcgccaggttgggacttgatcagcagctgtctg 110
>gb|AY108749.1| Zea mays PCO080986 mRNA sequence Length = 1273 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 367 tacatgggcatgccctcgtcgttgatcgccttgaatgaatc 407 |||||||||||||| || |||||||| |||||||||||||| Sbjct: 1271 tacatgggcatgccttcatcgttgattgccttgaatgaatc 1231
>dbj|AB015601.1| Salix gilgiana SGJ3 mRNA for DnaJ homolog, complete cds Length = 1573 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 358 ggcctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgaca 417 ||||| |||||||| ||||| || || || || || ||||||||| |||||||||||| Sbjct: 1109 ggcctttggtacatcggcattccttcatcatttatagccttgaattgatcaggcttgact 1050 Query: 418 acttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatat 477 ||||||||||| | || || || || ||||| || ||||||||||| | | ||| || Sbjct: 1049 acttccccgggttgagattttatcaggagctgccttccatccaaatgggtcaagacgaat 990 Query: 478 tggaagccacagagggcctc 497 ||||||||||| || ||||| Sbjct: 989 tggaagccacatagtgcctc 970
>emb|X77632.1|APLDJ2 A.porrum LDJ2 mRNA Length = 1509 Score = 54.0 bits (27), Expect = 5e-04 Identities = 54/63 (85%) Strand = Plus / Minus Query: 327 gaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccctcgtc 386 |||||| ||||| ||||| || ||||||| |||||||||||||| ||||| || ||||| Sbjct: 1094 gaagtgaatgtaaagctttcctctcatgaatggcctctggtacatcggcattccttcgtc 1035 Query: 387 gtt 389 ||| Sbjct: 1034 gtt 1032 Score = 42.1 bits (21), Expect = 2.0 Identities = 51/61 (83%) Strand = Plus / Minus Query: 133 tcctcgtcataggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatg 192 ||||| || ||||||||||| || ||||| ||||| | ||||| |||||| ||||| ||| Sbjct: 1288 tcctcatcgtaggcctcctgagcttgctggtgctgcttcctcctcatctcctcctctatg 1229 Query: 193 t 193 | Sbjct: 1228 t 1228
>gb|AY244756.1| Solanum tuberosum clone PATMAGC326-SH AFLP marker sequence Length = 426 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 320 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 379 |||| ||||| || ||||| || || ||||||||||| ||||||||||| | ||||| | Sbjct: 93 ccactgtgaaatgaatgtacagtttacccttcatgaatggcctctggtaaactggcattc 34 Query: 380 cctcgtcgttgatcgccttgaat 402 | || || ||||||||||||||| Sbjct: 33 cttcatcattgatcgccttgaat 11
>dbj|AB032545.1| Nicotiana tabacum B38 mRNA for DnaJ homolog, complete cds Length = 1453 Score = 54.0 bits (27), Expect = 5e-04 Identities = 78/95 (82%) Strand = Plus / Minus Query: 358 ggcctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgaca 417 ||||| |||||||| ||||| || || || || || ||||| ||| ||||||||||||| Sbjct: 966 ggcctttggtacattggcattccttcatcatttatggccttaaattgatcaggcttgaca 907 Query: 418 acttccccggggttggacttgatgagcagctgtct 452 ||||| || || | |||||| ||||| |||||||| Sbjct: 906 acttctccaggttgggacttaatgagtagctgtct 872
>gb|DQ228340.1| Solanum tuberosum clone 147D03 DnaJ-like protein mRNA, complete cds Length = 1492 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 405 atcaggcttgacaacttccccggggttggacttgatgagcagctg 449 |||||||||||||||||| ||||| | || |||||||| |||||| Sbjct: 1006 atcaggcttgacaacttctccgggttggggcttgatgatcagctg 962
>gb|DQ228331.1| Solanum tuberosum clone 140B12 DnaJ-like protein mRNA, complete cds Length = 1496 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 405 atcaggcttgacaacttccccggggttggacttgatgagcagctg 449 |||||||||||||||||| ||||| | || |||||||| |||||| Sbjct: 1010 atcaggcttgacaacttctccgggttggggcttgatgatcagctg 966
>gb|DQ200383.1| Solanum tuberosum clone 063B08 DnaJ-like protein mRNA, complete cds Length = 1515 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 405 atcaggcttgacaacttccccggggttggacttgatgagcagctg 449 |||||||||||||||||| ||||| | || |||||||| |||||| Sbjct: 1034 atcaggcttgacaacttctccgggttggggcttgatgatcagctg 990
>dbj|AB003138.1| Salix gilgiana premature mRNA for DnaJ homolog protein, complete cds Length = 2555 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Minus Query: 306 cgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcct 362 |||||| ||||| ||||| | || ||||| |||||||||||| ||||||||||||| Sbjct: 2088 cgagtcagggaacaccacattaaaatggatatagagcttgcccctcatgaagggcct 2032
>gb|DQ252506.1| Solanum tuberosum clone 085D01 DnaJ-like protein-like mRNA, complete cds Length = 1502 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 405 atcaggcttgacaacttccccggggttggacttgatgagcagctg 449 |||||||||||||||||| ||||| | || |||||||| |||||| Sbjct: 1001 atcaggcttgacaacttctccgggttggggcttgatgatcagctg 957
>dbj|AB003137.1| Salix gilgiana mRNA for DnaJ homolog protein, complete cds Length = 1610 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Minus Query: 306 cgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcct 362 |||||| ||||| ||||| | || ||||| |||||||||||| ||||||||||||| Sbjct: 1149 cgagtcagggaacaccacattaaaatggatatagagcttgcccctcatgaagggcct 1093
>ref|XM_482383.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1491 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 99 caccctctgcccgccgccgcccg 121 ||||||||||||||||||||||| Sbjct: 938 caccctctgcccgccgccgcccg 916
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome Length = 3046682 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 150 ctgcgcctgctgctgctgttgcc 172 ||||||||||||||||||||||| Sbjct: 144307 ctgcgcctgctgctgctgttgcc 144285
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 99 caccctctgcccgccgccgcccg 121 ||||||||||||||||||||||| Sbjct: 19739269 caccctctgcccgccgccgcccg 19739247
>dbj|AP005158.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0007M04 Length = 176293 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 99 caccctctgcccgccgccgcccg 121 ||||||||||||||||||||||| Sbjct: 68220 caccctctgcccgccgccgcccg 68198
>dbj|AK106356.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-A06, full insert sequence Length = 1491 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 99 caccctctgcccgccgccgcccg 121 ||||||||||||||||||||||| Sbjct: 938 caccctctgcccgccgccgcccg 916
>gb|AC107663.10| Mus musculus chromosome 13, clone RP23-99G9, complete sequence Length = 213163 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 446 gctgtctgccatccaaatgagc 467 |||||||||||||||||||||| Sbjct: 184957 gctgtctgccatccaaatgagc 184978
>ref|NM_168837.1| Drosophila melanogaster CG17233-RC, transcript variant C (CG17233), mRNA Length = 5471 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 150 ctgcgcctgctgctgctgttgc 171 |||||||||||||||||||||| Sbjct: 2519 ctgcgcctgctgctgctgttgc 2498
>ref|NM_168836.1| Drosophila melanogaster CG17233-RA, transcript variant A (CG17233), mRNA Length = 4595 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 150 ctgcgcctgctgctgctgttgc 171 |||||||||||||||||||||| Sbjct: 1643 ctgcgcctgctgctgctgttgc 1622
>ref|NM_140939.2| Drosophila melanogaster CG17233-RB, transcript variant B (CG17233), mRNA Length = 5079 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 150 ctgcgcctgctgctgctgttgc 171 |||||||||||||||||||||| Sbjct: 2127 ctgcgcctgctgctgctgttgc 2106
>gb|AC009839.10| Drosophila melanogaster 3L BAC RP98-16G9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 185918 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 150 ctgcgcctgctgctgctgttgc 171 |||||||||||||||||||||| Sbjct: 27309 ctgcgcctgctgctgctgttgc 27330
>gb|AC009383.8| Drosophila melanogaster 3L BAC RP98-31C3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179283 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 150 ctgcgcctgctgctgctgttgc 171 |||||||||||||||||||||| Sbjct: 166446 ctgcgcctgctgctgctgttgc 166467
>gb|AY060466.1| Drosophila melanogaster SD04853 full length cDNA Length = 5112 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 150 ctgcgcctgctgctgctgttgc 171 |||||||||||||||||||||| Sbjct: 2127 ctgcgcctgctgctgctgttgc 2106
>gb|BT021948.1| Drosophila melanogaster LD13191 full insert cDNA Length = 2971 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 150 ctgcgcctgctgctgctgttgc 171 |||||||||||||||||||||| Sbjct: 1643 ctgcgcctgctgctgctgttgc 1622
>ref|XM_319781.2| Anopheles gambiae str. PEST ENSANGP00000023939 (ENSANGG00000023183), partial mRNA Length = 552 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 145 gcctcctgcgcctgctgctgctgttg 170 |||| ||||||||||||||||||||| Sbjct: 161 gcctgctgcgcctgctgctgctgttg 136
>gb|AE003514.4| Drosophila melanogaster chromosome 3L, section 71 of 83 of the complete sequence Length = 299903 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 150 ctgcgcctgctgctgctgttgc 171 |||||||||||||||||||||| Sbjct: 209463 ctgcgcctgctgctgctgttgc 209484
>ref|NM_178332.1| Homo sapiens gonadotropin-releasing hormone 2 (GNRH2), transcript variant 2, mRNA Length = 399 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 143 aggcctcctgcgcctgctgctgctg 167 ||||||||||| ||||||||||||| Sbjct: 69 aggcctcctgctcctgctgctgctg 93
>ref|NM_178331.1| Homo sapiens gonadotropin-releasing hormone 2 (GNRH2), transcript variant 3, mRNA Length = 402 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 143 aggcctcctgcgcctgctgctgctg 167 ||||||||||| ||||||||||||| Sbjct: 69 aggcctcctgctcctgctgctgctg 93
>ref|NM_001501.1| Homo sapiens gonadotropin-releasing hormone 2 (GNRH2), transcript variant 1, mRNA Length = 423 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 143 aggcctcctgcgcctgctgctgctg 167 ||||||||||| ||||||||||||| Sbjct: 69 aggcctcctgctcctgctgctgctg 93
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 134 cctcgtcataggcctcctgcg 154 ||||||||||||||||||||| Sbjct: 182192 cctcgtcataggcctcctgcg 182172
>gb|AC011251.6| Drosophila melanogaster clone BACR09F10, complete sequence Length = 173988 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 151 tgcgcctgctgctgctgttgc 171 ||||||||||||||||||||| Sbjct: 28681 tgcgcctgctgctgctgttgc 28701
>ref|XM_368171.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein (MG01073.4) partial mRNA Length = 2916 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 144 ggcctcctgcgcctgctgctgctgt 168 |||| |||||||||||||||||||| Sbjct: 2619 ggccgcctgcgcctgctgctgctgt 2595
>gb|AC138260.7| Mus musculus chromosome 6, clone RP23-247I19, complete sequence Length = 197686 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 147 ctcctgcgcctgctgctgctgttgc 171 ||||||| ||||||||||||||||| Sbjct: 181403 ctcctgctcctgctgctgctgttgc 181379
>gb|BC069362.1| Homo sapiens gonadotropin-releasing hormone 2, transcript variant 1, mRNA (cDNA clone MGC:97397 IMAGE:7262673), complete cds Length = 422 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 143 aggcctcctgcgcctgctgctgctg 167 ||||||||||| ||||||||||||| Sbjct: 68 aggcctcctgctcctgctgctgctg 92
>ref|NM_019498.2| Mus musculus olfactomedin 1 (Olfm1), transcript variant 1, mRNA Length = 2727 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 101 ccctctgcccgccgccgcccg 121 ||||||||||||||||||||| Sbjct: 145 ccctctgcccgccgccgcccg 125
>ref|NM_001038612.1| Mus musculus olfactomedin 1 (Olfm1), transcript variant 2, mRNA Length = 1048 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 101 ccctctgcccgccgccgcccg 121 ||||||||||||||||||||| Sbjct: 145 ccctctgcccgccgccgcccg 125
>gb|AC165365.3| Mus musculus BAC clone RP23-28N13 from chromosome 6, complete sequence Length = 238262 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 147 ctcctgcgcctgctgctgctgttgc 171 ||||||| ||||||||||||||||| Sbjct: 138084 ctcctgctcctgctgctgctgttgc 138060
>gb|AY702654.1| Chlamydomonas reinhardtii Set3p (Set3) mRNA, complete cds Length = 3059 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 150 ctgcgcctgctgctgctgttg 170 ||||||||||||||||||||| Sbjct: 2826 ctgcgcctgctgctgctgttg 2806
>ref|XM_983991.1| PREDICTED: Mus musculus SRY-box containing gene 30 (Sox30), mRNA Length = 2196 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 gctgctgctgttgcctccgca 178 ||||||||||||||||||||| Sbjct: 627 gctgctgctgttgcctccgca 647
>ref|XM_756903.1| Ustilago maydis 521 hypothetical protein (UM05849.1) partial mRNA Length = 3156 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 ctcctgcgcctgctgctgctg 167 ||||||||||||||||||||| Sbjct: 2737 ctcctgcgcctgctgctgctg 2717
>ref|XM_746258.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g14820) partial mRNA Length = 1437 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Minus Query: 147 ctcctgcgcctgctgctgctgttgcctccgcat 179 ||||||| ||||||||||||| ||| ||||||| Sbjct: 522 ctcctgctcctgctgctgctgctgcatccgcat 490
>emb|AL121905.23|HSDJ534B8 Human DNA sequence from clone RP4-534B8 on chromosome 20 Contains the 3' end of the PTPRA gene for protein tyrosine phosphatase receptor type A, the GNRH2 gene for gonadotropin-releasing hormone 2, a novel gene and two CpG islands, complete sequence Length = 126679 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 143 aggcctcctgcgcctgctgctgctg 167 ||||||||||| ||||||||||||| Sbjct: 121853 aggcctcctgctcctgctgctgctg 121877
>ref|XM_781569.1| PREDICTED: Strongylocentrotus purpuratus similar to hydroxysteroid (17-beta) dehydrogenase 4 (LOC581580), mRNA Length = 2151 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 337 tagagcttgcccttcatgaag 357 ||||||||||||||||||||| Sbjct: 2150 tagagcttgcccttcatgaag 2130
>emb|X94301.1|STDNAJ S.tuberosum mRNA for DnaJ protein Length = 1421 Score = 42.1 bits (21), Expect = 2.0 Identities = 39/45 (86%) Strand = Plus / Minus Query: 405 atcaggcttgacaacttccccggggttggacttgatgagcagctg 449 |||||||||||||||||| |||| | || |||||||| |||||| Sbjct: 986 atcaggcttgacaacttctccggcttggggcttgatgatcagctg 942
>emb|AJ000977.1|RSCHEMOOP Rhodobacter sphaeroides DNA for second chemotaxis operon and flanking genes Length = 10434 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 134 cctcgtcataggcctcctgcg 154 ||||||||||||||||||||| Sbjct: 9476 cctcgtcataggcctcctgcg 9456
>emb|AL645948.10| Mouse DNA sequence from clone RP23-298M7 on chromosome 11 Contains an H+ transporting ATP synthase mitochondrial F0 complex subunit g (Atp5l) pseudogene, a ferritin light chain 1 (Ftl1) pseudogene, three novel genes, the gene for a novel ENTH domain containing protein, the 5' end of the Sox30 gene for SRY-box containing gene 30 and three Cpg islands, complete sequence Length = 207877 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 gctgctgctgttgcctccgca 178 ||||||||||||||||||||| Sbjct: 204959 gctgctgctgttgcctccgca 204979
>ref|NM_167744.3| Drosophila melanogaster tweety CG1693-RB, transcript variant B (tty), mRNA Length = 2977 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 151 tgcgcctgctgctgctgttgc 171 ||||||||||||||||||||| Sbjct: 1995 tgcgcctgctgctgctgttgc 1975
>ref|NM_080712.5| Drosophila melanogaster tweety CG1693-RA, transcript variant A (tty), mRNA Length = 3890 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 151 tgcgcctgctgctgctgttgc 171 ||||||||||||||||||||| Sbjct: 1995 tgcgcctgctgctgctgttgc 1975
>gb|AY084210.1| Drosophila melanogaster SD08336 full insert cDNA Length = 3714 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 150 ctgcgcctgctgctgctgttg 170 ||||||||||||||||||||| Sbjct: 1329 ctgcgcctgctgctgctgttg 1309
>gb|AC084265.4| Homo sapiens chromosome 2, clone CTB-2367F13, complete sequence Length = 127066 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 163 tgctgttgcctccgcatctcttcct 187 |||||||||||| |||||||||||| Sbjct: 55701 tgctgttgcctcagcatctcttcct 55725
>gb|AC069282.6| Homo sapiens BAC clone RP11-61L9 from 7, complete sequence Length = 175938 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 327 gaagtggatgtagagcttgcccttc 351 |||||||||||||||| |||||||| Sbjct: 133937 gaagtggatgtagagcctgcccttc 133913
>gb|AF351820.1|F351812S09 Homo sapiens sterolin-2 (ABCG8) gene, exon 9 Length = 685 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 163 tgctgttgcctccgcatctcttcct 187 |||||||||||| |||||||||||| Sbjct: 272 tgctgttgcctcagcatctcttcct 296
>emb|BX004816.11| Zebrafish DNA sequence from clone DKEY-30G5 in linkage group 3, complete sequence Length = 231341 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 437 tgatgagcagctgtctgccat 457 ||||||||||||||||||||| Sbjct: 159218 tgatgagcagctgtctgccat 159238
>gb|AC108476.5| Homo sapiens BAC clone RP11-1413K20 from 2, complete sequence Length = 139342 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 163 tgctgttgcctccgcatctcttcct 187 |||||||||||| |||||||||||| Sbjct: 53935 tgctgttgcctcagcatctcttcct 53959
>gb|AY005801.1| Mus musculus Sox-30 mRNA, complete cds Length = 3074 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 gctgctgctgttgcctccgca 178 ||||||||||||||||||||| Sbjct: 412 gctgctgctgttgcctccgca 432
>gb|S58775.1| Solanum tuberosum tuber-induction protein mRNA, partial cds Length = 950 Score = 42.1 bits (21), Expect = 2.0 Identities = 39/45 (86%) Strand = Plus / Minus Query: 405 atcaggcttgacaacttccccggggttggacttgatgagcagctg 449 |||||||||||||||||| |||| | || |||||||| |||||| Sbjct: 629 atcaggcttgacaacttctccggcttggggcttgatgatcagctg 585
>gb|AY108160.1| Zea mays PCO119794 mRNA sequence Length = 1849 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 211 gtctcctcgcactcgtctagctccatgtc 239 ||||||||||||| ||| ||||||||||| Sbjct: 1294 gtctcctcgcactggtccagctccatgtc 1266
>gb|AF184227.1|AF184227 Drosophila melanogaster clone LD23194 tty (tty) mRNA, complete cds Length = 3863 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 151 tgcgcctgctgctgctgttgc 171 ||||||||||||||||||||| Sbjct: 1971 tgcgcctgctgctgctgttgc 1951
>gb|AE003568.4| Drosophila melanogaster chromosome X, section 71 of 74 of the complete sequence Length = 315815 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 151 tgcgcctgctgctgctgttgc 171 ||||||||||||||||||||| Sbjct: 128661 tgcgcctgctgctgctgttgc 128681
>gb|AF017777.1|AF017777 Drosophila melanogaster tweety (tty), flightless (fli), dodo (dod), penguin (pen), small optic lobes (sol), innocent bystander (iby), waclaw (waw), bobby sox (bbx), sluggish (slg), helicase (hlc), misato (mst), and la costa (lcs) genes, complete cds Length = 66669 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 151 tgcgcctgctgctgctgttgc 171 ||||||||||||||||||||| Sbjct: 2620 tgcgcctgctgctgctgttgc 2640
>gb|AF036330.1|AF036330 Homo sapiens gonadotropin-releasing hormone precursor, second form (GnRH-II) mRNA, partial cds Length = 391 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 143 aggcctcctgcgcctgctgctgctg 167 ||||||||||| ||||||||||||| Sbjct: 69 aggcctcctgctcctgctgctgctg 93
>gb|AF036329.1|AF036329 Homo sapiens gonadotropin-releasing hormone precursor, second form (GnRH-II) gene, complete cds Length = 4498 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 143 aggcctcctgcgcctgctgctgctg 167 ||||||||||| ||||||||||||| Sbjct: 2122 aggcctcctgctcctgctgctgctg 2146
>ref|NM_173384.1| Mus musculus SRY-box containing gene 30 (Sox30), mRNA Length = 3074 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 gctgctgctgttgcctccgca 178 ||||||||||||||||||||| Sbjct: 412 gctgctgctgttgcctccgca 432
>gb|AC171736.1| Lycopersicon esculentum chromosome 11 clone C11HBa0323E19, complete sequence Length = 141216 Score = 42.1 bits (21), Expect = 2.0 Identities = 48/57 (84%) Strand = Plus / Plus Query: 346 cccttcatgaagggcctctggtacatgggcatgccctcgtcgttgatcgccttgaat 402 ||||||||||| ||||||||||| | ||||| || || || ||||| ||||||||| Sbjct: 107547 cccttcatgaatggcctctggtaaactggcattccttcatcattgatagccttgaat 107603
>emb|AL596108.13| Mouse DNA sequence from clone RP23-326K2 on chromosome 11, complete sequence Length = 200966 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 544 ttgaatttgggggtgctcctt 564 ||||||||||||||||||||| Sbjct: 124938 ttgaatttgggggtgctcctt 124958
>emb|AL731778.12| Mouse DNA sequence from clone RP23-475B13 on chromosome 2, complete sequence Length = 211430 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 101 ccctctgcccgccgccgcccg 121 ||||||||||||||||||||| Sbjct: 175172 ccctctgcccgccgccgcccg 175152
>gb|AC114617.16| Mus musculus chromosome 5, clone RP24-84E3, complete sequence Length = 200977 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 545 tgaatttgggggtgctcctt 564 |||||||||||||||||||| Sbjct: 140425 tgaatttgggggtgctcctt 140406
>ref|NM_188447.1| Oryza sativa (japonica cultivar-group), Ozsa8142 predicted mRNA Length = 1125 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 96 ctgcaccctctgcccgccgccgcc 119 |||| ||||||||||||||||||| Sbjct: 105 ctgcgccctctgcccgccgccgcc 82
>ref|XM_475149.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 218 cgcactcgtctagctccatgtctg 241 |||||||||| ||||||||||||| Sbjct: 545 cgcactcgtccagctccatgtctg 522
>ref|NM_186999.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1689 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 146 cctcctgcgcctgctgctgctgtt 169 |||||||| ||||||||||||||| Sbjct: 1570 cctcctgctcctgctgctgctgtt 1593
>ref|NM_022384.1| Rattus norvegicus achaete-scute complex homolog-like 1 (Drosophila) (Ascl1), mRNA Length = 1656 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 gcgcctgctgctgctgttgc 171 |||||||||||||||||||| Sbjct: 906 gcgcctgctgctgctgttgc 887
>gb|AC008203.8| Drosophila melanogaster clone BACR29F06, complete sequence Length = 174729 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 151 tgcgcctgctgctgctgttg 170 |||||||||||||||||||| Sbjct: 124993 tgcgcctgctgctgctgttg 125012
>gb|AC007694.7| Drosophila melanogaster clone BACR17O24, complete sequence Length = 193722 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 194 ctatatcgtaggccatcgtc 213 |||||||||||||||||||| Sbjct: 43851 ctatatcgtaggccatcgtc 43870
>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome Length = 2560265 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 384 gtcgttgatcgccttgaatgaatc 407 |||||||||| ||||||||||||| Sbjct: 488988 gtcgttgatcaccttgaatgaatc 489011
>ref|XM_879724.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 10 (LOC615175), mRNA Length = 2598 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 tgttgcctccgcatctcttcctca 189 ||||||| |||||||||||||||| Sbjct: 1182 tgttgccgccgcatctcttcctca 1159
>ref|XM_879698.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 9 (LOC615175), mRNA Length = 2621 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 tgttgcctccgcatctcttcctca 189 ||||||| |||||||||||||||| Sbjct: 1205 tgttgccgccgcatctcttcctca 1182
>ref|XM_867114.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 1 (LOC615175), mRNA Length = 2204 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 tgttgcctccgcatctcttcctca 189 ||||||| |||||||||||||||| Sbjct: 1182 tgttgccgccgcatctcttcctca 1159
>ref|XM_879637.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 8 (LOC615175), mRNA Length = 2525 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 tgttgcctccgcatctcttcctca 189 ||||||| |||||||||||||||| Sbjct: 1109 tgttgccgccgcatctcttcctca 1086
>ref|XM_879607.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 7 (LOC615175), mRNA Length = 2400 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 tgttgcctccgcatctcttcctca 189 ||||||| |||||||||||||||| Sbjct: 984 tgttgccgccgcatctcttcctca 961
>ref|XM_879574.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 6 (LOC615175), mRNA Length = 2495 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 tgttgcctccgcatctcttcctca 189 ||||||| |||||||||||||||| Sbjct: 1182 tgttgccgccgcatctcttcctca 1159
>ref|XM_879515.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 4 (LOC615175), mRNA Length = 2080 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 tgttgcctccgcatctcttcctca 189 ||||||| |||||||||||||||| Sbjct: 664 tgttgccgccgcatctcttcctca 641
>ref|XM_879484.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 3 (LOC615175), mRNA Length = 1520 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 tgttgcctccgcatctcttcctca 189 ||||||| |||||||||||||||| Sbjct: 104 tgttgccgccgcatctcttcctca 81
>gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0025P09, complete sequence Length = 167318 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 218 cgcactcgtctagctccatgtctg 241 |||||||||| ||||||||||||| Sbjct: 94104 cgcactcgtccagctccatgtctg 94081
>ref|XM_706548.1| Candida albicans SC5314 hypothetical protein (CaO19.13710), mRNA Length = 2079 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 404 aatcaggcttgacaacttcc 423 |||||||||||||||||||| Sbjct: 456 aatcaggcttgacaacttcc 475
>ref|XM_706479.1| Candida albicans SC5314 hypothetical protein (CaO19.6353), mRNA Length = 2079 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 404 aatcaggcttgacaacttcc 423 |||||||||||||||||||| Sbjct: 456 aatcaggcttgacaacttcc 475
>gb|AC099640.6| Mus musculus chromosome 1, clone RP24-339K18, complete sequence Length = 177962 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 106 tgcccgccgccgcccggcat 125 |||||||||||||||||||| Sbjct: 14548 tgcccgccgccgcccggcat 14529
>ref|XM_853285.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 13 (LOC612773), mRNA Length = 2290 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 1274 ctgttgccgccgcatctcttcctc 1251
>ref|XM_853248.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 12 (LOC612773), mRNA Length = 2382 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 1274 ctgttgccgccgcatctcttcctc 1251
>ref|XM_853207.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 11 (LOC612773), mRNA Length = 1616 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 1274 ctgttgccgccgcatctcttcctc 1251
>ref|XM_853123.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 9 (LOC612773), mRNA Length = 2385 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 1174 ctgttgccgccgcatctcttcctc 1151
>ref|XM_853086.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 8 (LOC612773), mRNA Length = 2550 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 1339 ctgttgccgccgcatctcttcctc 1316
>ref|XM_853047.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 7 (LOC612773), mRNA Length = 2396 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 1185 ctgttgccgccgcatctcttcctc 1162
>ref|XM_853008.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 6 (LOC612773), mRNA Length = 2215 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 1004 ctgttgccgccgcatctcttcctc 981
>ref|XM_852963.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 5 (LOC612773), mRNA Length = 1777 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 566 ctgttgccgccgcatctcttcctc 543
>ref|XM_852923.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 4 (LOC612773), mRNA Length = 1333 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 122 ctgttgccgccgcatctcttcctc 99
>ref|XM_844017.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 2 (LOC612773), mRNA Length = 2485 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 1274 ctgttgccgccgcatctcttcctc 1251
>ref|XM_987520.1| PREDICTED: Mus musculus zinc finger, CCHC domain containing 2, transcript variant 2 (Zcchc2), mRNA Length = 6658 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 106 tgcccgccgccgcccggcat 125 |||||||||||||||||||| Sbjct: 635 tgcccgccgccgcccggcat 616
>ref|XM_129972.7| PREDICTED: Mus musculus zinc finger, CCHC domain containing 2, transcript variant 1 (Zcchc2), mRNA Length = 6658 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 106 tgcccgccgccgcccggcat 125 |||||||||||||||||||| Sbjct: 635 tgcccgccgccgcccggcat 616
>ref|XM_854653.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 3 (LOC482706), mRNA Length = 2338 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 1108 ctgttgccgccgcatctcttcctc 1085
>ref|XM_539822.2| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 2 (LOC482706), mRNA Length = 1646 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 1108 ctgttgccgccgcatctcttcctc 1085
>ref|XM_846065.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding (LOC608914), mRNA Length = 1408 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 ctgttgcctccgcatctcttcctc 188 |||||||| ||||||||||||||| Sbjct: 1141 ctgttgccgccgcatctcttcctc 1118
>gb|AC007316.4| Homo sapiens BAC clone RP11-356B17 from 7, complete sequence Length = 106392 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 ctgctgctgctgttgcctcc 175 |||||||||||||||||||| Sbjct: 84569 ctgctgctgctgttgcctcc 84588
>gb|BC105532.1| Bos taurus similar to non-POU domain containing, octamer-binding, mRNA (cDNA clone MGC:128851 IMAGE:8119639), complete cds Length = 2580 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 tgttgcctccgcatctcttcctca 189 ||||||| |||||||||||||||| Sbjct: 1125 tgttgccgccgcatctcttcctca 1102
>gb|BT009348.1| Triticum aestivum clone wlm96.pk0006.b11:fis, full insert mRNA sequence Length = 850 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 425 cggggttggacttgatgagcagct 448 ||||||||||||||| |||||||| Sbjct: 202 cggggttggacttgaggagcagct 179
>emb|BX055061.1|CNS09END Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tgcgcctgctgctgctgttg 170 |||||||||||||||||||| Sbjct: 186 tgcgcctgctgctgctgttg 167
>emb|BX572599.1| Rhodopseudomonas palustris CGA009 complete genome; segment 7/16 Length = 349142 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 cctcgtcgttgatcgccttg 399 |||||||||||||||||||| Sbjct: 290750 cctcgtcgttgatcgccttg 290769
>ref|NM_142975.2| Drosophila melanogaster CG5669-RA (CG5669), mRNA Length = 3493 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tgcgcctgctgctgctgttg 170 |||||||||||||||||||| Sbjct: 1478 tgcgcctgctgctgctgttg 1459
>ref|NM_142222.1| Drosophila melanogaster CG5302-RA (CG5302), mRNA Length = 1908 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 194 ctatatcgtaggccatcgtc 213 |||||||||||||||||||| Sbjct: 1363 ctatatcgtaggccatcgtc 1344
>ref|NM_137372.2| Drosophila melanogaster CG6520-RA (CG6520), mRNA Length = 864 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 ctcctgcgcctgctgctgct 166 |||||||||||||||||||| Sbjct: 161 ctcctgcgcctgctgctgct 142
>gb|AC105225.5| Homo sapiens chromosome 8, clone RP11-775E18, complete sequence Length = 135609 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 500 tcagggtcagggtgtgctca 519 |||||||||||||||||||| Sbjct: 34530 tcagggtcagggtgtgctca 34511
>gb|AY089533.1| Drosophila melanogaster LD04007 full insert cDNA Length = 3511 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tgcgcctgctgctgctgttg 170 |||||||||||||||||||| Sbjct: 1478 tgcgcctgctgctgctgttg 1459
>gb|AY071537.1| Drosophila melanogaster RE57682 full length cDNA Length = 866 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 ctcctgcgcctgctgctgct 166 |||||||||||||||||||| Sbjct: 163 ctcctgcgcctgctgctgct 144
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 143 aggcctcctgcgcctgctgc 162 |||||||||||||||||||| Sbjct: 2202104 aggcctcctgcgcctgctgc 2202123
>gb|AC109037.6| Rattus norvegicus 18 BAC CH230-178G23 (Children's Hospital Oakland Research Institute) complete sequence Length = 208650 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 ctgctgctgctgttgcctcc 175 |||||||||||||||||||| Sbjct: 7940 ctgctgctgctgttgcctcc 7921
>dbj|AK046562.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length enriched library, clone:B430011M18 product:hypothetical PX (Bem1/NCF1/PI3K) domain/ATP synthase alpha and beta subunit, central region containing protein, full insert sequence Length = 2079 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 106 tgcccgccgccgcccggcat 125 |||||||||||||||||||| Sbjct: 636 tgcccgccgccgcccggcat 617
>gb|AC153514.8| Mus musculus 10 BAC RP23-406O24 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 189633 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tctgccatccaaatgagcta 469 |||||||||||||||||||| Sbjct: 121951 tctgccatccaaatgagcta 121970
>gb|AC008004.5|AC008004 Drosophila melanogaster, chromosome 2R, region 54B-54C, BAC clone BACR21A09, complete sequence Length = 175506 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 ctcctgcgcctgctgctgct 166 |||||||||||||||||||| Sbjct: 67392 ctcctgcgcctgctgctgct 67411
>emb|AL112780.1|CNS01AD0 Botrytis cinerea strain T4 cDNA library Length = 660 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 423 cccggggttggacttgatga 442 |||||||||||||||||||| Sbjct: 506 cccggggttggacttgatga 525
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 146 cctcctgcgcctgctgctgctgtt 169 |||||||| ||||||||||||||| Sbjct: 23694966 cctcctgctcctgctgctgctgtt 23694989
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 218 cgcactcgtctagctccatgtctg 241 |||||||||| ||||||||||||| Sbjct: 17834150 cgcactcgtccagctccatgtctg 17834127
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 96 ctgcaccctctgcccgccgccgcc 119 |||| ||||||||||||||||||| Sbjct: 6318557 ctgcgccctctgcccgccgccgcc 6318534
>gb|AC015599.5|AC015599 Homo sapiens chromosome , clone RP11-45B19, complete sequence Length = 162607 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 500 tcagggtcagggtgtgctca 519 |||||||||||||||||||| Sbjct: 14439 tcagggtcagggtgtgctca 14420
>emb|BX005061.9| Zebrafish DNA sequence from clone CH211-158F5 in linkage group 5, complete sequence Length = 155854 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 11 taacatggaaaacttgagaa 30 |||||||||||||||||||| Sbjct: 50825 taacatggaaaacttgagaa 50806
>gb|AC007647.6|AC007647 Drosophila melanogaster, chromosome 3R, region 89B-89C, BAC clone BACR05P04, complete sequence Length = 194335 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 tcctgcgcctgctgctgctg 167 |||||||||||||||||||| Sbjct: 175723 tcctgcgcctgctgctgctg 175704
>gb|AC011615.4|AC011615 Drosophila melanogaster, chromosome 3R, region 89D-89D, BAC clone BACR01H23, complete sequence Length = 199653 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 tcctgcgcctgctgctgctg 167 |||||||||||||||||||| Sbjct: 40864 tcctgcgcctgctgctgctg 40845
>ref|XM_341619.2| PREDICTED: Rattus norvegicus a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19 (predicted) (Adamts19_predicted), mRNA Length = 5043 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 ctgctgctgctgttgcctcc 175 |||||||||||||||||||| Sbjct: 939 ctgctgctgctgttgcctcc 958
>ref|XM_579457.1| PREDICTED: Rattus norvegicus achaete-scute complex homolog-like 1 (Drosophila) (Ascl1), mRNA Length = 1491 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 gcgcctgctgctgctgttgc 171 |||||||||||||||||||| Sbjct: 736 gcgcctgctgctgctgttgc 717
>ref|XM_345249.2| PREDICTED: Rattus norvegicus similar to KIAA0460 protein (predicted) (LOC365869), mRNA Length = 4303 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 ctgctgctgctgttgcctcc 175 |||||||||||||||||||| Sbjct: 4001 ctgctgctgctgttgcctcc 3982
>gb|AC135075.5| Homo sapiens chromosome 8, clone RP11-557G24, complete sequence Length = 72016 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 500 tcagggtcagggtgtgctca 519 |||||||||||||||||||| Sbjct: 46939 tcagggtcagggtgtgctca 46920
>gb|AC011455.6|AC011455 Homo sapiens chromosome 19 clone CTC-360G5, complete sequence Length = 148876 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 87 ctgggcgcactgcaccctctgccc 110 |||||| ||||||||||||||||| Sbjct: 78423 ctgggctcactgcaccctctgccc 78400
>dbj|AP001633.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0515G01 Length = 175072 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 96 ctgcaccctctgcccgccgccgcc 119 |||| ||||||||||||||||||| Sbjct: 89623 ctgcgccctctgcccgccgccgcc 89600
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 108 cccgccgccgcccggcatat 127 |||||||||||||||||||| Sbjct: 251519 cccgccgccgcccggcatat 251538
>dbj|AK173248.1| Mus musculus mRNA for mKIAA1744 protein Length = 6369 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 106 tgcccgccgccgcccggcat 125 |||||||||||||||||||| Sbjct: 352 tgcccgccgccgcccggcat 333
>dbj|AP003803.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1060_D03 Length = 102178 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 146 cctcctgcgcctgctgctgctgtt 169 |||||||| ||||||||||||||| Sbjct: 39580 cctcctgctcctgctgctgctgtt 39603
>dbj|AK119642.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-F10, full insert sequence Length = 1452 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 96 ctgcaccctctgcccgccgccgcc 119 |||| ||||||||||||||||||| Sbjct: 168 ctgcgccctctgcccgccgccgcc 145
>dbj|AK119598.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-117-E01, full insert sequence Length = 1520 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 96 ctgcaccctctgcccgccgccgcc 119 |||| ||||||||||||||||||| Sbjct: 165 ctgcgccctctgcccgccgccgcc 142
>emb|AJ234591.1|HVU234591 Hordeum vulgare genomic DNA fragment; clone MWG0851.uni Length = 611 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 150 ctgcgcctgctgctgctgttgcct 173 |||| ||||||||||||||||||| Sbjct: 367 ctgctcctgctgctgctgttgcct 390
>ref|XM_308780.2| Anopheles gambiae str. PEST ENSANGP00000007677 (ENSANGG00000005786), partial mRNA Length = 4758 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 tcctgcgcctgctgctgctg 167 |||||||||||||||||||| Sbjct: 1778 tcctgcgcctgctgctgctg 1759
>dbj|AK071269.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088L08, full insert sequence Length = 1690 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 146 cctcctgcgcctgctgctgctgtt 169 |||||||| ||||||||||||||| Sbjct: 1571 cctcctgctcctgctgctgctgtt 1594
>ref|NM_208127.1| Eremothecium gossypii ABL173Cp (ABL173C), mRNA Length = 909 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 443 gcagctgtctgccatccaaa 462 |||||||||||||||||||| Sbjct: 175 gcagctgtctgccatccaaa 156
>dbj|AK061118.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-F05, full insert sequence Length = 1577 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 96 ctgcaccctctgcccgccgccgcc 119 |||| ||||||||||||||||||| Sbjct: 168 ctgcgccctctgcccgccgccgcc 145
>dbj|AK059088.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-B07, full insert sequence Length = 1691 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 96 ctgcaccctctgcccgccgccgcc 119 |||| ||||||||||||||||||| Sbjct: 428 ctgcgccctctgcccgccgccgcc 405
>gb|AY107770.1| Zea mays PCO087426 mRNA sequence Length = 1494 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 gcgcctgctgctgctgttgc 171 |||||||||||||||||||| Sbjct: 381 gcgcctgctgctgctgttgc 362
>gb|AF080067.1|AF080067 Oryctolagus cuniculus sodium-dependent multi-vitamin transporter (SMVT) mRNA, complete cds Length = 3137 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 tggaagccacagagggcctc 497 |||||||||||||||||||| Sbjct: 2718 tggaagccacagagggcctc 2737
>gb|AE003746.3| Drosophila melanogaster chromosome 3R, section 84 of 118 of the complete sequence Length = 218498 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 151 tgcgcctgctgctgctgttg 170 |||||||||||||||||||| Sbjct: 193610 tgcgcctgctgctgctgttg 193629
>emb|X53725.1|RNMASH1 Rat MASH-1 mRNA expressed in neuronal precursor cells (mammalian achaete-scute homologue) Length = 1656 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 gcgcctgctgctgctgttgc 171 |||||||||||||||||||| Sbjct: 906 gcgcctgctgctgctgttgc 887
>gb|AE003713.3| Drosophila melanogaster chromosome 3R, section 51 of 118 of the complete sequence Length = 226561 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 tcctgcgcctgctgctgctg 167 |||||||||||||||||||| Sbjct: 39032 tcctgcgcctgctgctgctg 39013
>gb|AE003709.4| Drosophila melanogaster chromosome 3R, section 47 of 118 of the complete sequence Length = 222815 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 194 ctatatcgtaggccatcgtc 213 |||||||||||||||||||| Sbjct: 204859 ctatatcgtaggccatcgtc 204840
>gb|AE003803.4| Drosophila melanogaster chromosome 2R, section 47 of 73 of the complete sequence Length = 290783 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 ctcctgcgcctgctgctgct 166 |||||||||||||||||||| Sbjct: 210409 ctcctgcgcctgctgctgct 210428
>emb|AL133445.4|CNS01DV1 Human chromosome 14 DNA sequence BAC R-1046B16 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 190946 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 ctgctgctgctgttgcctcc 175 |||||||||||||||||||| Sbjct: 168377 ctgctgctgctgttgcctcc 168396
>gb|AC132123.3| Mus musculus BAC clone RP24-79F8 from 1, complete sequence Length = 214923 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 106 tgcccgccgccgcccggcat 125 |||||||||||||||||||| Sbjct: 19657 tgcccgccgccgcccggcat 19676
>gb|U49120.1|DMU49120 Drosophila melanogaster Y-box protein, ypsilon schachtel (yps) mRNA, complete cds Length = 1870 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 150 ctgcgcctgctgctgctgtt 169 |||||||||||||||||||| Sbjct: 269 ctgcgcctgctgctgctgtt 250
>dbj|AP006112.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT45P14, TM0196b, complete sequence Length = 25928 Score = 40.1 bits (20), Expect = 7.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 211 gtctcctcgcactcgtctagctccatgtctgt 242 ||||| || |||||||| |||||||||||||| Sbjct: 25795 gtctcttcacactcgtccagctccatgtctgt 25826
>gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome II, complete sequence Length = 867699 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 443 gcagctgtctgccatccaaa 462 |||||||||||||||||||| Sbjct: 79031 gcagctgtctgccatccaaa 79050
>gb|DQ138884.1| Drosophila melanogaster strain Ral1 CG5669 gene, partial cds Length = 2868 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tgcgcctgctgctgctgttg 170 |||||||||||||||||||| Sbjct: 1178 tgcgcctgctgctgctgttg 1159
>emb|AL355837.6|CNS05TCR Human chromosome 14 DNA sequence BAC C-2216L1 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 120724 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 ctgctgctgctgttgcctcc 175 |||||||||||||||||||| Sbjct: 113057 ctgctgctgctgttgcctcc 113038
>dbj|AP004318.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-77K9, complete sequence Length = 128885 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 ggcgcactgcaccctctgcc 109 |||||||||||||||||||| Sbjct: 61178 ggcgcactgcaccctctgcc 61197 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,834,066 Number of Sequences: 3902068 Number of extensions: 4834066 Number of successful extensions: 141202 Number of sequences better than 10.0: 210 Number of HSP's better than 10.0 without gapping: 212 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 139875 Number of HSP's gapped (non-prelim): 1278 length of query: 568 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 545 effective length of database: 17,143,297,704 effective search space: 9343097248680 effective search space used: 9343097248680 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
