ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags11j04 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_188655.1| Oryza sativa (japonica cultivar-group), Ozsa8258 predicted mRNA Length = 537 Score = 167 bits (84), Expect = 5e-38 Identities = 174/204 (85%) Strand = Plus / Minus Query: 237 tcgtccatgctctgaccgtagcgccggtaccgaccgccggaggcgacgaaacccgggcac 296 |||||||||||||| || | | ||||||||| ||||||||||||||||| || |||||| Sbjct: 464 tcgtccatgctctgcccctgcctccggtaccggccgccggaggcgacgaagccggggcac 405 Query: 297 ggccggtaggccttgatcggccaccacccgaacaaggggacggcggctatgccgcccatg 356 |||||||| |||||||| |||||||||||||| |||||||| ||||||||||||| | Sbjct: 404 ggccggtacgccttgataggccaccacccgaagccggggacggtggctatgccgccctgg 345 Query: 357 atccgtccttcgccgttgcagcccctctctggttcctcacggccgcaccccttgcaaccc 416 ||||| || ||||||||||| |||||||| ||||| || |||||||| |||| ||| Sbjct: 344 atccgcccctcgccgttgcaacccctctccacctcctcccgcccgcaccctctgcatccc 285 Query: 417 ctgaagttagggtcatccttgtag 440 |||||||| ||||||||| ||||| Sbjct: 284 ctgaagttggggtcatccctgtag 261
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 145 bits (73), Expect = 2e-31 Identities = 130/149 (87%) Strand = Plus / Minus Query: 237 tcgtccatgctctgaccgtagcgccggtaccgaccgccggaggcgacgaaacccgggcac 296 |||||||||||||| || | | ||||||||| ||||||||||||||||| || |||||| Sbjct: 7458005 tcgtccatgctctgcccctgcctccggtaccggccgccggaggcgacgaagccggggcac 7457946 Query: 297 ggccggtaggccttgatcggccaccacccgaacaaggggacggcggctatgccgcccatg 356 |||||||| |||||||| |||||||||||||| |||||||| ||||||||||||| | Sbjct: 7457945 ggccggtacgccttgataggccaccacccgaagccggggacggtggctatgccgccctgg 7457886 Query: 357 atccgtccttcgccgttgcagcccctctc 385 ||||| || ||||||||||| |||||||| Sbjct: 7457885 atccgcccctcgccgttgcaacccctctc 7457857
>dbj|AP002481.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0702F03 Length = 141111 Score = 145 bits (73), Expect = 2e-31 Identities = 130/149 (87%) Strand = Plus / Minus Query: 237 tcgtccatgctctgaccgtagcgccggtaccgaccgccggaggcgacgaaacccgggcac 296 |||||||||||||| || | | ||||||||| ||||||||||||||||| || |||||| Sbjct: 119033 tcgtccatgctctgcccctgcctccggtaccggccgccggaggcgacgaagccggggcac 118974 Query: 297 ggccggtaggccttgatcggccaccacccgaacaaggggacggcggctatgccgcccatg 356 |||||||| |||||||| |||||||||||||| |||||||| ||||||||||||| | Sbjct: 118973 ggccggtacgccttgataggccaccacccgaagccggggacggtggctatgccgccctgg 118914 Query: 357 atccgtccttcgccgttgcagcccctctc 385 ||||| || ||||||||||| |||||||| Sbjct: 118913 atccgcccctcgccgttgcaacccctctc 118885
>dbj|AP001539.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0708G02 Length = 168976 Score = 145 bits (73), Expect = 2e-31 Identities = 130/149 (87%) Strand = Plus / Minus Query: 237 tcgtccatgctctgaccgtagcgccggtaccgaccgccggaggcgacgaaacccgggcac 296 |||||||||||||| || | | ||||||||| ||||||||||||||||| || |||||| Sbjct: 6797 tcgtccatgctctgcccctgcctccggtaccggccgccggaggcgacgaagccggggcac 6738 Query: 297 ggccggtaggccttgatcggccaccacccgaacaaggggacggcggctatgccgcccatg 356 |||||||| |||||||| |||||||||||||| |||||||| ||||||||||||| | Sbjct: 6737 ggccggtacgccttgataggccaccacccgaagccggggacggtggctatgccgccctgg 6678 Query: 357 atccgtccttcgccgttgcagcccctctc 385 ||||| || ||||||||||| |||||||| Sbjct: 6677 atccgcccctcgccgttgcaacccctctc 6649
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome Length = 6438405 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 569 cggcgcgtgcttcctgtgcagc 590 |||||||||||||||||||||| Sbjct: 3052438 cggcgcgtgcttcctgtgcagc 3052459
>ref|XM_315444.2| Anopheles gambiae str. PEST ENSANGP00000014065 (ENSANGG00000011576), partial mRNA Length = 2181 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 455 tgccggagttggagcggctgctgctg 480 |||||||| ||||||||||||||||| Sbjct: 602 tgccggagctggagcggctgctgctg 627
>emb|BX470115.19| Zebrafish DNA sequence from clone CH211-234C11 in linkage group 23, complete sequence Length = 185756 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Plus Query: 506 ggaggaagttgaggacgaggagctaccagatga 538 |||||||||||| |||||||| |||| |||||| Sbjct: 153386 ggaggaagttgatgacgaggatctacaagatga 153418
>ref|XM_724507.1| Plasmodium yoelii yoelii str. 17XNL high molecular weight rhoptry protein 3 (PY01798) partial mRNA Length = 1204 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 2 gttttacttctattattagat 22 ||||||||||||||||||||| Sbjct: 993 gttttacttctattattagat 973
>ref|XM_721865.1| Plasmodium yoelii yoelii str. 17XNL high molecular weight rhoptry protein 3 (PY06325) partial mRNA Length = 2529 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 2 gttttacttctattattagat 22 ||||||||||||||||||||| Sbjct: 2438 gttttacttctattattagat 2418
>emb|BX957234.7| Zebrafish DNA sequence from clone CH211-286L10 in linkage group 23, complete sequence Length = 180834 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Plus Query: 506 ggaggaagttgaggacgaggagctaccagatga 538 |||||||||||| |||||||| |||| |||||| Sbjct: 18910 ggaggaagttgatgacgaggatctacaagatga 18942
>emb|AL356583.28| Human DNA sequence from clone RP11-690C23 on chromosome 1 Contains the 5' end of the SMYD3 gene for SET and MYND domain containing 3, an ubiquitin specific protease 6 (Tre-2 oncogene) (USP6) pseudogene, a novel gene, a pseudogene similar to part of tumor necrosis factor receptor superfamily member 13B (TNFRSF13B), a pseudogene similar to part of carboxypeptidase D (CPD), the TFB2M gene for mitochondrial transcription factor B2, the 5' end of the gene for a novel protein (FLJ32001, DKFZp451A152, DKFZp451B077, FLJ00215) and two CpG islands, complete sequence Length = 207486 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 165 gaggttgaggtggatcatttg 185 ||||||||||||||||||||| Sbjct: 199530 gaggttgaggtggatcatttg 199510
>emb|AL669869.10| Mouse DNA sequence from clone RP23-198E14 on chromosome 11 Contains the 3' end of the Mgl2 gene for macrophage galactose N-acetyl-galactosamine specific lectin 2, the Mgl1 gene for macrophage galactose N-acetyl-galactosamine specific lectin 1, the gene for a novel RNA polymerase Rpb1 C-terminal repeat domain containing protein, three novel genes, the Bcl6b gene for B-cell CLL/lymphoma 6 member B, the Alox12 gene for arachidonate 12-lipoxygenase and four CpG islands, complete sequence Length = 174390 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 aaacaaaatctatgaaggttg 133 ||||||||||||||||||||| Sbjct: 53796 aaacaaaatctatgaaggttg 53816
>emb|CR933731.5| Mouse DNA sequence from clone DN-160I24 on chromosome 11, complete sequence Length = 212982 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 aaacaaaatctatgaaggttg 133 ||||||||||||||||||||| Sbjct: 33814 aaacaaaatctatgaaggttg 33834
>emb|CR749167.8| Zebrafish DNA sequence from clone DKEY-23A17 in linkage group 5, complete sequence Length = 155288 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Plus Query: 506 ggaggaagttgaggacgaggagctaccagatga 538 |||||||||||| |||||||| |||| |||||| Sbjct: 123978 ggaggaagttgatgacgaggatctacaagatga 124010
>gb|AF146528.1|AF146528 Plasmodium yoelii rhoptry complex polypeptide Rhop-3 mRNA, partial cds Length = 586 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 2 gttttacttctattattagat 22 ||||||||||||||||||||| Sbjct: 214 gttttacttctattattagat 194
>dbj|AP001823.5| Homo sapiens genomic DNA, chromosome 11 clone:CTD-2355J17, complete sequence Length = 178189 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 162 cttgaggttgaggtggatcat 182 ||||||||||||||||||||| Sbjct: 126183 cttgaggttgaggtggatcat 126203
>dbj|AP000889.6| Homo sapiens genomic DNA, chromosome 11 clone:CMB9-101M8, complete sequence Length = 163047 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 162 cttgaggttgaggtggatcat 182 ||||||||||||||||||||| Sbjct: 29049 cttgaggttgaggtggatcat 29069
>dbj|AB044564.1| Plasmodium yoelii PyRhopH3 mRNA for high molecular weight rhoptry protein 3, complete cds Length = 2649 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 2 gttttacttctattattagat 22 ||||||||||||||||||||| Sbjct: 2438 gttttacttctattattagat 2418
>dbj|AB044563.1| Plasmodium yoelii PyRhopH3 gene for high molecular weight rhoptry protein 3, complete cds Length = 4018 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 2 gttttacttctattattagat 22 ||||||||||||||||||||| Sbjct: 3677 gttttacttctattattagat 3657
>gb|AC121147.8| Mus musculus chromosome 3, clone RP24-369O15, complete sequence Length = 178352 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 470 ggctgctgctgccccctctt 489 |||||||||||||||||||| Sbjct: 145634 ggctgctgctgccccctctt 145615
>gb|AC116776.12| Mus musculus chromosome 3, clone RP24-472H5, complete sequence Length = 170076 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 470 ggctgctgctgccccctctt 489 |||||||||||||||||||| Sbjct: 113694 ggctgctgctgccccctctt 113713
>gb|AC146109.3| Pan troglodytes BAC clone RP43-22H22 from 7, complete sequence Length = 164618 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 526 agctaccagatgagctgcag 545 |||||||||||||||||||| Sbjct: 73119 agctaccagatgagctgcag 73100
>ref|XM_744509.1| Aspergillus fumigatus Af293 RNA binding effector protein Scp160 (Afu2g04700) partial mRNA Length = 3933 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 569 cggcgcgtgcttcctgtgcagcag 592 ||||||| |||||||||||||||| Sbjct: 1147 cggcgcgggcttcctgtgcagcag 1124
>gb|AC074121.16| Homo sapiens BAC clone RP11-725M1 from 7, complete sequence Length = 166379 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 526 agctaccagatgagctgcag 545 |||||||||||||||||||| Sbjct: 50932 agctaccagatgagctgcag 50913
>emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chromosome 1 Contains part of the PLXNA2 gene for plexin A2, complete sequence Length = 164057 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 160 tccttgaggttgaggtggat 179 |||||||||||||||||||| Sbjct: 1644 tccttgaggttgaggtggat 1663
>emb|AL356275.20| Human DNA sequence from clone RP11-328D5 on chromosome 1 Contains the 5' end of a novel gene, a novel gene, the CD34 gene for CD34 antigen and the 3' end of the PLXNA2 gene for plexin A2, complete sequence Length = 198906 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 160 tccttgaggttgaggtggat 179 |||||||||||||||||||| Sbjct: 198550 tccttgaggttgaggtggat 198569
>emb|AL078594.36|HSDJ293L8 Human DNA sequence from clone RP1-293L8 on chromosome 6q22.2-22.33 Contains the 3' part of a novel gene, the 5' part of a novel gene, the HEY2 gene for hairy/enhancer-of-split related with YRPW motif 2, a novel gene, the 5' part of the gene for endoplasmic reticulum associated protein 140 kDa (ERAP140) (similar to nucleolar protein C7B) and four putative CpG islands, complete sequence Length = 164808 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 143 ctccagcacactgcagttccttga 166 ||||| |||||||||||||||||| Sbjct: 126895 ctccaacacactgcagttccttga 126872
>emb|AL939115.1|SCO939115 Streptomyces coelicolor A3(2) complete genome; segment 12/29 Length = 276800 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tggagcggctgctgctgccc 483 |||||||||||||||||||| Sbjct: 69544 tggagcggctgctgctgccc 69525
>gb|AF418138.1|AF418138 Syntrophobacter fumaroxidans DSM 10017 adenosine-5'-phosphosulfate reductase alpha subunit (apsA) gene, partial cds Length = 866 Score = 40.1 bits (20), Expect = 8.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 219 cccttgccggctatgacgtcgtccatgc 246 ||||||||||| |||||||| ||||||| Sbjct: 767 cccttgccggccatgacgtcttccatgc 740
>gb|AC025188.8| Homo sapiens chromosome 5 clone CTD-2384B11, complete sequence Length = 143335 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 541 tgcaggcaagattgcctctg 560 |||||||||||||||||||| Sbjct: 16451 tgcaggcaagattgcctctg 16470
>gb|AC016165.11| Homo sapiens chromosome 18, clone RP11-450M22, complete sequence Length = 166511 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 182 tttgtcacttttcttcttct 201 |||||||||||||||||||| Sbjct: 27386 tttgtcacttttcttcttct 27405
>gb|AC026706.5|AC026706 Homo sapiens chromosome 5 clone CTD-2068N7, complete sequence Length = 131370 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 541 tgcaggcaagattgcctctg 560 |||||||||||||||||||| Sbjct: 3976 tgcaggcaagattgcctctg 3957
>gb|AC010365.5|AC010365 Homo sapiens chromosome 19 clone CTD-2043I16, complete sequence Length = 106146 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 12 tattattagatttagcaagc 31 |||||||||||||||||||| Sbjct: 22031 tattattagatttagcaagc 22050
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 tacttctattattagattta 25 |||||||||||||||||||| Sbjct: 20750252 tacttctattattagattta 20750271
>gb|AC006305.3| Homo sapiens chromosome 18, clone RP11-456O19, complete sequence Length = 178261 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tttgtcacttttcttcttct 201 |||||||||||||||||||| Sbjct: 47467 tttgtcacttttcttcttct 47448
>gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence Length = 268433 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 505 cggaggaagttgaggacgag 524 |||||||||||||||||||| Sbjct: 2461 cggaggaagttgaggacgag 2442
>dbj|AP004674.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0681F05 Length = 144741 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 tacttctattattagattta 25 |||||||||||||||||||| Sbjct: 103002 tacttctattattagattta 103021
>emb|AL805978.10| Mouse DNA sequence from clone RP23-344I3 on chromosome X, complete sequence Length = 190744 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 3 ttttacttctattattagatttag 26 |||| ||||||||||||||||||| Sbjct: 187431 tttttcttctattattagatttag 187408
>gb|AC154356.2| Mus musculus BAC clone RP23-189C20 from 13, complete sequence Length = 201031 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 172 aggtggatcatttgtcacttttct 195 |||||||||||| ||||||||||| Sbjct: 84397 aggtggatcattcgtcacttttct 84374
>tpe|BN000633.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-group) prx104 gene for class III peroxidase 104 precursor, exons 1-4 Length = 1853 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 tacttctattattagattta 25 |||||||||||||||||||| Sbjct: 439 tacttctattattagattta 458 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,057,416 Number of Sequences: 3902068 Number of extensions: 5057416 Number of successful extensions: 103054 Number of sequences better than 10.0: 40 Number of HSP's better than 10.0 without gapping: 40 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 102876 Number of HSP's gapped (non-prelim): 177 length of query: 594 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 571 effective length of database: 17,143,297,704 effective search space: 9788822988984 effective search space used: 9788822988984 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
