| Clone Name | rbags11i05 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|AF307145.1| Hordeum vulgare subsp. vulgare glutamine-dependen... | 135 | 3e-29 | 2 | gb|AY621539.1| Triticum aestivum glutamine-dependent asparagine ... | 127 | 6e-27 | 3 | gb|BT009245.1| Triticum aestivum clone wlk1.pk0018.d4:fis, full ... | 119 | 2e-24 | 4 | ref|XM_798433.1| Trypanosoma brucei TREU927 hypothetical protein... | 38 | 4.4 | 5 | emb|BX119920.7| Zebrafish DNA sequence from clone CH211-46O21 in... | 38 | 4.4 |
|---|
>gb|AF307145.1| Hordeum vulgare subsp. vulgare glutamine-dependent asparagine synthetase 1 mRNA, complete cds Length = 1973 Score = 135 bits (68), Expect = 3e-29 Identities = 93/100 (93%), Gaps = 2/100 (2%) Strand = Plus / Minus Query: 1 ggacaggacaccatcaactactcaattgcagacaccaggngccgnaaccttgatcatcct 60 ||||||||||||||||||| ||||||||| ||||||||| |||| ||||||||||||||| Sbjct: 1842 ggacaggacaccatcaact-ctcaattgc-gacaccaggtgccgcaaccttgatcatcct 1785 Query: 61 cggcttcttgctggtncctgncatgatggatgctgggaga 100 ||||||||||||||| |||| |||||||| |||||||||| Sbjct: 1784 cggcttcttgctggttcctgccatgatggttgctgggaga 1745
>gb|AY621539.1| Triticum aestivum glutamine-dependent asparagine synthetase (ASN1) mRNA, complete cds Length = 1815 Score = 127 bits (64), Expect = 6e-27 Identities = 92/100 (92%), Gaps = 2/100 (2%) Strand = Plus / Minus Query: 1 ggacaggacaccatcaactactcaattgcagacaccaggngccgnaaccttgatcatcct 60 ||||||||||||||||||| ||||||||| ||||||||| |||| ||||| ||||||||| Sbjct: 1792 ggacaggacaccatcaact-ctcaattgc-gacaccaggcgccgcaacctcgatcatcct 1735 Query: 61 cggcttcttgctggtncctgncatgatggatgctgggaga 100 ||||||||||||||| |||| |||||||| |||||||||| Sbjct: 1734 cggcttcttgctggttcctgccatgatggttgctgggaga 1695
>gb|BT009245.1| Triticum aestivum clone wlk1.pk0018.d4:fis, full insert mRNA sequence Length = 2064 Score = 119 bits (60), Expect = 2e-24 Identities = 91/100 (91%), Gaps = 2/100 (2%) Strand = Plus / Minus Query: 1 ggacaggacaccatcaactactcaattgcagacaccaggngccgnaaccttgatcatcct 60 ||||||||||||||||||| ||||||||| ||||||||| |||| ||||| ||||||||| Sbjct: 1826 ggacaggacaccatcaact-ctcaattgc-gacaccaggcgccgcaacctcgatcatcct 1769 Query: 61 cggcttcttgctggtncctgncatgatggatgctgggaga 100 |||||||||||||| |||| |||||||| |||||||||| Sbjct: 1768 tggcttcttgctggttcctgccatgatggttgctgggaga 1729
>ref|XM_798433.1| Trypanosoma brucei TREU927 hypothetical protein (Tb09.160.0920) partial mRNA Length = 4278 Score = 38.2 bits (19), Expect = 4.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 3 acaggacaccatcaactac 21 ||||||||||||||||||| Sbjct: 583 acaggacaccatcaactac 565
>emb|BX119920.7| Zebrafish DNA sequence from clone CH211-46O21 in linkage group 15, complete sequence Length = 123713 Score = 38.2 bits (19), Expect = 4.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 10 accatcaactactcaattg 28 ||||||||||||||||||| Sbjct: 12707 accatcaactactcaattg 12689 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 581,641 Number of Sequences: 3902068 Number of extensions: 581641 Number of successful extensions: 35265 Number of sequences better than 10.0: 5 Number of HSP's better than 10.0 without gapping: 5 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 35256 Number of HSP's gapped (non-prelim): 6 length of query: 100 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 79 effective length of database: 17,151,101,840 effective search space: 1354937045360 effective search space used: 1354937045360 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)