ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags11i05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF307145.1| Hordeum vulgare subsp. vulgare glutamine-dependen... 135 3e-29
2gb|AY621539.1| Triticum aestivum glutamine-dependent asparagine ... 127 6e-27
3gb|BT009245.1| Triticum aestivum clone wlk1.pk0018.d4:fis, full ... 119 2e-24
4ref|XM_798433.1| Trypanosoma brucei TREU927 hypothetical protein... 38 4.4
5emb|BX119920.7| Zebrafish DNA sequence from clone CH211-46O21 in... 38 4.4

>gb|AF307145.1| Hordeum vulgare subsp. vulgare glutamine-dependent asparagine
            synthetase 1 mRNA, complete cds
          Length = 1973

 Score =  135 bits (68), Expect = 3e-29
 Identities = 93/100 (93%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                        
Query: 1    ggacaggacaccatcaactactcaattgcagacaccaggngccgnaaccttgatcatcct 60
            ||||||||||||||||||| ||||||||| ||||||||| |||| |||||||||||||||
Sbjct: 1842 ggacaggacaccatcaact-ctcaattgc-gacaccaggtgccgcaaccttgatcatcct 1785

                                                    
Query: 61   cggcttcttgctggtncctgncatgatggatgctgggaga 100
            ||||||||||||||| |||| |||||||| ||||||||||
Sbjct: 1784 cggcttcttgctggttcctgccatgatggttgctgggaga 1745



to top

>gb|AY621539.1| Triticum aestivum glutamine-dependent asparagine synthetase (ASN1)
            mRNA, complete cds
          Length = 1815

 Score =  127 bits (64), Expect = 6e-27
 Identities = 92/100 (92%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                        
Query: 1    ggacaggacaccatcaactactcaattgcagacaccaggngccgnaaccttgatcatcct 60
            ||||||||||||||||||| ||||||||| ||||||||| |||| ||||| |||||||||
Sbjct: 1792 ggacaggacaccatcaact-ctcaattgc-gacaccaggcgccgcaacctcgatcatcct 1735

                                                    
Query: 61   cggcttcttgctggtncctgncatgatggatgctgggaga 100
            ||||||||||||||| |||| |||||||| ||||||||||
Sbjct: 1734 cggcttcttgctggttcctgccatgatggttgctgggaga 1695



to top

>gb|BT009245.1| Triticum aestivum clone wlk1.pk0018.d4:fis, full insert mRNA sequence
          Length = 2064

 Score =  119 bits (60), Expect = 2e-24
 Identities = 91/100 (91%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                        
Query: 1    ggacaggacaccatcaactactcaattgcagacaccaggngccgnaaccttgatcatcct 60
            ||||||||||||||||||| ||||||||| ||||||||| |||| ||||| |||||||||
Sbjct: 1826 ggacaggacaccatcaact-ctcaattgc-gacaccaggcgccgcaacctcgatcatcct 1769

                                                    
Query: 61   cggcttcttgctggtncctgncatgatggatgctgggaga 100
             |||||||||||||| |||| |||||||| ||||||||||
Sbjct: 1768 tggcttcttgctggttcctgccatgatggttgctgggaga 1729



to top

>ref|XM_798433.1| Trypanosoma brucei TREU927 hypothetical protein (Tb09.160.0920)
           partial mRNA
          Length = 4278

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 3   acaggacaccatcaactac 21
           |||||||||||||||||||
Sbjct: 583 acaggacaccatcaactac 565



to top

>emb|BX119920.7| Zebrafish DNA sequence from clone CH211-46O21 in linkage group 15,
             complete sequence
          Length = 123713

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    accatcaactactcaattg 28
             |||||||||||||||||||
Sbjct: 12707 accatcaactactcaattg 12689


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 581,641
Number of Sequences: 3902068
Number of extensions: 581641
Number of successful extensions: 35265
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35256
Number of HSP's gapped (non-prelim): 6
length of query: 100
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 79
effective length of database: 17,151,101,840
effective search space: 1354937045360
effective search space used: 1354937045360
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top