ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags11g08 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ538931.1|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT21-M1-005 Length = 332 Score = 63.9 bits (32), Expect = 4e-08 Identities = 49/55 (89%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || ||||||||| |||||||| | ||| |||||||| Sbjct: 74 cttggcaagcccaaatggccaaaatgctttgtgcgtggaccaaacttgggttgcc 20
>emb|AJ538840.1|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT2-M11-016 Length = 315 Score = 63.9 bits (32), Expect = 4e-08 Identities = 49/55 (89%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || ||||||||| |||||||| | ||| |||||||| Sbjct: 57 cttggcaagcccaaatggccaaaatgctttgtgcgtggaccaaacttgggttgcc 3
>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R Length = 1173 Score = 56.0 bits (28), Expect = 9e-06 Identities = 48/55 (87%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || |||||||| |||||||| | ||| |||||||| Sbjct: 729 cttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgcc 675
>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein Length = 1080 Score = 56.0 bits (28), Expect = 9e-06 Identities = 48/55 (87%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || |||||||| |||||||| | ||| |||||||| Sbjct: 562 cttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgcc 508
>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein Length = 1025 Score = 56.0 bits (28), Expect = 9e-06 Identities = 48/55 (87%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || |||||||| |||||||| | ||| |||||||| Sbjct: 554 cttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgcc 500
>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds Length = 1815 Score = 56.0 bits (28), Expect = 9e-06 Identities = 48/55 (87%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || |||||||| |||||||| | ||| |||||||| Sbjct: 1474 cttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgcc 1420
>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3386 Score = 56.0 bits (28), Expect = 9e-06 Identities = 48/55 (87%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || ||||||||| || ||||| | ||| |||||||| Sbjct: 1949 cttggcaagcccaaatggccaaaatgctttgtgcatggaccaaacttgggttgcc 1895
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 50.1 bits (25), Expect = 6e-04 Identities = 48/56 (85%) Strand = Plus / Minus Query: 3 tggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgccgag 58 |||||||||||||||| || ||||| || || |||||||| || ||||||||||| Sbjct: 512 tggcaagcccaaatggcaaggatgctctgagcatggacgaggcttgggttgccgag 457
>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 50.1 bits (25), Expect = 6e-04 Identities = 36/40 (90%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggac 40 |||||||||||||||||| ||| |||||||| || ||||| Sbjct: 493 cttggcaagcccaaatggccaggatgctttgtgcatggac 454
>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 40 mRNA, complete cds Length = 859 Score = 48.1 bits (24), Expect = 0.002 Identities = 41/47 (87%) Strand = Plus / Minus Query: 9 gcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 ||||| |||| ||| ||||| |||||||||||||| || |||||||| Sbjct: 542 gcccagatggccaggatgctctgcgcgtggacgaggctggggttgcc 496
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 48.1 bits (24), Expect = 0.002 Identities = 41/47 (87%) Strand = Plus / Minus Query: 9 gcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 ||||| |||| ||| ||||| |||||||||||||| || |||||||| Sbjct: 159 gcccagatggccaggatgctctgcgcgtggacgaggctggggttgcc 113
>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein (CAB) mRNA, partial cds Length = 720 Score = 48.1 bits (24), Expect = 0.002 Identities = 41/47 (87%) Strand = Plus / Minus Query: 9 gcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 ||||| |||| ||||||||| || |||||||| || ||||||||||| Sbjct: 526 gcccatatggccagaatgctctgtgcgtggaccaggctagggttgcc 480
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 48.1 bits (24), Expect = 0.002 Identities = 41/47 (87%) Strand = Plus / Minus Query: 9 gcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 ||||| |||| ||||||||| || |||||||| || ||||||||||| Sbjct: 361 gcccatatggccagaatgctctgtgcgtggaccaggctagggttgcc 315
>emb|AJ538915.1|NTA538915 Nicotiana tabacum cDNA-AFLP-fragment BT2-M42-024 Length = 212 Score = 48.1 bits (24), Expect = 0.002 Identities = 47/55 (85%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || |||||||| || ||||| | ||| |||||||| Sbjct: 58 cttggcaagcccaaatggccaagatgctttgtgcatggaccaaacttgggttgcc 4
>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R Length = 1187 Score = 48.1 bits (24), Expect = 0.002 Identities = 47/55 (85%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || |||||||| ||||| || | ||| |||||||| Sbjct: 729 cttggcaagcccaaatggccaagatgctttgtgcgtgaaccaaacttgggttgcc 675
>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L Length = 1187 Score = 48.1 bits (24), Expect = 0.002 Identities = 47/55 (85%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 ||||||||||||| |||| || |||||||| |||||||| | ||| |||||||| Sbjct: 729 cttggcaagcccagatggccaagatgctttgtgcgtggaccaaacttgggttgcc 675
>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein Length = 1656 Score = 48.1 bits (24), Expect = 0.002 Identities = 47/55 (85%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || |||||||| || ||||| | ||| |||||||| Sbjct: 1000 cttggcaagcccaaatggccaagatgctttgtgcatggaccaaacttgggttgcc 946
>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein Length = 964 Score = 48.1 bits (24), Expect = 0.002 Identities = 47/55 (85%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || |||||||| ||||| || | ||| |||||||| Sbjct: 566 cttggcaagcccaaatggccaagatgctttgtgcgtgaaccaaacttgggttgcc 512
>gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding protein (Cab) clone pCab146, 3' end and flank Length = 498 Score = 48.1 bits (24), Expect = 0.002 Identities = 47/55 (85%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || |||||||| ||||| || | ||| |||||||| Sbjct: 73 cttggcaagcccaaatggccaagatgctttgtgcgtgaaccaaacttgggttgcc 19
>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3102 Score = 48.1 bits (24), Expect = 0.002 Identities = 47/55 (85%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||||| || |||||||| || ||||| | ||| |||||||| Sbjct: 2403 cttggcaagcccaaatggccaagatgctttgtgcatggaccaaacttgggttgcc 2349
>dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3663 Score = 48.1 bits (24), Expect = 0.002 Identities = 47/55 (85%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||| | || |||||||| |||||||| | ||| |||||||| Sbjct: 3044 cttggcaagcccaaattgccaagatgctttgtgcgtggaccaaacttgggttgcc 2990
>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7299 Score = 48.1 bits (24), Expect = 0.002 Identities = 47/55 (85%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 ||||||||||||| |||| | ||||||||| |||||||| | ||| |||||||| Sbjct: 4858 cttggcaagcccagatggctaaaatgctttgtgcgtggaccaaacttgggttgcc 4804 Score = 40.1 bits (20), Expect = 0.55 Identities = 46/55 (83%) Strand = Plus / Plus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||||| | || |||||||| ||||| || | ||| |||||||| Sbjct: 2175 cttggcaagcccaaatagccaagatgctttgtgcgtgaaccaaacttgggttgcc 2229
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 42.1 bits (21), Expect = 0.14 Identities = 47/56 (83%) Strand = Plus / Minus Query: 3 tggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgccgag 58 ||||| ||||| |||| || ||||| ||||||||||| || || ||||||||||| Sbjct: 557 tggcaggcccagatggcgaggatgctctgcgcgtggaccaggctggggttgccgag 502
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 42.1 bits (21), Expect = 0.14 Identities = 47/56 (83%) Strand = Plus / Minus Query: 3 tggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgccgag 58 |||||| ||||||| | ||| ||||| |||||||||| || || ||||||||||| Sbjct: 533 tggcaaccccaaatcgccaggatgctctgcgcgtggatcaggctggggttgccgag 478
>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 42.1 bits (21), Expect = 0.14 Identities = 35/40 (87%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggac 40 |||||||||||||||||| || |||||||| || ||||| Sbjct: 493 cttggcaagcccaaatggccaagatgctttgtgcatggac 454
>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein, partial cds Length = 878 Score = 42.1 bits (21), Expect = 0.14 Identities = 35/40 (87%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggac 40 ||||||||||||| |||| || |||||| || |||||||| Sbjct: 463 cttggcaagcccagatggccaaaatgctctgagcgtggac 424
>emb|AJ538493.1|NTA538493 Nicotiana tabacum cDNA-AFLP-fragment BC2-M31-012 Length = 321 Score = 40.1 bits (20), Expect = 0.55 Identities = 46/55 (83%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||| ||||||||||||| || |||||||| || ||||| | ||| |||||||| Sbjct: 73 cttgacaagcccaaatggccaatatgctttgtgcatggaccaaacttgggttgcc 19
>emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC2-M14-017 Length = 330 Score = 40.1 bits (20), Expect = 0.55 Identities = 46/55 (83%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||| ||||||||||||| || |||||||| || ||||| | ||| |||||||| Sbjct: 72 cttgacaagcccaaatggccaatatgctttgagcatggaccaaacttgggttgcc 18
>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13 Length = 1019 Score = 40.1 bits (20), Expect = 0.55 Identities = 46/55 (83%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 ||||||||||||| |||| || |||||||| ||||| || | ||| |||||||| Sbjct: 617 cttggcaagcccagatggccaagatgctttgtgcgtgaaccaaacttgggttgcc 563
>gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protein (Cab) clone pCab4, 3' end Length = 387 Score = 40.1 bits (20), Expect = 0.55 Identities = 46/55 (83%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||||||||||||| ||| || |||||||| ||||| || | ||| |||||||| Sbjct: 91 cttggcaagcccaactggccaagatgctttgtgcgtgaaccaaacttgggttgcc 37
>gb|K00973.1|PETCAB3 Petunia major chlorophyll a/b binding protein (Cab) clone pCab3, 3' end and flank Length = 511 Score = 40.1 bits (20), Expect = 0.55 Identities = 46/55 (83%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 ||||||||||||||| || || || ||||| ||||||| ||||| |||||||| Sbjct: 106 cttggcaagcccaaacggccaagatactttgtgcgtggatcagacttgggttgcc 52
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b binding protein (cab gene) Length = 760 Score = 40.1 bits (20), Expect = 0.55 Identities = 46/55 (83%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||| |||||||| |||| || ||||| || ||||||||||| || |||||||| Sbjct: 491 cttgacaagcccatatggcgaggatgctctgggcgtggacgaggctggggttgcc 437
>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end Length = 351 Score = 40.1 bits (20), Expect = 0.55 Identities = 28/31 (90%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttg 31 |||||||||||||||| | || ||||||||| Sbjct: 46 cttggcaagcccaaatagccaaaatgctttg 16
>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end Length = 351 Score = 40.1 bits (20), Expect = 0.55 Identities = 28/31 (90%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttg 31 |||||||||||||||| | || ||||||||| Sbjct: 46 cttggcaagcccaaatagccaaaatgctttg 16
>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end Length = 351 Score = 40.1 bits (20), Expect = 0.55 Identities = 28/31 (90%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttg 31 |||||||||||||||||| || |||||||| Sbjct: 46 cttggcaagcccaaatggccaagatgctttg 16
>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds Length = 1240 Score = 40.1 bits (20), Expect = 0.55 Identities = 46/55 (83%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 |||| ||||||||||||| || |||||||| || ||||| | ||| |||||||| Sbjct: 935 cttgacaagcccaaatggccaatatgctttgagcatggaccaaacttgggttgcc 881
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 40.1 bits (20), Expect = 0.55 Identities = 28/31 (90%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatggncagaatgctttg 31 ||||||||||||| |||| || ||||||||| Sbjct: 687 cttggcaagcccagatggccaaaatgctttg 657
>gb|DQ418483.1| Zingiber officinale chloroplast chlorophyll a/b-binding protein mRNA, partial cds; nuclear gene for chloroplast product Length = 393 Score = 38.2 bits (19), Expect = 2.2 Identities = 42/50 (84%) Strand = Plus / Minus Query: 9 gcccaaatggncagaatgctttgcgcgtggacgagactagggttgccgag 58 ||||| |||| ||| ||||| |||||||||| || || ||||||||||| Sbjct: 217 gcccatatggccaggatgctctgcgcgtggatcaggctggggttgccgag 168
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 38.2 bits (19), Expect = 2.2 Identities = 45/54 (83%) Strand = Plus / Minus Query: 3 tggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgccg 56 ||||| ||||| || | ||| ||||| ||||||||||| || || ||||||||| Sbjct: 2414 tggcacgcccagatagccaggatgctctgcgcgtggacaaggctcgggttgccg 2361
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 38.2 bits (19), Expect = 2.2 Identities = 33/38 (86%) Strand = Plus / Minus Query: 3 tggcaagcccaaatggncagaatgctttgcgcgtggac 40 ||||| ||||| |||| ||| ||||| ||||||||||| Sbjct: 668 tggcaggcccagatggccaggatgctctgcgcgtggac 631
>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial cds Length = 551 Score = 38.2 bits (19), Expect = 2.2 Identities = 33/38 (86%) Strand = Plus / Minus Query: 3 tggcaagcccaaatggncagaatgctttgcgcgtggac 40 ||||| ||||| |||| ||||||||||| |||||||| Sbjct: 89 tggcatgcccagatggcaagaatgctttgtgcgtggac 52
>ref|XM_364556.1| Magnaporthe grisea 70-15 hypothetical protein (MG09370.4) partial mRNA Length = 3558 Score = 36.2 bits (18), Expect = 8.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatgg 18 |||||||||||||||||| Sbjct: 1794 cttggcaagcccaaatgg 1777
>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA, complete cds Length = 927 Score = 36.2 bits (18), Expect = 8.6 Identities = 32/37 (86%) Strand = Plus / Minus Query: 3 tggcaagcccaaatggncagaatgctttgcgcgtgga 39 ||||||||||| || | || ||||||||| ||||||| Sbjct: 500 tggcaagcccagattgccaaaatgctttgagcgtgga 464
>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting chlorophyll a/b-binding protein 2, complete cds Length = 3125 Score = 36.2 bits (18), Expect = 8.6 Identities = 44/53 (83%) Strand = Plus / Minus Query: 3 tggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 ||||||||||| |||| ||| ||||| || ||||| || || || |||||||| Sbjct: 2717 tggcaagcccagatggccaggatgctctgagcgtgcacaaggctggggttgcc 2665
>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting chlorophyll a/b-binding protein 1, complete cds Length = 1975 Score = 36.2 bits (18), Expect = 8.6 Identities = 44/53 (83%) Strand = Plus / Minus Query: 3 tggcaagcccaaatggncagaatgctttgcgcgtggacgagactagggttgcc 55 ||||| ||||| |||| || |||||| || ||||| || || ||||||||||| Sbjct: 1545 tggcaggcccagatggccaaaatgctctgagcgtgcacaaggctagggttgcc 1493
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25 Length = 1184 Score = 36.2 bits (18), Expect = 8.6 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cttggcaagcccaaatgg 18 |||||||||||||||||| Sbjct: 726 cttggcaagcccaaatgg 709 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 167,813 Number of Sequences: 3902068 Number of extensions: 167813 Number of successful extensions: 7964 Number of sequences better than 10.0: 46 Number of HSP's better than 10.0 without gapping: 46 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 7916 Number of HSP's gapped (non-prelim): 48 length of query: 60 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 39 effective length of database: 17,151,101,840 effective search space: 668892971760 effective search space used: 668892971760 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)
