ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags11f24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CR376737.4| Zebrafish DNA sequence from clone CH211-14G13 in... 44 0.55
2emb|BX323842.8| Zebrafish DNA sequence from clone CH211-1M7, com... 44 0.55
3gb|AC129326.3| Mus musculus BAC clone RP23-326H12 from chromosom... 42 2.2
4gb|AY363618.1| Malus baccata putative TIR-NBS type R protein 4 (... 42 2.2
5gb|AY363616.1| Malus baccata putative TIR-NBS type R protein 4 (... 42 2.2
6gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, com... 42 2.2
7emb|AL391476.20| Human DNA sequence from clone RP11-229A19 on ch... 42 2.2
8gb|AC155294.2| Mus musculus BAC clone RP24-328F24 from chromosom... 42 2.2
9gb|AC005184.1| Homo sapiens Xp22 bins 45-47 BAC GSHB-665N22 (Gen... 42 2.2
10gb|DP000004.1| Lemur catta target 1 genomic scaffold 42 2.2
11gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold 42 2.2
12gb|AC123970.3| Lemur catta clone LB2-159J16, complete sequence 42 2.2
13gb|AC153890.8| Mus musculus BAC RP23-403C13 (Roswell Park Cance... 42 2.2
14emb|AL663098.8| Mouse DNA sequence from clone RP23-24L23 on chro... 42 2.2
15gb|AC148517.3| Felis catus clone RP86-202K10, complete sequence 40 8.5
16gb|AC109239.8| Mus musculus chromosome 3, clone RP23-191N23, com... 40 8.5
17gb|AC111122.13| Mus musculus chromosome 7, clone RP23-230L8, com... 40 8.5
18gb|AC115742.13| Mus musculus chromosome 7, clone RP23-477E13, co... 40 8.5
19emb|CR388042.8| Zebrafish DNA sequence from clone CH211-254C12 i... 40 8.5
20ref|XM_387760.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 40 8.5
21gb|AC145330.19| Medicago truncatula clone mth2-17l1, complete se... 40 8.5
22gb|AC146329.19| Medicago truncatula clone mth2-5i21, complete se... 40 8.5
23emb|CR589881.11| Zebrafish DNA sequence from clone DKEY-188M1 in... 40 8.5
24emb|AL157396.9| Human DNA sequence from clone RP11-437J2 on chro... 40 8.5
25emb|AL138758.7| Human DNA sequence from clone RP5-824O18 on chro... 40 8.5
26emb|AL161556.2|ATCHRIV56 Arabidopsis thaliana DNA chromosome 4, ... 40 8.5
27emb|AL022140.1|ATF1N20 Arabidopsis thaliana DNA chromosome 4, BA... 40 8.5
28emb|AL021890.1|ATT8O5 Arabidopsis thaliana DNA chromosome 4, BAC... 40 8.5
29gb|AC162913.3| Mus musculus BAC clone RP24-409P22 from chromosom... 40 8.5
30gb|AC099325.4| Oryza sativa chromosome 10 BAC OSJNBb0048O22 geno... 40 8.5
31gb|AC099040.10| Oryza sativa chromosome 10 BAC OSJNBa0004P12 gen... 40 8.5
32gb|AC068896.9| Homo sapiens chromosome 10 clone RP11-464O2, comp... 40 8.5
33gb|AC182811.1| Gasterosteus aculeatus clone VMRC28-119K14, compl... 40 8.5
34gb|AC093117.2| Homo sapiens chromosome 1 clone RP11-86H7, comple... 40 8.5
35ref|XM_687464.1| PREDICTED: Danio rerio similar to 26S proteasom... 40 8.5
36gb|AC160338.2| Mus musculus BAC clone RP23-261O3 from chromosome... 40 8.5
37dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.5
38ref|NM_001017624.1| Danio rerio proteasome (prosome, macropain) ... 40 8.5
39emb|BX255877.14| Zebrafish DNA sequence from clone CH211-254C9, ... 40 8.5
40emb|BX276083.4| Zebrafish DNA sequence from clone CH211-165N1 in... 40 8.5
41dbj|AK103839.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.5
42gb|AC024558.21| Homo sapiens 3 BAC RP11-390G14 (Roswell Park Can... 40 8.5
43gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 8.5
44gb|BC092825.1| Danio rerio proteasome (prosome, macropain) 26S s... 40 8.5
45gb|AC132471.4| Mus musculus BAC clone RP23-106E17 from 10, compl... 40 8.5
46gb|AC164552.4| Mus musculus BAC clone RP23-352M7 from chromosome... 40 8.5
47emb|AL772290.3| Mouse DNA sequence from clone RP23-66O4 on chrom... 40 8.5

>emb|CR376737.4| Zebrafish DNA sequence from clone CH211-14G13 in linkage group 24,
             complete sequence
          Length = 158366

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 426   tgtttgtaaagaggtgtgatga 447
             ||||||||||||||||||||||
Sbjct: 24315 tgtttgtaaagaggtgtgatga 24336



to top

>emb|BX323842.8| Zebrafish DNA sequence from clone CH211-1M7, complete sequence
          Length = 162929

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 212    aagtttcttctcatcctctttc 233
              ||||||||||||||||||||||
Sbjct: 100989 aagtttcttctcatcctctttc 101010



to top

>gb|AC129326.3| Mus musculus BAC clone RP23-326H12 from chromosome 19, complete
             sequence
          Length = 184128

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 201   atgagaaccacaagtttcttc 221
             |||||||||||||||||||||
Sbjct: 85294 atgagaaccacaagtttcttc 85274



to top

>gb|AY363618.1| Malus baccata putative TIR-NBS type R protein 4 (R4) gene, complete
            cds
          Length = 3366

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 298  aaagaaactagtaaaattgca 318
            |||||||||||||||||||||
Sbjct: 2124 aaagaaactagtaaaattgca 2144



to top

>gb|AY363616.1| Malus baccata putative TIR-NBS type R protein 4 (R4) mRNA, complete
            cds
          Length = 2243

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 298  aaagaaactagtaaaattgca 318
            |||||||||||||||||||||
Sbjct: 1118 aaagaaactagtaaaattgca 1138



to top

>gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, complete sequence
          Length = 218079

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 201    atgagaaccacaagtttcttc 221
              |||||||||||||||||||||
Sbjct: 184501 atgagaaccacaagtttcttc 184481



to top

>emb|AL391476.20| Human DNA sequence from clone RP11-229A19 on chromosome 1 Contains the 3'
              end of the TTF2 gene for RNA polymerase II transcription
              termination factor, the TRIM45 gene for tripartite
              motif-containing 45, a ribosomal protein S15a (RPS15A)
              pseudogene, the gene for immune costimulatory protein B7-H4
              and a CpG island, complete sequence
          Length = 171595

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 295    accaaagaaactagtaaaatt 315
              |||||||||||||||||||||
Sbjct: 127949 accaaagaaactagtaaaatt 127969



to top

>gb|AC155294.2| Mus musculus BAC clone RP24-328F24 from chromosome 13, complete
             sequence
          Length = 174186

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 554   aacttttacttctaagtgcct 574
             |||||||||||||||||||||
Sbjct: 90044 aacttttacttctaagtgcct 90024



to top

>gb|AC005184.1| Homo sapiens Xp22 bins 45-47 BAC GSHB-665N22 (Genome Systems Human BAC
             Library) complete sequence
          Length = 157981

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 144   agaaaaaggacccaacaagtg 164
             |||||||||||||||||||||
Sbjct: 43396 agaaaaaggacccaacaagtg 43376



to top

>gb|DP000004.1| Lemur catta target 1 genomic scaffold
          Length = 1399362

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 100    ttttacatgtgcacaacagaatact 124
              ||||| |||||||||||||||||||
Sbjct: 279573 ttttatatgtgcacaacagaatact 279549



to top

>gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold
          Length = 1570569

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 100    ttttacatgtgcacaacagaatact 124
              ||||| |||||||||||||||||||
Sbjct: 309020 ttttatatgtgcacaacagaatact 308996



to top

>gb|AC123970.3| Lemur catta clone LB2-159J16, complete sequence
          Length = 183268

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 100   ttttacatgtgcacaacagaatact 124
             ||||| |||||||||||||||||||
Sbjct: 13622 ttttatatgtgcacaacagaatact 13598



to top

>gb|AC153890.8| Mus musculus  BAC RP23-403C13 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 202932

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 216   ttcttctcatcctctttctcc 236
             |||||||||||||||||||||
Sbjct: 44282 ttcttctcatcctctttctcc 44262



to top

>emb|AL663098.8| Mouse DNA sequence from clone RP23-24L23 on chromosome X, complete
             sequence
          Length = 227133

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 215   tttcttctcatcctctttctc 235
             |||||||||||||||||||||
Sbjct: 94830 tttcttctcatcctctttctc 94850



to top

>gb|AC148517.3| Felis catus clone RP86-202K10, complete sequence
          Length = 75775

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 580   taaattgaggaatatgctct 599
             ||||||||||||||||||||
Sbjct: 40363 taaattgaggaatatgctct 40382



to top

>gb|AC109239.8| Mus musculus chromosome 3, clone RP23-191N23, complete sequence
          Length = 187162

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 214   gtttcttctcatcctctttc 233
             ||||||||||||||||||||
Sbjct: 45274 gtttcttctcatcctctttc 45293



to top

>gb|AC111122.13| Mus musculus chromosome 7, clone RP23-230L8, complete sequence
          Length = 175772

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   acagaaaaaggacccaacaa 161
             ||||||||||||||||||||
Sbjct: 49534 acagaaaaaggacccaacaa 49553



to top

>gb|AC115742.13| Mus musculus chromosome 7, clone RP23-477E13, complete sequence
          Length = 186195

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 142  acagaaaaaggacccaacaa 161
            ||||||||||||||||||||
Sbjct: 3327 acagaaaaaggacccaacaa 3308



to top

>emb|CR388042.8| Zebrafish DNA sequence from clone CH211-254C12 in linkage group 15,
             complete sequence
          Length = 158539

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    acatcaacataattttacat 107
             ||||||||||||||||||||
Sbjct: 55376 acatcaacataattttacat 55357



to top

>ref|XM_387760.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07584.1)
           partial mRNA
          Length = 1500

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 210 acaagtttcttctcatcctc 229
           ||||||||||||||||||||
Sbjct: 113 acaagtttcttctcatcctc 94



to top

>gb|AC145330.19| Medicago truncatula clone mth2-17l1, complete sequence
          Length = 136161

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 389    attttattaactcaaaacat 408
              ||||||||||||||||||||
Sbjct: 128404 attttattaactcaaaacat 128423



to top

>gb|AC146329.19| Medicago truncatula clone mth2-5i21, complete sequence
          Length = 142834

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 365   taacgaaaaagtatatggat 384
             ||||||||||||||||||||
Sbjct: 48189 taacgaaaaagtatatggat 48208



to top

>emb|CR589881.11| Zebrafish DNA sequence from clone DKEY-188M1 in linkage group 14,
             complete sequence
          Length = 179964

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    acatcaacataattttacat 107
             ||||||||||||||||||||
Sbjct: 17496 acatcaacataattttacat 17477



to top

>emb|AL157396.9| Human DNA sequence from clone RP11-437J2 on chromosome 10 Contains the
             3' end of the PDE6C gene for phosphodiesterase 6C,
             cGMP-specific, cone, alpha prime (PDEA2), the C10orf4 gene
             for chromosome 10 open reading frame 4 and the 5' end of
             the LGI1 gene for leucine-rich glioma inactivated 1,
             complete sequence
          Length = 128796

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 377   atatggatctgtattttatt 396
             ||||||||||||||||||||
Sbjct: 16946 atatggatctgtattttatt 16965



to top

>emb|AL138758.7| Human DNA sequence from clone RP5-824O18 on chromosome 1p11.2-13.1
             Contains the 3' end of the ABCD3 gene for ATP-binding
             cassette sub-family D (ALD) member 3, the F3 gene for
             coagulation factor III (thromboplastin, tissue factor), a
             novel gene and a CpG island, complete sequence
          Length = 108205

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 377   atatggatctgtattttatt 396
             ||||||||||||||||||||
Sbjct: 63698 atatggatctgtattttatt 63717



to top

>emb|AL161556.2|ATCHRIV56 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 56
          Length = 196247

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 325   atatatatattaaaagctat 344
             ||||||||||||||||||||
Sbjct: 56147 atatatatattaaaagctat 56166



to top

>emb|AL022140.1|ATF1N20 Arabidopsis thaliana DNA chromosome 4, BAC clone F1N20 (ESSA project)
          Length = 103270

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 325  atatatatattaaaagctat 344
            ||||||||||||||||||||
Sbjct: 1829 atatatatattaaaagctat 1848



to top

>emb|AL021890.1|ATT8O5 Arabidopsis thaliana DNA chromosome 4, BAC clone T8O5 (ESSAII project)
          Length = 83029

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 325   atatatatattaaaagctat 344
             ||||||||||||||||||||
Sbjct: 54659 atatatatattaaaagctat 54678



to top

>gb|AC162913.3| Mus musculus BAC clone RP24-409P22 from chromosome 3, complete sequence
          Length = 175922

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 214   gtttcttctcatcctctttc 233
             ||||||||||||||||||||
Sbjct: 93770 gtttcttctcatcctctttc 93789



to top

>gb|AC099325.4| Oryza sativa chromosome 10 BAC OSJNBb0048O22 genomic sequence, complete
              sequence
          Length = 134825

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 325    atatatatattaaaagctat 344
              ||||||||||||||||||||
Sbjct: 106458 atatatatattaaaagctat 106477



to top

>gb|AC099040.10| Oryza sativa chromosome 10 BAC OSJNBa0004P12 genomic sequence, complete
              sequence
          Length = 137029

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 325    atatatatattaaaagctat 344
              ||||||||||||||||||||
Sbjct: 128500 atatatatattaaaagctat 128481



to top

>gb|AC068896.9| Homo sapiens chromosome 10 clone RP11-464O2, complete sequence
          Length = 194905

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 217    tcttctcatcctctttctcc 236
              ||||||||||||||||||||
Sbjct: 105402 tcttctcatcctctttctcc 105421



to top

>gb|AC182811.1| Gasterosteus aculeatus clone VMRC28-119K14, complete sequence
          Length = 130423

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 87    cacatcaacataattttaca 106
             ||||||||||||||||||||
Sbjct: 68078 cacatcaacataattttaca 68097



to top

>gb|AC093117.2| Homo sapiens chromosome 1 clone RP11-86H7, complete sequence
          Length = 200426

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 377   atatggatctgtattttatt 396
             ||||||||||||||||||||
Sbjct: 42556 atatggatctgtattttatt 42575



to top

>ref|XM_687464.1| PREDICTED: Danio rerio similar to 26S proteasome non-ATPase
            regulatory subunit 4 (26S proteasome regulatory subunit
            S5A) (Rpn10) (Multiubiquitin chain binding protein)
            (Antisecretory factor-1) (AF) (ASF) (LOC564108), mRNA
          Length = 1496

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 215  tttcttctcatcctctttct 234
            ||||||||||||||||||||
Sbjct: 1119 tttcttctcatcctctttct 1100



to top

>gb|AC160338.2| Mus musculus BAC clone RP23-261O3 from chromosome 9, complete
            sequence
          Length = 167569

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 215  tttcttctcatcctctttct 234
            ||||||||||||||||||||
Sbjct: 8107 tttcttctcatcctctttct 8088



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 325     atatatatattaaaagctat 344
               ||||||||||||||||||||
Sbjct: 7060349 atatatatattaaaagctat 7060330



to top

>ref|NM_001017624.1| Danio rerio proteasome (prosome, macropain) 26S subunit, non-ATPase,
            4 (psmd4), mRNA
          Length = 1522

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 215  tttcttctcatcctctttct 234
            ||||||||||||||||||||
Sbjct: 1130 tttcttctcatcctctttct 1111



to top

>emb|BX255877.14| Zebrafish DNA sequence from clone CH211-254C9, complete sequence
          Length = 152976

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   tttcttctcatcctctttct 234
             ||||||||||||||||||||
Sbjct: 42232 tttcttctcatcctctttct 42213



to top

>emb|BX276083.4| Zebrafish DNA sequence from clone CH211-165N1 in linkage group 17,
             complete sequence
          Length = 133128

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 293   agaccaaagaaactagtaaa 312
             ||||||||||||||||||||
Sbjct: 87669 agaccaaagaaactagtaaa 87650



to top

>dbj|AK103839.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033148H10, full
            insert sequence
          Length = 2252

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 325  atatatatattaaaagctat 344
            ||||||||||||||||||||
Sbjct: 2220 atatatatattaaaagctat 2239



to top

>gb|AC024558.21| Homo sapiens 3 BAC RP11-390G14 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 216161

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 383    atctgtattttattaactca 402
              ||||||||||||||||||||
Sbjct: 128121 atctgtattttattaactca 128140



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 325     atatatatattaaaagctat 344
               ||||||||||||||||||||
Sbjct: 7063636 atatatatattaaaagctat 7063617



to top

>gb|BC092825.1| Danio rerio proteasome (prosome, macropain) 26S subunit, non-ATPase,
            4, mRNA (cDNA clone MGC:110247 IMAGE:7397606), complete
            cds
          Length = 1522

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 215  tttcttctcatcctctttct 234
            ||||||||||||||||||||
Sbjct: 1130 tttcttctcatcctctttct 1111



to top

>gb|AC132471.4| Mus musculus BAC clone RP23-106E17 from 10, complete sequence
          Length = 197822

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 105    catgtgcacaacagaatact 124
              ||||||||||||||||||||
Sbjct: 135024 catgtgcacaacagaatact 135043



to top

>gb|AC164552.4| Mus musculus BAC clone RP23-352M7 from chromosome 9, complete sequence
          Length = 169465

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   tttcttctcatcctctttct 234
             ||||||||||||||||||||
Sbjct: 73719 tttcttctcatcctctttct 73738



to top

>emb|AL772290.3| Mouse DNA sequence from clone RP23-66O4 on chromosome 4, complete
             sequence
          Length = 110623

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   ttacatgtgcacaacagaat 121
             ||||||||||||||||||||
Sbjct: 85625 ttacatgtgcacaacagaat 85606


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,777,224
Number of Sequences: 3902068
Number of extensions: 7777224
Number of successful extensions: 168939
Number of sequences better than 10.0: 47
Number of HSP's better than 10.0 without gapping: 47
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 168621
Number of HSP's gapped (non-prelim): 318
length of query: 626
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 603
effective length of database: 17,143,297,704
effective search space: 10337408515512
effective search space used: 10337408515512
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top