Clone Name	rbags10o24
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_472343.1| Oryza sativa (japonica cultivar-group), predic...	113	2e-22
2	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	113	2e-22
3	dbj|AK059519.1| Oryza sativa (japonica cultivar-group) cDNA clon...	113	2e-22
4	emb|AL731591.3|OSJN00240 Oryza sativa genomic DNA, chromosome 4,...	113	2e-22
5	gb|BT017520.1| Zea mays clone EL01N0421A02.c mRNA sequence	103	2e-19
6	gb|BT018238.1| Zea mays clone EL01N0563B05.c mRNA sequence	96	4e-17
7	gb|AY105531.1| Zea mays PCO113958 mRNA sequence	86	4e-14
8	gb|AY109584.1| Zea mays CL2436_1 mRNA sequence	72	6e-10
9	gb|M77225.1|TOBRFESP Nicotiana tabacum mitochondrial Rieske Fe-S...	72	6e-10
10	gb|M77224.1|MZERFESPA Zea mays mitochondrial Rieske Fe-S protein...	72	6e-10
11	gb|L16812.1|TOBFESC Nicotiana tabacum clone 36.14 Rieske iron-su...	70	2e-09
12	gb|L16810.1|TOBFESA Nicotiana tabacum clone 17.12 Rieske iron-su...	70	2e-09
13	gb|DQ207870.1| Solanum tuberosum clone 087E11 rieske iron-sulfur...	70	2e-09
14	emb|X79332.1|STFES1G S.tuberosum (Desiree) FeS1 mRNA for Rieske ...	70	2e-09
15	ref|XM_466001.1| Oryza sativa (japonica cultivar-group), mRNA	68	9e-09
16	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	68	9e-09
17	dbj|AP005842.3| Oryza sativa (japonica cultivar-group) genomic D...	68	9e-09
18	dbj|AP005749.3| Oryza sativa (japonica cultivar-group) genomic D...	68	9e-09
19	dbj|AK102815.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	9e-09
20	emb|AJ250370.1|CPA250370 Cyanophora paradoxa partial mRNA for ub...	66	4e-08
21	gb|L16811.1|TOBFESB Nicotiana tabacum clone 8.8 Rieske iron-sulf...	62	6e-07
22	gb|BT014059.1| Lycopersicon esculentum clone 133157F, mRNA sequence	62	6e-07
23	emb|X91795.1|CRUCCOR C.reinhardtii mRNa for ubiquinol-cytochrome...	58	9e-06
24	emb|AJ320239.1|CRE320239 Chlamydomonas reinhardtii risp gene for...	58	9e-06
25	gb|L16813.1|TOBFESD Nicotiana tabacum clone 32.10 Rieske iron-su...	54	1e-04
26	gb|CP000081.1| Leishmania major chromosome 35, complete sequence	52	5e-04
27	ref|XM_838166.1| Leishmania major strain Friedlin reiske iron-su...	52	5e-04
28	emb|AJ719669.1| Gallus gallus mRNA for hypothetical protein, clo...	50	0.002
29	ref|NM_001005843.1| Gallus gallus ubiquinol-cytochrome c reducta...	50	0.002
30	dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome	50	0.002
31	ref|XM_499709.1| Yarrowia lipolytica CLIB122, YALI0A02915g predi...	44	0.13
32	emb|AL022104.2|SPBC16H5 S.pombe chromosome II cosmid c16H5	44	0.13
33	dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ...	44	0.13
34	ref|NM_001021849.1| Schizosaccharomyces pombe 972h- hypothetical...	44	0.13
35	gb|U40480.1|SPU40480 Schizosaccharomyces pombe Rieske iron-sulfu...	44	0.13
36	emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1...	44	0.13
37	ref|NM_001030839.1| Gallus gallus UV radiation resistance associ...	42	0.52
38	gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr...	42	0.52
39	ref|XM_570926.1| Cryptococcus neoformans var. neoformans JEC21 u...	42	0.52
40	emb|AJ720269.1| Gallus gallus mRNA for hypothetical protein, clo...	42	0.52
41	gb|DQ122922.1| Chlamydomonas incerta mitochondrial ubiquinol-cyt...	42	0.52
42	emb|CT033644.1| Platynereis dumerilii EST IB0AAA16DC02EM1	42	0.52
43	emb|CT033533.1| Platynereis dumerilii EST IB0AAA18DC05EM1	42	0.52
44	emb|CT033153.1| Platynereis dumerilii EST IB0AAA25DC05EM1	42	0.52
45	gb|CP000087.1| Rickettsia bellii RML369-C, complete genome	40	2.1
46	gb|AE005720.1| Caulobacter crescentus CB15 section 46 of 359 of ...	40	2.1
47	dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010	40	2.1
48	gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome	38	8.1
49	ref|XM_515143.1| PREDICTED: Pan troglodytes similar to voltage-d...	38	8.1
50	ref|XM_512557.1| PREDICTED: Pan troglodytes similar to ubiquinol...	38	8.1
51	gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome...	38	8.1
52	ref|NM_001008888.1| Rattus norvegicus ubiquinol-cytochrome c red...	38	8.1
53	ref|NM_174813.2| Bos taurus ubiquinol-cytochrome c reductase, Ri...	38	8.1
54	ref|XM_359684.1| Magnaporthe grisea 70-15 hypothetical protein (...	38	8.1
55	gb|AY387508.1|AY387507S2 Colobus polykomos ubiquinol-cytochrome ...	38	8.1
56	gb|AY387502.1|AY387501S2 Pongo pygmaeus ubiquinol-cytochrome c o...	38	8.1
57	gb|AY387498.1|AY387497S2 Pan troglodytes ubiquinol-cytochrome c ...	38	8.1
58	gb|AY387496.1|AY387495S2 Pan paniscus ubiquinol-cytochrome c oxi...	38	8.1
59	gb|BC019934.1| Mus musculus ubiquinol-cytochrome c reductase, Ri...	38	8.1
60	gb|BC115994.1| Bos taurus ubiquinol-cytochrome c reductase, Ries...	38	8.1
61	gb|AY539946.1| Rattus norvegicus LRRGT00195 mRNA, complete cds	38	8.1
62	ref|XM_748490.1| Aspergillus fumigatus Af293 ubiquinol-cytochrom...	38	8.1
63	emb|CR956381.6| Pig DNA sequence from clone CH242-248C21 on chro...	38	8.1
64	ref|XM_533711.2| PREDICTED: Canis familiaris similar to ubiquino...	38	8.1
65	gb|AC092728.2| Canis familiaris clone RP81-237O17, complete sequ...	38	8.1
66	emb|CR956417.1| Pig DNA sequence from clone CH242-300K12 on chro...	38	8.1
67	emb|Z82206.1|HS370M22 Human DNA sequence from clone RP3-370M22 o...	38	8.1
68	emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on ch...	38	8.1
69	gb|BC085339.1| Rattus norvegicus ubiquinol-cytochrome c reductas...	38	8.1
70	emb|CR592425.1| full-length cDNA clone CS0DB008YM18 of Neuroblas...	38	8.1
71	dbj|AK152391.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	38	8.1
72	dbj|AK153139.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	38	8.1
73	gb|S58789.1| Bos taurus Rieske iron-sulfur mRNA, complete cds; n...	38	8.1
74	gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	38	8.1
75	dbj|AK012180.1| Mus musculus 10 days embryo whole body cDNA, RIK...	38	8.1
76	dbj|AK014470.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu...	38	8.1
77	dbj|AK003966.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	38	8.1
78	ref|NM_025710.1| Mus musculus ubiquinol-cytochrome c reductase, ...	38	8.1
79	dbj|AK217705.1| Mus musculus cDNA, clone:Y2G0142L01, strand:plus...	38	8.1
80	dbj|AK216624.1| Mus musculus cDNA, clone:Y2G0138P18, strand:minu...	38	8.1
81	dbj|AK212564.1| Mus musculus cDNA, clone:Y2G0125G04, strand:plus...	38	8.1
82	dbj|AK210928.1| Mus musculus cDNA, clone:Y2G0120B13, strand:minu...	38	8.1
83	dbj|AK180820.1| Mus musculus cDNA, clone:Y0G0116A06, strand:minu...	38	8.1
84	ref|NM_210148.1| Eremothecium gossypii AEL067Wp (AEL067W), mRNA	38	8.1
85	emb|AL049548.6|HSDJ398G3 Human DNA sequence from clone RP3-398G3...	38	8.1
86	gb|BC047125.1| Mus musculus ubiquinol-cytochrome c reductase, Ri...	38	8.1
87	emb|AL772395.12| Mouse DNA sequence from clone RP23-39O1 on chro...	38	8.1
88	gb|M24542.1|RATRIP Rat Rieske iron-sulfur protein mRNA, complete...	38	8.1
89	gb|M34336.1|BOVFESUP Bovine Rieske iron-sulfur protein mRNA, com...	38	8.1

---

>ref|XM_472343.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 837

 Score =  113 bits (57), Expect = 2e-22
 Identities = 123/146 (84%)
 Strand = Plus / Minus

                                                                       
Query: 19  acctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnag 78
           ||||| |||||| | || || ||||||||||| || ||||||||||||||||| ||| ||
Sbjct: 791 acctccaggttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggag 732

                                                                       
Query: 79  ccatggcacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaacca 138
           ||||||||||||||||||||| | || || ||| |||  ||||| || || |||||||||
Sbjct: 731 ccatggcacgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaacca 672

                                     
Query: 139 agatgagtgcagacaccaataaccac 164
           || || |||||||| ||||| |||||
Sbjct: 671 aggtgggtgcagacgccaatgaccac 646

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  113 bits (57), Expect = 2e-22
 Identities = 123/146 (84%)
 Strand = Plus / Minus

                                                                            
Query: 19       acctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnag 78
                ||||| |||||| | || || ||||||||||| || ||||||||||||||||| ||| ||
Sbjct: 19696214 acctccaggttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggag 19696155

                                                                            
Query: 79       ccatggcacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaacca 138
                ||||||||||||||||||||| | || || ||| |||  ||||| || || |||||||||
Sbjct: 19696154 ccatggcacgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaacca 19696095

                                          
Query: 139      agatgagtgcagacaccaataaccac 164
                || || |||||||| ||||| |||||
Sbjct: 19696094 aggtgggtgcagacgccaatgaccac 19696069

---

>dbj|AK059519.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-C04, full
           insert sequence
          Length = 1242

 Score =  113 bits (57), Expect = 2e-22
 Identities = 123/146 (84%)
 Strand = Plus / Minus

                                                                       
Query: 19  acctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnag 78
           ||||| |||||| | || || ||||||||||| || ||||||||||||||||| ||| ||
Sbjct: 920 acctccaggttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggag 861

                                                                       
Query: 79  ccatggcacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaacca 138
           ||||||||||||||||||||| | || || ||| |||  ||||| || || |||||||||
Sbjct: 860 ccatggcacgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaacca 801

                                     
Query: 139 agatgagtgcagacaccaataaccac 164
           || || |||||||| ||||| |||||
Sbjct: 800 aggtgggtgcagacgccaatgaccac 775

---

>emb|AL731591.3|OSJN00240 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0039C07,
              complete sequence
          Length = 166410

 Score =  113 bits (57), Expect = 2e-22
 Identities = 123/146 (84%)
 Strand = Plus / Minus

                                                                          
Query: 19     acctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnag 78
              ||||| |||||| | || || ||||||||||| || ||||||||||||||||| ||| ||
Sbjct: 146940 acctccaggttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggag 146881

                                                                          
Query: 79     ccatggcacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaacca 138
              ||||||||||||||||||||| | || || ||| |||  ||||| || || |||||||||
Sbjct: 146880 ccatggcacgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaacca 146821

                                        
Query: 139    agatgagtgcagacaccaataaccac 164
              || || |||||||| ||||| |||||
Sbjct: 146820 aggtgggtgcagacgccaatgaccac 146795

---

>gb|BT017520.1| Zea mays clone EL01N0421A02.c mRNA sequence
          Length = 1172

 Score =  103 bits (52), Expect = 2e-19
 Identities = 124/149 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  acctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnag 78
           ||||| |||||| |||||||||||||||||||||| || || || |||| ||| ||| | 
Sbjct: 852 acctcgaggttgaacggggcagggcccttgcggatcctcccggatatgtagtagtgggaa 793

                                                                       
Query: 79  ccatggcacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaacca 138
           |||||||| |||||||||||  | ||||||||| | | ||| || || ||||||||||| 
Sbjct: 792 ccatggcatgggcagaaccagccgccaaagtctccggcgttcggtagtgggatgcaaccg 733

                                        
Query: 139 agatgagtgcagacaccaataaccaccag 167
           || |||||||| || ||||| ||||||||
Sbjct: 732 aggtgagtgcacacgccaatgaccaccag 704

---

>gb|BT018238.1| Zea mays clone EL01N0563B05.c mRNA sequence
          Length = 971

 Score = 95.6 bits (48), Expect = 4e-17
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                       
Query: 19  acctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnag 78
           ||||| |||||| |||| ||||||||||||||||| || || || |||||||| ||| | 
Sbjct: 740 acctcgaggttgaacggcgcagggcccttgcggatcctcccggatatgtcgtagtgggaa 681

                                                                       
Query: 79  ccatggcacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaacca 138
           |||||||| |||||||||||  | ||||||||| | | ||| || || |||||||| || 
Sbjct: 680 ccatggcatgggcagaaccagccgccaaagtctccggcgttcggtagtgggatgcagccg 621

                                        
Query: 139 agatgagtgcagacaccaataaccaccag 167
           || |||||||| || ||||| ||||||||
Sbjct: 620 aggtgagtgcacacgccaatgaccaccag 592

---

>gb|AY105531.1| Zea mays PCO113958 mRNA sequence
          Length = 1217

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 40  gggcccttgcggattctgccagagatgtcgtantggnagccatggcacgggcagaaccaa 99
           |||||||||||||| || ||||| |||||||| ||  |||| ||||||||||||||||| 
Sbjct: 895 gggcccttgcggatcctaccagaaatgtcgtagtgcgagccgtggcacgggcagaaccag 836

                                                                       
Query: 100 ncaccaaagtcttcagagttgggaagggggatgcaaccaagatgagtgcagacaccaata 159
            ||||||||||| | |  || || || |||||||| || || ||||||||||| ||||| 
Sbjct: 835 ccaccaaagtctcctgcattagggagcgggatgcagcccaggtgagtgcagaccccaatg 776

                   
Query: 160 accaccag 167
           || |||||
Sbjct: 775 acgaccag 768

---

>gb|AY109584.1| Zea mays CL2436_1 mRNA sequence
          Length = 1746

 Score = 71.9 bits (36), Expect = 6e-10
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                        
Query: 19   acctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnag 78
            ||||| |||||| |||| ||||||||||||||||| || || || ||||| || ||| | 
Sbjct: 1392 acctcgaggttgaacggcgcagggcccttgcggatcctcccggaaatgtcatagtgggaa 1333

                                             
Query: 79   ccatggcacgggcagaaccaancaccaaagtct 111
            |||||||| |||||||||||  | |||||||||
Sbjct: 1332 ccatggcatgggcagaaccagccgccaaagtct 1300

---

>gb|M77225.1|TOBRFESP Nicotiana tabacum mitochondrial Rieske Fe-S protein mRNA, complete
           cds
          Length = 956

 Score = 71.9 bits (36), Expect = 6e-10
 Identities = 120/149 (80%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           |||||||| || || || || ||||| ||||||||||| || ||||||||||| || |||
Sbjct: 734 ggcacctccagattatatggtgcaggtcccttgcggatcctaccagagatgtcataatgg 675

                                                                       
Query: 76  nagccatggcacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaa 135
            |||| ||||| ||||| |||||| ||||||| ||  |||  || || |  || ||||| 
Sbjct: 674 gagccgtggcaagggcaaaaccaaccaccaaaatcaccagcatttggcaaaggaatgcac 615

                                        
Query: 136 ccaagatgagtgcagacaccaataaccac 164
           |||||||| ||||| || |||||||||||
Sbjct: 614 ccaagatgggtgcataccccaataaccac 586

---

>gb|M77224.1|MZERFESPA Zea mays mitochondrial Rieske Fe-S protein mRNA, complete cds
          Length = 1197

 Score = 71.9 bits (36), Expect = 6e-10
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  acctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnag 78
           ||||| |||||| |||| ||||||||||||||||| || || || ||||| || ||| | 
Sbjct: 883 acctcgaggttgaacggcgcagggcccttgcggatcctcccggaaatgtcatagtgggaa 824

                                            
Query: 79  ccatggcacgggcagaaccaancaccaaagtct 111
           |||||||| |||||||||||  | |||||||||
Sbjct: 823 ccatggcatgggcagaaccagccgccaaagtct 791

---

>gb|L16812.1|TOBFESC Nicotiana tabacum clone 36.14 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1286

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           |||||||| || || || || ||||| ||||||||||| || ||||||||||| || |||
Sbjct: 986 ggcacctccagattatatggtgcaggtcccttgcggatcctaccagagatgtcataatgg 927

                                           
Query: 76  nagccatggcacgggcagaaccaancaccaaa 107
            |||| ||||| ||||| |||||| |||||||
Sbjct: 926 gagccgtggcaagggcaaaaccaaccaccaaa 895

---

>gb|L16810.1|TOBFESA Nicotiana tabacum clone 17.12 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1210

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           |||||||| || || || || ||||| ||||||||||| || ||||||||||| || |||
Sbjct: 926 ggcacctccagattatatggtgcaggtcccttgcggatcctaccagagatgtcataatgg 867

                                           
Query: 76  nagccatggcacgggcagaaccaancaccaaa 107
            |||| ||||| ||||| |||||| |||||||
Sbjct: 866 gagccgtggcaagggcaaaaccaaccaccaaa 835

---

>gb|DQ207870.1| Solanum tuberosum clone 087E11 rieske iron-sulfur protein-like
           mRNA, complete cds
          Length = 1098

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           |||||||| || || ||||| || || || ||||| || || |||||||||||||| |||
Sbjct: 813 ggcacctccagattatacggtgcgggtcctttgcgaatcctaccagagatgtcgtaatgg 754

                                           
Query: 76  nagccatggcacgggcagaaccaancaccaaa 107
            |||||||||| ||||| |||||| |||||||
Sbjct: 753 gagccatggcatgggcaaaaccaaccaccaaa 722

---

>emb|X79332.1|STFES1G S.tuberosum (Desiree) FeS1 mRNA for Rieske iron-sulfur protein
          Length = 993

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           |||||||| || || ||||| || || || ||||| || || |||||||||||||| |||
Sbjct: 776 ggcacctccagattatacggtgcgggtcctttgcgaatcctaccagagatgtcgtaatgg 717

                                           
Query: 76  nagccatggcacgggcagaaccaancaccaaa 107
            |||||||||| ||||| |||||| |||||||
Sbjct: 716 gagccatggcatgggcaaaaccaaccaccaaa 685

---

>ref|XM_466001.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1157

 Score = 67.9 bits (34), Expect = 9e-09
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 25  aggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnagccatgg 84
           |||||||| || ||||||||||| |||||||| || || || || || ||  | ||||||
Sbjct: 857 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 798

                                                                       
Query: 85  cacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaaccaagatga 144
           || || ||||||||  ||||||||||  ||| ||||||||| || ||||| || ||||||
Sbjct: 797 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 738

                                  
Query: 145 gtgcagacaccaataaccaccag 167
           || || || ||||| || |||||
Sbjct: 737 gtacacaccccaatcacaaccag 715

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 67.9 bits (34), Expect = 9e-09
 Identities = 115/143 (80%)
 Strand = Plus / Plus

                                                                            
Query: 25       aggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnagccatgg 84
                |||||||| || ||||||||||| |||||||| || || || || || ||  | ||||||
Sbjct: 19000643 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 19000702

                                                                            
Query: 85       cacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaaccaagatga 144
                || || ||||||||  ||||||||||  ||| ||||||||| || ||||| || ||||||
Sbjct: 19000703 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 19000762

                                       
Query: 145      gtgcagacaccaataaccaccag 167
                || || || ||||| || |||||
Sbjct: 19000763 gtacacaccccaatcacaaccag 19000785

---

>dbj|AP005842.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBb0003H22
          Length = 68256

 Score = 67.9 bits (34), Expect = 9e-09
 Identities = 115/143 (80%)
 Strand = Plus / Plus

                                                                         
Query: 25    aggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnagccatgg 84
             |||||||| || ||||||||||| |||||||| || || || || || ||  | ||||||
Sbjct: 55964 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 56023

                                                                         
Query: 85    cacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaaccaagatga 144
             || || ||||||||  ||||||||||  ||| ||||||||| || ||||| || ||||||
Sbjct: 56024 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 56083

                                    
Query: 145   gtgcagacaccaataaccaccag 167
             || || || ||||| || |||||
Sbjct: 56084 gtacacaccccaatcacaaccag 56106

---

>dbj|AP005749.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OSJNBa0047A17
          Length = 149142

 Score = 67.9 bits (34), Expect = 9e-09
 Identities = 115/143 (80%)
 Strand = Plus / Plus

                                                                        
Query: 25   aggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnagccatgg 84
            |||||||| || ||||||||||| |||||||| || || || || || ||  | ||||||
Sbjct: 6164 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 6223

                                                                        
Query: 85   cacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaaccaagatga 144
            || || ||||||||  ||||||||||  ||| ||||||||| || ||||| || ||||||
Sbjct: 6224 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 6283

                                   
Query: 145  gtgcagacaccaataaccaccag 167
            || || || ||||| || |||||
Sbjct: 6284 gtacacaccccaatcacaaccag 6306

---

>dbj|AK102815.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108M09, full
           insert sequence
          Length = 1157

 Score = 67.9 bits (34), Expect = 9e-09
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 25  aggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnagccatgg 84
           |||||||| || ||||||||||| |||||||| || || || || || ||  | ||||||
Sbjct: 857 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 798

                                                                       
Query: 85  cacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaaccaagatga 144
           || || ||||||||  ||||||||||  ||| ||||||||| || ||||| || ||||||
Sbjct: 797 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 738

                                  
Query: 145 gtgcagacaccaataaccaccag 167
           || || || ||||| || |||||
Sbjct: 737 gtacacaccccaatcacaaccag 715

---

>emb|AJ250370.1|CPA250370 Cyanophora paradoxa partial mRNA for ubiquinol-cytochrome C
           reductase iron-sulfur subunit precursor (risp gene)
          Length = 836

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           |||||||| |||||   ||| ||||||||||| ||||| | ||| ||||||||||| |||
Sbjct: 635 ggcacctccaggttaagcggcgcagggcccttccggatgcggccggagatgtcgtagtgg 576

                                  
Query: 76  nagccatggcacgggcagaacca 98
             ||| |||||||||||||||||
Sbjct: 575 ctgccgtggcacgggcagaacca 553

---

>gb|L16811.1|TOBFESB Nicotiana tabacum clone 8.8 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1202

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           |||||||| || || || || ||||| || ||||| || || ||||||||||| || |||
Sbjct: 879 ggcacctccagattatatggtgcaggtcctttgcgaatcctaccagagatgtcatagtgg 820

                                           
Query: 76  nagccatggcacgggcagaaccaancaccaaa 107
            |||||||||| ||||| |||||| |||||||
Sbjct: 819 gagccatggcatgggcaaaaccaaccaccaaa 788

---

>gb|BT014059.1| Lycopersicon esculentum clone 133157F, mRNA sequence
          Length = 1087

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           |||||||| || || ||||| || || || ||||| || || |||||||||||||| || 
Sbjct: 825 ggcacctccagattatacggtgcgggtcctttgcgaatcctaccagagatgtcgtaatga 766

                                           
Query: 76  nagccatggcacgggcagaaccaancaccaaa 107
            |||||||||| ||||| |||||| |||||||
Sbjct: 765 gagccatggcatgggcaaaaccaaccaccaaa 734

---

>emb|X91795.1|CRUCCOR C.reinhardtii mRNa for ubiquinol-cytochrome c oxidoreductase
          Length = 1447

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           |||||||| |||||||| ||||| |||||||  |  || | ||| ||||||||||| |||
Sbjct: 869 ggcacctccaggttgtatggggcggggccctccctaatgcggcccgagatgtcgtagtgg 810

                                  
Query: 76  nagccatggcacgggcagaacca 98
             ||| |||||||||||||||||
Sbjct: 809 ctgccgtggcacgggcagaacca 787

---

>emb|AJ320239.1|CRE320239 Chlamydomonas reinhardtii risp gene for ubiquinol-cytochrome c
            reductase, exons 1-5
          Length = 2847

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                        
Query: 16   ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
            |||||||| |||||||| ||||| |||||||  |  || | ||| ||||||||||| |||
Sbjct: 2208 ggcacctccaggttgtatggggcggggccctccctaatgcggcccgagatgtcgtagtgg 2149

                                   
Query: 76   nagccatggcacgggcagaacca 98
              ||| |||||||||||||||||
Sbjct: 2148 ctgccgtggcacgggcagaacca 2126

---

>gb|L16813.1|TOBFESD Nicotiana tabacum clone 32.10 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1121

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           |||||||| || || || || ||||| || ||||| || || ||||||||||| || |||
Sbjct: 863 ggcacctccagattatatggcgcaggtcctttgcgaatcctaccagagatgtcatagtgg 804

                                           
Query: 76  nagccatggcacgggcagaaccaancaccaaa 107
            | |||||||| ||||| |||||| |||||||
Sbjct: 803 gaaccatggcatgggcaaaaccaaccaccaaa 772

---

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                          
Query: 16     ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
              ||||||||||||||   |||||||||||| | |||||| | ||| |||  |||||| |||
Sbjct: 666939 ggcacctcaaggttcagcggggcagggccttggcggatacggccggaggggtcgtagtgg 666998

                                  
Query: 76     nagccatggcacgggcagaa 95
                ||| ||||||||||||||
Sbjct: 666999 ctgccgtggcacgggcagaa 667018

---

>ref|XM_838166.1| Leishmania major strain Friedlin reiske iron-sulfur protein
           precursor (LMJ_1083) partial mRNA
          Length = 894

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           ||||||||||||||   |||||||||||| | |||||| | ||| |||  |||||| |||
Sbjct: 845 ggcacctcaaggttcagcggggcagggccttggcggatacggccggaggggtcgtagtgg 786

                               
Query: 76  nagccatggcacgggcagaa 95
             ||| ||||||||||||||
Sbjct: 785 ctgccgtggcacgggcagaa 766

---

>emb|AJ719669.1| Gallus gallus mRNA for hypothetical protein, clone 5b19
          Length = 1070

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 106/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 19  acctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnag 78
           ||||| ||||| || |||||||| || || | |||||||||||||   || || ||| | 
Sbjct: 835 acctccaggttatagggggcaggacctttcctgattctgccagaggcatcataatgggac 776

                                                                       
Query: 79  ccatggcacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaacca 138
           || |||||||||||| |  || ||||||| ||| ||||||| | ||  || |  ||||||
Sbjct: 775 ccgtggcacgggcagtaataaccaccaaaatctccagagttagcaattggtacacaacca 716

                         
Query: 139 agatgagtgcagac 152
           ||||||||||||||
Sbjct: 715 agatgagtgcagac 702

---

>ref|NM_001005843.1| Gallus gallus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1 (UQCRFS1), mRNA
          Length = 1070

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 106/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 19  acctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantggnag 78
           ||||| ||||| || |||||||| || || | |||||||||||||   || || ||| | 
Sbjct: 835 acctccaggttatagggggcaggacctttcctgattctgccagaggcatcataatgggac 776

                                                                       
Query: 79  ccatggcacgggcagaaccaancaccaaagtcttcagagttgggaagggggatgcaacca 138
           || |||||||||||| |  || ||||||| ||| ||||||| | ||  || |  ||||||
Sbjct: 775 ccgtggcacgggcagtaataaccaccaaaatctccagagttagcaattggtacacaacca 716

                         
Query: 139 agatgagtgcagac 152
           ||||||||||||||
Sbjct: 715 agatgagtgcagac 702

---

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                          
Query: 40      gggcccttgcggattctgccagagatgtcgtantggnagccatggcacgggcagaacca 98
               ||||| |||||||| | ||| | | ||||||| ||  ||||||||||||||||||||||
Sbjct: 2177333 gggcctttgcggatgcggccggcggtgtcgtactgcgagccatggcacgggcagaacca 2177391

---

>ref|XM_499709.1| Yarrowia lipolytica CLIB122, YALI0A02915g predicted mRNA
          Length = 678

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 52/63 (82%)
 Strand = Plus / Minus

                                                                       
Query: 49  cggattctgccagagatgtcgtantggnagccatggcacgggcagaaccaancaccaaag 108
           ||||||| ||| || |||||||| ||| | || ||||| |||||||||||  | ||||||
Sbjct: 602 cggattcggccggaaatgtcgtaatgggatccgtggcaggggcagaaccagccgccaaag 543

              
Query: 109 tct 111
           |||
Sbjct: 542 tct 540

---

>emb|AL022104.2|SPBC16H5 S.pombe chromosome II cosmid c16H5
          Length = 35660

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 133   caaccaagatgagtgcagacaccaat 158
             |||||||||||||| |||||||||||
Sbjct: 20415 caaccaagatgagtacagacaccaat 20440

---

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                       
Query: 43      cccttgcggattctgccagagatgtcgtantggnagccatggcacgggcagaacca 98
               ||||||||||| | ||| ||| | ||||| ||  | ||||||||||||||||||||
Sbjct: 4489680 cccttgcggatgcggccggaggtatcgtagtgcgatccatggcacgggcagaacca 4489625

---

>ref|NM_001021849.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC16H5.06),
           partial mRNA
          Length = 687

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 133 caaccaagatgagtgcagacaccaat 158
           |||||||||||||| |||||||||||
Sbjct: 530 caaccaagatgagtacagacaccaat 505

---

>gb|U40480.1|SPU40480 Schizosaccharomyces pombe Rieske iron-sulfur protein (Rip1) mRNA,
           complete cds
          Length = 746

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 133 caaccaagatgagtgcagacaccaat 158
           |||||||||||||| |||||||||||
Sbjct: 584 caaccaagatgagtacagacaccaat 559

---

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 52/63 (82%)
 Strand = Plus / Minus

                                                                          
Query: 49     cggattctgccagagatgtcgtantggnagccatggcacgggcagaaccaancaccaaag 108
              ||||||| ||| || |||||||| ||| | || ||||| |||||||||||  | ||||||
Sbjct: 346295 cggattcggccggaaatgtcgtaatgggatccgtggcaggggcagaaccagccgccaaag 346236

                 
Query: 109    tct 111
              |||
Sbjct: 346235 tct 346233

---

>ref|NM_001030839.1| Gallus gallus UV radiation resistance associated gene (UVRAG), mRNA
          Length = 2538

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 105  aaagtcttcagagttgggaag 125
            |||||||||||||||||||||
Sbjct: 1183 aaagtcttcagagttgggaag 1163

---

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 133    caaccaagatgagtgcagacaccaa 157
              ||||||||||| |||||||||||||
Sbjct: 627953 caaccaagatgtgtgcagacaccaa 627977

---

>ref|XM_570926.1| Cryptococcus neoformans var. neoformans JEC21 ubiquinol-cytochrome
           c reductase iron-sulfur subunit, mitochondrial precursor
           (CNE02310) partial mRNA
          Length = 840

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 133 caaccaagatgagtgcagacaccaa 157
           ||||||||||| |||||||||||||
Sbjct: 677 caaccaagatgtgtgcagacaccaa 653

---

>emb|AJ720269.1| Gallus gallus mRNA for hypothetical protein, clone 13n21
          Length = 2538

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 105  aaagtcttcagagttgggaag 125
            |||||||||||||||||||||
Sbjct: 1183 aaagtcttcagagttgggaag 1163

---

>gb|DQ122922.1| Chlamydomonas incerta mitochondrial ubiquinol-cytochrome c
           oxidoreductase (RisP) mRNA, partial cds; nuclear gene
           for mitochondrial product
          Length = 921

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 67/83 (80%)
 Strand = Plus / Minus

                                                                       
Query: 16  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtantgg 75
           ||||| || |||||||| ||||| |||||||  || || | ||| || |||||||| |||
Sbjct: 593 ggcacttccaggttgtagggggcggggccctcccgaatgcggcccgaaatgtcgtagtgg 534

                                  
Query: 76  nagccatggcacgggcagaacca 98
             ||| ||||| |||||||||||
Sbjct: 533 ctgccgtggcaggggcagaacca 511

---

>emb|CT033644.1| Platynereis dumerilii EST IB0AAA16DC02EM1
          Length = 957

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 34  ggggcagggcccttgcggattctgccaga 62
           ||||| || ||||||||||||||||||||
Sbjct: 804 ggggcgggtcccttgcggattctgccaga 776

---

>emb|CT033533.1| Platynereis dumerilii EST IB0AAA18DC05EM1
          Length = 864

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 34  ggggcagggcccttgcggattctgccaga 62
           ||||| || ||||||||||||||||||||
Sbjct: 826 ggggcgggtcccttgcggattctgccaga 798

---

>emb|CT033153.1| Platynereis dumerilii EST IB0AAA25DC05EM1
          Length = 915

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 34  ggggcagggcccttgcggattctgccaga 62
           ||||| || ||||||||||||||||||||
Sbjct: 793 ggggcgggtcccttgcggattctgccaga 765

---

>gb|CP000087.1| Rickettsia bellii RML369-C, complete genome
          Length = 1522076

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 79     ccatggcacgggcagaacca 98
              ||||||||||||||||||||
Sbjct: 913996 ccatggcacgggcagaacca 913977

---

>gb|AE005720.1| Caulobacter crescentus CB15 section 46 of 359 of the complete genome
          Length = 11816

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 51/62 (82%)
 Strand = Plus / Minus

                                                                        
Query: 37   gcagggcccttgcggattctgccagagatgtcgtantggnagccatggcacgggcagaac 96
            ||||||||||| ||||| |  || ||| ||||||| ||  |||| ||||| |||||||||
Sbjct: 5564 gcagggcccttacggatacgacccgaggtgtcgtagtgcgagccgtggcaggggcagaac 5505

              
Query: 97   ca 98
            ||
Sbjct: 5504 ca 5503

---

>dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010
          Length = 2039961

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 62/77 (80%)
 Strand = Plus / Minus

                                                                           
Query: 34      ggggcagggcccttgcggattctgccagagatgtcgtantggnagccatggcacgggcag 93
               |||||||| ||||| | ||| | ||| ||||||||||| ||  | || ||||| ||||||
Sbjct: 1276830 ggggcaggacccttcctgatacggccggagatgtcgtagtgagaaccgtggcaggggcag 1276771

                                
Query: 94      aaccaancaccaaagtc 110
               |||||  | ||||||||
Sbjct: 1276770 aaccagccgccaaagtc 1276754

---

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 44/53 (83%)
 Strand = Plus / Minus

                                                                   
Query: 46     ttgcggattctgccagagatgtcgtantggnagccatggcacgggcagaacca 98
              |||||||| | ||||||| | ||||| ||  |||| ||||| |||||||||||
Sbjct: 288687 ttgcggatccggccagaggtatcgtagtgcgagccgtggcaggggcagaacca 288635

---

>ref|XM_515143.1| PREDICTED: Pan troglodytes similar to voltage-dependent T-type calcium
             channel alpha-1I subunit isoform a (LOC458848), mRNA
          Length = 10542

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 133   caaccaagatgagtgcagacacc 155
             ||||||||||||||||| |||||
Sbjct: 10283 caaccaagatgagtgcaaacacc 10261

---

>ref|XM_512557.1| PREDICTED: Pan troglodytes similar to ubiquinol-cytochrome c
           oxidoreductase subunit 9 and Rieske iron sulfur protein
           (LOC455911), mRNA
          Length = 2430

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||||||||||||||| |||||
Sbjct: 563 caaccaagatgagtgcaaacacc 541

---

>gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome 14, complete sequence
          Length = 200560

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 110    cttcagagttgggaagggg 128
              |||||||||||||||||||
Sbjct: 180772 cttcagagttgggaagggg 180790

---

>ref|NM_001008888.1| Rattus norvegicus ubiquinol-cytochrome c reductase, Rieske
           iron-sulfur polypeptide 1 (Uqcrfs1), mRNA
          Length = 1110

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 720 caaccaagatgagtacagacacc 698

---

>ref|NM_174813.2| Bos taurus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1 (UQCRFS1), mRNA
          Length = 1112

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||||||||||||||| |||||
Sbjct: 665 caaccaagatgagtgcaaacacc 643

---

>ref|XM_359684.1| Magnaporthe grisea 70-15 hypothetical protein (MG05093.4) partial
           mRNA
          Length = 711

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||||||||| |||||||||||
Sbjct: 551 caaccaagatgtgtgcagacacc 529

---

>gb|AY387508.1|AY387507S2 Colobus polykomos ubiquinol-cytochrome c oxidoreductase subunit 9
           and Rieske iron sulfur protein (ISP) gene, exon 2 and
           complete cds
          Length = 611

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||||||||||||||| |||||
Sbjct: 451 caaccaagatgagtgcaaacacc 429

---

>gb|AY387502.1|AY387501S2 Pongo pygmaeus ubiquinol-cytochrome c oxidoreductase subunit 9 and
           Rieske iron sulfur protein (ISP) gene, exon 2 and
           complete cds
          Length = 611

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||||||||||||||| |||||
Sbjct: 451 caaccaagatgagtgcaaacacc 429

---

>gb|AY387498.1|AY387497S2 Pan troglodytes ubiquinol-cytochrome c oxidoreductase subunit 9 and
           Rieske iron sulfur protein (ISP) gene, exon 2 and
           complete cds
          Length = 611

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||||||||||||||| |||||
Sbjct: 451 caaccaagatgagtgcaaacacc 429

---

>gb|AY387496.1|AY387495S2 Pan paniscus ubiquinol-cytochrome c oxidoreductase subunit 9 and
           Rieske iron sulfur protein (ISP) gene, exon 2 and
           complete cds
          Length = 611

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||||||||||||||| |||||
Sbjct: 451 caaccaagatgagtgcaaacacc 429

---

>gb|BC019934.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1, mRNA (cDNA clone MGC:30985
           IMAGE:5249225), complete cds
          Length = 1194

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 741 caaccaagatgagtacagacacc 719

---

>gb|BC115994.1| Bos taurus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1, mRNA (cDNA clone MGC:140068
           IMAGE:8041037), complete cds
          Length = 1117

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||||||||||||||| |||||
Sbjct: 719 caaccaagatgagtgcaaacacc 697

---

>gb|AY539946.1| Rattus norvegicus LRRGT00195 mRNA, complete cds
          Length = 825

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 665 caaccaagatgagtacagacacc 643

---

>ref|XM_748490.1| Aspergillus fumigatus Af293 ubiquinol-cytochrome c reductase
           iron-sulfur subunit precursor (Afu5g10610) partial mRNA
          Length = 897

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 53/65 (81%)
 Strand = Plus / Minus

                                                                       
Query: 34  ggggcagggcccttgcggattctgccagagatgtcgtantggnagccatggcacgggcag 93
           |||||||| ||||| ||||| | ||| ||||| || || ||| | || ||||| ||||||
Sbjct: 836 ggggcaggacccttccggatacggccggagatatcatagtgggaaccgtggcaggggcag 777

                
Query: 94  aacca 98
           |||||
Sbjct: 776 aacca 772

---

>emb|CR956381.6| Pig DNA sequence from clone CH242-248C21 on chromosome 17, complete
            sequence
          Length = 58781

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 105  aaagtcttcagagttgggaagggggat 131
            ||||||| |||||| ||||||||||||
Sbjct: 1211 aaagtctacagagtagggaagggggat 1185

---

>ref|XM_533711.2| PREDICTED: Canis familiaris similar to ubiquinol-cytochrome c
           reductase, Rieske iron-sulfur polypeptide 1 (LOC476503),
           mRNA
          Length = 1133

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||| |||||||||||||||||
Sbjct: 703 caaccgagatgagtgcagacacc 681

---

>gb|AC092728.2| Canis familiaris clone RP81-237O17, complete sequence
          Length = 141578

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 117    gttgggaagggggatgcaa 135
              |||||||||||||||||||
Sbjct: 119865 gttgggaagggggatgcaa 119847

---

>emb|CR956417.1| Pig DNA sequence from clone CH242-300K12 on chromosome 17, complete
              sequence
          Length = 176004

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 105    aaagtcttcagagttgggaagggggat 131
              ||||||| |||||| ||||||||||||
Sbjct: 175215 aaagtctacagagtagggaagggggat 175189

---

>emb|Z82206.1|HS370M22 Human DNA sequence from clone RP3-370M22 on chromosome 22, complete
             sequence
          Length = 143747

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 133   caaccaagatgagtgcagacacc 155
             ||||||||||||||||| |||||
Sbjct: 21457 caaccaagatgagtgcaaacacc 21435

---

>emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on chromosome 13 Contains the
             gene for the ortholog of rat and human
             ubiquinol-cytochrome c reductase, Rieske iron-sulfur
             polypeptide 1 UQCRFS1, a novel gene and a CpG island,
             complete sequence
          Length = 194065

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 133   caaccaagatgagtgcagacacc 155
             |||||||||||||| ||||||||
Sbjct: 77391 caaccaagatgagtacagacacc 77413

---

>gb|BC085339.1| Rattus norvegicus ubiquinol-cytochrome c reductase, Rieske
           iron-sulfur polypeptide 1, mRNA (cDNA clone MGC:105530
           IMAGE:7302533), complete cds
          Length = 1110

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 720 caaccaagatgagtacagacacc 698

---

>emb|CR592425.1| full-length cDNA clone CS0DB008YM18 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 855

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||||||||||||||| |||||
Sbjct: 414 caaccaagatgagtgcaaacacc 392

---

>dbj|AK152391.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830067N02
           product:ubiquinol-cytochrome c reductase, Rieske
           iron-sulfur polypeptide 1, full insert sequence
          Length = 1200

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 746 caaccaagatgagtacagacacc 724

---

>dbj|AK153139.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830124H22
           product:ubiquinol-cytochrome c reductase, Rieske
           iron-sulfur polypeptide 1, full insert sequence
          Length = 1084

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 721 caaccaagatgagtacagacacc 699

---

>gb|S58789.1| Bos taurus Rieske iron-sulfur mRNA, complete cds; nuclear gene for
           mitochondrial product
          Length = 1043

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||||||||||||||| |||||
Sbjct: 677 caaccaagatgagtgcaaacacc 655

---

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 37/44 (84%)
 Strand = Plus / Minus

                                                          
Query: 67     tcgtantggnagccatggcacgggcagaaccaancaccaaagtc 110
              ||||| ||| | || ||||| |||||||||||  ||||||||||
Sbjct: 508718 tcgtagtgggaaccgtggcatgggcagaaccagccaccaaagtc 508675

---

>dbj|AK012180.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610528M22
           product:UBIQUINOL-CYTOCHROME C REDUCTASE IRON-SULFUR
           SUBUNIT, MITOCHONDRIAL PRECURSOR (EC 1.10.2.2) (RIESKE
           IRON-SULFUR PROTEIN) (RISP) [CONTAINS:
           UBIQUINOL-CYTOCHROME C REDUCTASE 8 KDA PROTEIN (COMPLEX
           III SUBUNIT IX)] homolog [Bos taurus], full insert
           sequence
          Length = 1048

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 685 caaccaagatgagtacagacacc 663

---

>dbj|AK014470.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:4430402G14 product:UBIQUINOL-CYTOCHROME C
           REDUCTASE IRON-SULFUR SUBUNIT, MITOCHONDRIAL PRECURSOR
           (EC 1.10.2.2) (RIESKE IRON-SULFUR PROTEIN) (RISP)
           [CONTAINS: UBIQUINOL-CYTOCHROME C REDUCTASE 8 KDA
           PROTEIN (COMPLEX III SUBUNIT IX)] homolog [Bos taurus],
           full insert sequence
          Length = 1316

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 737 caaccaagatgagtacagacacc 715

---

>dbj|AK003966.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110030B05
           product:ubiquinol-cytochrome c reductase, Rieske
           iron-sulfur polypeptide 1, full insert sequence
          Length = 1060

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 697 caaccaagatgagtacagacacc 675

---

>ref|NM_025710.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1 (Uqcrfs1), mRNA
          Length = 1316

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 737 caaccaagatgagtacagacacc 715

---

>dbj|AK217705.1| Mus musculus cDNA, clone:Y2G0142L01, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 378

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 231 caaccaagatgagtacagacacc 209

---

>dbj|AK216624.1| Mus musculus cDNA, clone:Y2G0138P18, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 305

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 231 caaccaagatgagtacagacacc 209

---

>dbj|AK212564.1| Mus musculus cDNA, clone:Y2G0125G04, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 336

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 231 caaccaagatgagtacagacacc 209

---

>dbj|AK210928.1| Mus musculus cDNA, clone:Y2G0120B13, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 384

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 219 caaccaagatgagtacagacacc 197

---

>dbj|AK180820.1| Mus musculus cDNA, clone:Y0G0116A06, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 435

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 270 caaccaagatgagtacagacacc 248

---

>ref|NM_210148.1| Eremothecium gossypii AEL067Wp (AEL067W), mRNA
          Length = 639

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 37/44 (84%)
 Strand = Plus / Minus

                                                       
Query: 67  tcgtantggnagccatggcacgggcagaaccaancaccaaagtc 110
           ||||| ||| | || ||||| |||||||||||  ||||||||||
Sbjct: 548 tcgtagtgggaaccgtggcatgggcagaaccagccaccaaagtc 505

---

>emb|AL049548.6|HSDJ398G3 Human DNA sequence from clone RP3-398G3 on chromosome 6q25.1-25.3
             Contains the 3' part of the gene for a novel protein
             containing CH domains (contains KIAA1756, FLJ30878 and the
             likely ortholog of rat CPG2), four novel genes and the 5'
             part of a novel gene, complete sequence
          Length = 86478

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 138   aagatgagtgcagacacca 156
             |||||||||||||||||||
Sbjct: 35912 aagatgagtgcagacacca 35894

---

>gb|BC047125.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1, mRNA (cDNA clone IMAGE:5009388)
          Length = 1194

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 741 caaccaagatgagtacagacacc 719

---

>emb|AL772395.12| Mouse DNA sequence from clone RP23-39O1 on chromosome 4, complete
             sequence
          Length = 183256

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   aaagtcttcagagttggga 123
             |||||||||||||||||||
Sbjct: 30033 aaagtcttcagagttggga 30015

---

>gb|M24542.1|RATRIP Rat Rieske iron-sulfur protein mRNA, complete cds
          Length = 912

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           |||||||||||||| ||||||||
Sbjct: 611 caaccaagatgagtacagacacc 589

---

>gb|M34336.1|BOVFESUP Bovine Rieske iron-sulfur protein mRNA, complete cds
          Length = 1112

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 133 caaccaagatgagtgcagacacc 155
           ||||||||||||||||| |||||
Sbjct: 665 caaccaagatgagtgcaaacacc 643


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 879,312
Number of Sequences: 3902068
Number of extensions: 879312
Number of successful extensions: 57574
Number of sequences better than 10.0: 90
Number of HSP's better than 10.0 without gapping: 90
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57319
Number of HSP's gapped (non-prelim): 250
length of query: 167
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 145
effective length of database: 17,147,199,772
effective search space: 2486343966940
effective search space used: 2486343966940
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)

---