ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags11c15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL512430.14| Human DNA sequence from clone RP11-346C16 on ch... 46 0.033
2ref|XM_809128.1| Trypanosoma cruzi strain CL Brener dispersed ge... 40 2.0
3ref|XM_813798.1| Trypanosoma cruzi strain CL Brener dispersed ge... 40 2.0
4gb|AY366525.1| Porcine reproductive and respiratory syndrome vir... 38 8.1
5gb|AC126672.3| Mus musculus BAC clone RP24-473A18 from chromosom... 38 8.1
6ref|XM_816808.1| Trypanosoma cruzi strain CL Brener dispersed ge... 38 8.1
7ref|XM_816818.1| Trypanosoma cruzi strain CL Brener dispersed ge... 38 8.1
8ref|XM_800396.1| Trypanosoma cruzi strain CL Brener dispersed ge... 38 8.1
9ref|XM_808167.1| Trypanosoma cruzi strain CL Brener dispersed ge... 38 8.1
10gb|AC174360.8| Medicago truncatula clone mth2-31a5, complete seq... 38 8.1
11emb|AL732390.10| Mouse DNA sequence from clone RP23-413O19 on ch... 38 8.1
12dbj|AB087258.1| Histophilus somni ibpB, ibpA, tbpA genes for out... 38 8.1
13gb|AC159278.3| Mus musculus BAC clone RP23-361M12 from chromosom... 38 8.1
14emb|AL928554.24| Mouse DNA sequence from clone RP23-131H7 on chr... 38 8.1
15gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 38 8.1
16gb|AC140488.4| Mus musculus BAC clone RP24-142A8 from 9, complet... 38 8.1
17emb|AL732498.15| Mouse DNA sequence from clone RP23-323E6 on chr... 38 8.1
18emb|AL831761.9| Mouse DNA sequence from clone RP23-318H16 on chr... 38 8.1
19emb|AL732482.8| Mouse DNA sequence from clone RP23-199C21 on chr... 38 8.1

>emb|AL512430.14| Human DNA sequence from clone RP11-346C16 on chromosome 6 Contains the 3'
              part of gene KIAA1028, a pseudogene similar to ribosomal
              protein S19 (RPS19), a pseudogene similar to protein
              phosphatases, a ribosomal protein S20 (RPS20) pseudogene
              and a CpG island, complete sequence
          Length = 189098

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 16     acccaaatacagtacaggaaatagtta 42
              ||||||||||||| |||||||||||||
Sbjct: 173647 acccaaatacagtccaggaaatagtta 173673



to top

>ref|XM_809128.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1
            (DGF-1) (Tc00.1047053510201.50) partial mRNA
          Length = 10449

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 50   gaaagcttggcaaagagtgc 69
            ||||||||||||||||||||
Sbjct: 3497 gaaagcttggcaaagagtgc 3478



to top

>ref|XM_813798.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1
            (DGF-1) (Tc00.1047053510197.110) partial mRNA
          Length = 10452

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 50   gaaagcttggcaaagagtgc 69
            ||||||||||||||||||||
Sbjct: 3494 gaaagcttggcaaagagtgc 3475



to top

>gb|AY366525.1| Porcine reproductive and respiratory syndrome virus strain EuroPRRSV,
            complete genome
          Length = 15047

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 55   cttggcaaagagtgcagag 73
            |||||||||||||||||||
Sbjct: 2336 cttggcaaagagtgcagag 2318



to top

>gb|AC126672.3| Mus musculus BAC clone RP24-473A18 from chromosome 9, complete sequence
          Length = 191730

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 50     gaaagcttggcaaagagtgcagagaga 76
              |||| |||||||||||||||| |||||
Sbjct: 187548 gaaaacttggcaaagagtgcaaagaga 187522



to top

>ref|XM_816808.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1
            (DGF-1) (Tc00.1047053511183.140) partial mRNA
          Length = 10467

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 51   aaagcttggcaaagagtgc 69
            |||||||||||||||||||
Sbjct: 3496 aaagcttggcaaagagtgc 3478



to top

>ref|XM_816818.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1
            (DGF-1) (Tc00.1047053511183.460) partial mRNA
          Length = 10473

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 51   aaagcttggcaaagagtgc 69
            |||||||||||||||||||
Sbjct: 3496 aaagcttggcaaagagtgc 3478



to top

>ref|XM_800396.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1
           (DGF-1) (Tc00.1047053508249.10) partial mRNA
          Length = 7831

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 51  aaagcttggcaaagagtgc 69
           |||||||||||||||||||
Sbjct: 881 aaagcttggcaaagagtgc 863



to top

>ref|XM_808167.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1
            (DGF-1) (Tc00.1047053510237.129) partial mRNA
          Length = 8097

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 51   aaagcttggcaaagagtgc 69
            |||||||||||||||||||
Sbjct: 3493 aaagcttggcaaagagtgc 3475



to top

>gb|AC174360.8| Medicago truncatula clone mth2-31a5, complete sequence
          Length = 99153

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 87    tgatgttacacaaggctac 105
             |||||||||||||||||||
Sbjct: 66232 tgatgttacacaaggctac 66250



to top

>emb|AL732390.10| Mouse DNA sequence from clone RP23-413O19 on chromosome 11 Contains a
             laminin receptor 1 (ribosomal protein SA) (Lamr1)
             pseudogene, a novel gene, the 3' end of the Fgf18 gene for
             fibroblast growth factor 18 and a CpG island, complete
             sequence
          Length = 195612

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 60    caaagagtgcagagagaca 78
             |||||||||||||||||||
Sbjct: 33749 caaagagtgcagagagaca 33731



to top

>dbj|AB087258.1| Histophilus somni ibpB, ibpA, tbpA genes for outer membrane
            transporter protein, high molecular weight-immunoglobulin
            binding proteins, hypothetical proteins, complete cds
          Length = 16894

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 83   aatttgatgttacacaagg 101
            |||||||||||||||||||
Sbjct: 3611 aatttgatgttacacaagg 3629



to top

>gb|AC159278.3| Mus musculus BAC clone RP23-361M12 from chromosome 1, complete sequence
          Length = 180181

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     gtgcagagagacacaacaa 84
              |||||||||||||||||||
Sbjct: 137414 gtgcagagagacacaacaa 137396



to top

>emb|AL928554.24| Mouse DNA sequence from clone RP23-131H7 on chromosome 1, complete
             sequence
          Length = 195568

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    gtgcagagagacacaacaa 84
             |||||||||||||||||||
Sbjct: 56539 gtgcagagagacacaacaa 56557



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 144     cgtcacggtacgagggacg 162
               |||||||||||||||||||
Sbjct: 2118095 cgtcacggtacgagggacg 2118113



to top

>gb|AC140488.4| Mus musculus BAC clone RP24-142A8 from 9, complete sequence
          Length = 185649

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 50     gaaagcttggcaaagagtgcagagaga 76
              |||| |||||||||||||||| |||||
Sbjct: 100637 gaaaacttggcaaagagtgcaaagaga 100611



to top

>emb|AL732498.15| Mouse DNA sequence from clone RP23-323E6 on chromosome 4, complete
              sequence
          Length = 145881

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 60     caaagagtgcagagagaca 78
              |||||||||||||||||||
Sbjct: 144127 caaagagtgcagagagaca 144145



to top

>emb|AL831761.9| Mouse DNA sequence from clone RP23-318H16 on chromosome 4, complete
             sequence
          Length = 179556

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 48    cggaaagcttggcaaagag 66
             |||||||||||||||||||
Sbjct: 27115 cggaaagcttggcaaagag 27097



to top

>emb|AL732482.8| Mouse DNA sequence from clone RP23-199C21 on chromosome 4, complete
           sequence
          Length = 191239

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 60  caaagagtgcagagagaca 78
           |||||||||||||||||||
Sbjct: 246 caaagagtgcagagagaca 264


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,194,735
Number of Sequences: 3902068
Number of extensions: 1194735
Number of successful extensions: 91438
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91396
Number of HSP's gapped (non-prelim): 42
length of query: 166
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 144
effective length of database: 17,147,199,772
effective search space: 2469196767168
effective search space used: 2469196767168
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top