ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags11a07 |
|---|---|
| Clone Library Name | barley_pub |
>emb|CT009489.6| Mouse DNA sequence from clone RP23-97F8 on chromosome 14, complete sequence Length = 150382 Score = 44.1 bits (22), Expect = 0.087 Identities = 22/22 (100%) Strand = Plus / Minus Query: 50 tttttcctttcttttgtctgcc 71 |||||||||||||||||||||| Sbjct: 4947 tttttcctttcttttgtctgcc 4926
>gb|AC124408.4| Mus musculus BAC clone RP24-262E22 from chromosome 14, complete sequence Length = 159082 Score = 44.1 bits (22), Expect = 0.087 Identities = 22/22 (100%) Strand = Plus / Minus Query: 50 tttttcctttcttttgtctgcc 71 |||||||||||||||||||||| Sbjct: 104580 tttttcctttcttttgtctgcc 104559
>gb|AY958085.1| Staurastrum punctulatum chloroplast, complete genome Length = 157089 Score = 42.1 bits (21), Expect = 0.34 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 aatttttcctttcttttgtct 68 ||||||||||||||||||||| Sbjct: 74677 aatttttcctttcttttgtct 74697
>emb|BX914216.14| Zebrafish DNA sequence from clone RP71-25N17 in linkage group 18, complete sequence Length = 72914 Score = 42.1 bits (21), Expect = 0.34 Identities = 21/21 (100%) Strand = Plus / Plus Query: 50 tttttcctttcttttgtctgc 70 ||||||||||||||||||||| Sbjct: 28853 tttttcctttcttttgtctgc 28873
>gb|AC146691.5| Macaca mulatta clone ch250-214a10, complete sequence Length = 152056 Score = 42.1 bits (21), Expect = 0.34 Identities = 21/21 (100%) Strand = Plus / Plus Query: 51 ttttcctttcttttgtctgcc 71 ||||||||||||||||||||| Sbjct: 10278 ttttcctttcttttgtctgcc 10298
>emb|BX908395.15| Zebrafish DNA sequence from clone DKEY-242H9 in linkage group 18, complete sequence Length = 130348 Score = 42.1 bits (21), Expect = 0.34 Identities = 21/21 (100%) Strand = Plus / Minus Query: 50 tttttcctttcttttgtctgc 70 ||||||||||||||||||||| Sbjct: 51846 tttttcctttcttttgtctgc 51826
>gb|AF195646.1| Sparus aurata growth hormone gene, complete cds Length = 4276 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 cgaggttctgagaaacaatg 25 |||||||||||||||||||| Sbjct: 2921 cgaggttctgagaaacaatg 2902
>gb|AF411339.1| Homo sapiens brain-derived neurotrophic factor opposite strand (BDNFOS) gene, partial sequence; and brain-derived neurotrophic factor (BDNF) gene, complete cds Length = 115886 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 ttcctttcttttgtctgcca 72 |||||||||||||||||||| Sbjct: 48858 ttcctttcttttgtctgcca 48877
>ref|XM_863863.1| PREDICTED: Bos taurus similar to Carbonyl reductase [NADPH] 1 (NADPH-dependent carbonyl reductase 1) (Prostaglandin-E(2) 9-reductase) (Prostaglandin 9-ketoreductase) (15-hydroxyprostaglandin dehydrogenase [NADP+]) (LOC613272), mRNA Length = 984 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 tttttcctttcttttgtctg 69 |||||||||||||||||||| Sbjct: 848 tttttcctttcttttgtctg 829
>gb|AC147337.3| Pan troglodytes BAC clone CH251-104M9 from Y, complete sequence Length = 168027 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 gtatcccaattctgtgctca 94 |||||||||||||||||||| Sbjct: 10937 gtatcccaattctgtgctca 10956
>gb|AC146249.2| Pan troglodytes BAC clone CH251-140O11 from Y, complete sequence Length = 173078 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 gtatcccaattctgtgctca 94 |||||||||||||||||||| Sbjct: 161293 gtatcccaattctgtgctca 161312
>emb|BX664739.3| Human DNA sequence from clone WI2-89031B12 on chromosome X Contains the FAM3A gene for family with sequence similarity, the SLC10A3 3 gene for solute carrier family 10 (sodium/bile acid cotransporter family) member 3, the UBL4 gene for ubiquitin-like 4 and three CpG islands, complete sequence Length = 41279 Score = 40.1 bits (20), Expect = 1.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 48 aatttttcctttcttttgtctgcc 71 ||||||||||||||| |||||||| Sbjct: 17718 aatttttcctttcttatgtctgcc 17695
>gb|AC087446.13| Homo sapiens chromosome 11, clone RP11-651M4, complete sequence Length = 167865 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 ttcctttcttttgtctgcca 72 |||||||||||||||||||| Sbjct: 100815 ttcctttcttttgtctgcca 100834
>gb|AC103796.3| Homo sapiens chromosome 11, clone RP11-1033A18, complete sequence Length = 211799 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 53 ttcctttcttttgtctgcca 72 |||||||||||||||||||| Sbjct: 8414 ttcctttcttttgtctgcca 8395
>dbj|BS000599.1| Pan troglodytes chromosome Y clone:PTB-225K16, complete sequences Length = 105000 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 gtatcccaattctgtgctca 94 |||||||||||||||||||| Sbjct: 54359 gtatcccaattctgtgctca 54378
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 75 gtatcccaattctgtgctca 94 |||||||||||||||||||| Sbjct: 22372246 gtatcccaattctgtgctca 22372227
>gb|AC040965.8| Homo sapiens chromosome 8, clone RP11-481K20, complete sequence Length = 189188 Score = 40.1 bits (20), Expect = 1.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 30 agcaaagcaagaatggtnaattt 52 ||||||||||||||||| ||||| Sbjct: 185305 agcaaagcaagaatggtgaattt 185283
>gb|AC090056.2|AC090056 Oryza sativa chromosome 9 clone PAC0663H05, complete sequence Length = 161873 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ctgccatggtatcccaattc 86 |||||||||||||||||||| Sbjct: 161785 ctgccatggtatcccaattc 161804
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 ctgccatggtatcccaattc 86 |||||||||||||||||||| Sbjct: 6268118 ctgccatggtatcccaattc 6268099
>gb|AC145688.4| Pan troglodytes BAC clone CH251-346A10 from chromosome x, complete sequence Length = 174819 Score = 40.1 bits (20), Expect = 1.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 48 aatttttcctttcttttgtctgcc 71 ||||||||||||||| |||||||| Sbjct: 23186 aatttttcctttcttatgtctgcc 23163
>gb|AC104563.14| Homo sapiens chromosome 11, clone RP11-587D21, complete sequence Length = 141200 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 53 ttcctttcttttgtctgcca 72 |||||||||||||||||||| Sbjct: 125580 ttcctttcttttgtctgcca 125561
>dbj|AP006758.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0663H05 Length = 161938 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 ctgccatggtatcccaattc 86 |||||||||||||||||||| Sbjct: 397 ctgccatggtatcccaattc 378
>dbj|AP005562.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1190_B07 Length = 140200 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 ctgccatggtatcccaattc 86 |||||||||||||||||||| Sbjct: 113401 ctgccatggtatcccaattc 113382
>gb|L44140.1|HUMFLNG6PD Homo sapiens chromosome X region from filamin (FLN) gene to glucose-6-phosphate dehydrogenase (G6PD) gene, complete cds's Length = 219447 Score = 40.1 bits (20), Expect = 1.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 48 aatttttcctttcttttgtctgcc 71 ||||||||||||||| |||||||| Sbjct: 167982 aatttttcctttcttatgtctgcc 167959
>emb|X55448.1|HSG6PDGEN H.sapiens G6PD gene for glucose-6-phosphate dehydrogenase Length = 52173 Score = 40.1 bits (20), Expect = 1.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 48 aatttttcctttcttttgtctgcc 71 ||||||||||||||| |||||||| Sbjct: 51466 aatttttcctttcttatgtctgcc 51489
>dbj|AP002350.3| Homo sapiens genomic DNA, chromosome 11q, clone:CTD-2552C2 Length = 109381 Score = 40.1 bits (20), Expect = 1.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 41 aatggtnaatttttcctttcttt 63 |||||| |||||||||||||||| Sbjct: 25053 aatggtcaatttttcctttcttt 25031
>gb|DP000016.1| Pan troglodytes target 1 genomic scaffold Length = 1623484 Score = 38.2 bits (19), Expect = 5.4 Identities = 21/22 (95%) Strand = Plus / Plus Query: 44 ggtnaatttttcctttcttttg 65 ||| |||||||||||||||||| Sbjct: 285986 ggtcaatttttcctttcttttg 286007
>gb|AC087512.2| Pan troglodytes clone RP43-144M20, complete sequence Length = 120797 Score = 38.2 bits (19), Expect = 5.4 Identities = 21/22 (95%) Strand = Plus / Plus Query: 44 ggtnaatttttcctttcttttg 65 ||| |||||||||||||||||| Sbjct: 75164 ggtcaatttttcctttcttttg 75185
>gb|AC147106.2| Pan troglodytes BAC clone RP43-15F7 from 7, complete sequence Length = 193107 Score = 38.2 bits (19), Expect = 5.4 Identities = 21/22 (95%) Strand = Plus / Minus Query: 44 ggtnaatttttcctttcttttg 65 ||| |||||||||||||||||| Sbjct: 139421 ggtcaatttttcctttcttttg 139400
>gb|AC146205.2| Pan troglodytes BAC clone RP43-34B6 from 7, complete sequence Length = 187725 Score = 38.2 bits (19), Expect = 5.4 Identities = 21/22 (95%) Strand = Plus / Plus Query: 44 ggtnaatttttcctttcttttg 65 ||| |||||||||||||||||| Sbjct: 86191 ggtcaatttttcctttcttttg 86212
>gb|AC161199.4| Mus musculus chromosome 15, clone RP23-383D13, complete sequence Length = 218523 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 tttttcctttcttttgtct 68 ||||||||||||||||||| Sbjct: 51177 tttttcctttcttttgtct 51195
>gb|AY330874.1| Cynomorium coccineum clone Cyno_5 23S large subunit ribosomal RNA gene, partial sequence; chloroplast gene for chloroplast product Length = 2737 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 57 tttcttttgtctgccatgg 75 ||||||||||||||||||| Sbjct: 164 tttcttttgtctgccatgg 146
>ref|XM_744410.1| Aspergillus fumigatus Af293 cell polarity protein (Afu2g03710) partial mRNA Length = 2826 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 27 cgcagcaaagcaagaatgg 45 ||||||||||||||||||| Sbjct: 1305 cgcagcaaagcaagaatgg 1323
>gb|AC122365.4| Mus musculus BAC clone RP23-447A7 from chromosome 5, complete sequence Length = 195492 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 tttttcctttcttttgtct 68 ||||||||||||||||||| Sbjct: 81944 tttttcctttcttttgtct 81962
>gb|AC109603.8| Mus musculus strain 129/Sv clone ct7-534h6 map 5, complete sequence Length = 81390 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 tttttcctttcttttgtct 68 ||||||||||||||||||| Sbjct: 44202 tttttcctttcttttgtct 44184
>emb|BX248088.18| Human DNA sequence from clone DAQB-126H3 on chromosome 6 Contains the TAPBP gene for TAP binding protein (tapasin), the ZNF297 gene for zinc finger protein 297, the DAXX gene for death-associated protein 6, the MYL8P pseudogene for myosin, light polypeptide 8, the LYPLA2P1 pseudogene for lysophospholipase II pseudogene 1, the KIFC1 gene for kinesin family member C1, the RPL12P1 pseudogene for ribosomal protein L12 pseudogene 1, the 5'end of the PHF1 gene for PHD finger protein 1, and 6 CpG islands, complete sequence Length = 114575 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 tttttcctttcttttgtct 68 ||||||||||||||||||| Sbjct: 27177 tttttcctttcttttgtct 27195
>emb|Z97183.1|HSICB2046 Human DNA sequence from clone ICRF6c-CB2046 on chromosome 6 Contains a myosin regulatory light chain 2 pseudogene, the DAXX gene for death-associated protein 6 (Fas-binding protein), the ZNF297 gene for zinc finger protein 297 (BING1), the 5' end of the TAPBP gene for TAP binding protein (tapasin). Contains ESTs, STSs, GSSs and three CpG islands, complete sequence Length = 39872 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 tttttcctttcttttgtct 68 ||||||||||||||||||| Sbjct: 26403 tttttcctttcttttgtct 26385
>emb|AL662820.6| Human DNA sequence from clone XXbac-185D15 on chromosome 6 contains the RPS18 gene for ribosomal protein S18, the B3GALT4 gene for UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4, the C6ORF11 gene for chromosome 6 open reading frame 11, the HKE2 gene for HLA class II region expressed gene 2, the RAB2L gene for RAB2, member RAS oncogene family-like, the TAPBP gene for TAP binding protein (tapasin), the ZNF297 gene for zinc finger protein 297, the DAXX gene for death-associated protein 6, a myosin, light polypeptide 8, pseudogene (MYL8P) and seven CpG islands, complete sequence Length = 78635 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 tttttcctttcttttgtct 68 ||||||||||||||||||| Sbjct: 53565 tttttcctttcttttgtct 53583
>emb|AL662827.3| Human DNA sequence from clone XXbac-165D10 on chromosome 6 contains the 3' end of the RPS18 gene for ribosomal protein S18, the gene for chromosome 6 open reading frame 11, the HKE2 gene for HLA class II region expressed gene 2, the RAB2L gene for RAB2, member RAS oncogene family-like, the TAPBP gene for TAP binding protein (tapasin), the DAXX gene for death-associated protein 6, a myosin, light polypeptide 8, pseudogene, a novel protein similar to lysophospholipase II (LYPLA2) and six CpG islands, complete sequence Length = 110794 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 tttttcctttcttttgtct 68 ||||||||||||||||||| Sbjct: 51577 tttttcctttcttttgtct 51595
>emb|AL359740.24| Human DNA sequence from clone RP13-204A15 on chromosome X Contains a Np95-like ring finger protein (NIRF) pseudogene, a DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide pseudogene, a makorin ring finger protein, 1 (MKRN1) pseudogene and two CpG islands, complete sequence Length = 98104 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 28 gcagcaaagcaagaatggt 46 ||||||||||||||||||| Sbjct: 64964 gcagcaaagcaagaatggt 64946
>emb|AL161913.11| Human DNA sequence from clone RP11-64P11 on chromosome 9, complete sequence Length = 137897 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 78 tcccaattctgtgctcagt 96 ||||||||||||||||||| Sbjct: 22016 tcccaattctgtgctcagt 22034
>emb|AL669871.18| Mouse DNA sequence from clone RP23-48J15 on chromosome 11 Contains a novel gene and a novel pseudogene, complete sequence Length = 208519 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 7 gaggttctgagaaacaatg 25 ||||||||||||||||||| Sbjct: 117844 gaggttctgagaaacaatg 117862
>emb|CR759786.5| Human DNA sequence from clone DAMC-227D19 on chromosome 6, complete sequence Length = 123399 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 tttttcctttcttttgtct 68 ||||||||||||||||||| Sbjct: 123265 tttttcctttcttttgtct 123283
>emb|CR759793.3| Human DNA sequence from clone DAMC-283P18 on chromosome 6, complete sequence Length = 69184 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 tttttcctttcttttgtct 68 ||||||||||||||||||| Sbjct: 1866 tttttcctttcttttgtct 1884
>emb|CR759817.3| Human DNA sequence from clone DADB-159G18 on chromosome 6, complete sequence Length = 108902 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 tttttcctttcttttgtct 68 ||||||||||||||||||| Sbjct: 72168 tttttcctttcttttgtct 72186
>gb|AC083795.5| Homo sapiens BAC clone RP11-255I10 from 4, complete sequence Length = 185371 Score = 38.2 bits (19), Expect = 5.4 Identities = 25/27 (92%) Strand = Plus / Minus Query: 50 tttttcctttcttttgtctgccatggt 76 ||||||||||||||| |||||| |||| Sbjct: 132352 tttttcctttcttttttctgccttggt 132326
>gb|AC096670.1| Homo sapiens BAC clone RP11-438K19 from 2, complete sequence Length = 181497 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 ttttcctttcttttgtctg 69 ||||||||||||||||||| Sbjct: 89038 ttttcctttcttttgtctg 89020
>gb|AC131958.1| Homo sapiens BAC clone RP11-62O19 from 2, complete sequence Length = 31484 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 49 atttttcctttcttttgtc 67 ||||||||||||||||||| Sbjct: 21620 atttttcctttcttttgtc 21602
>gb|AC107808.20| Mus musculus chromosome 9, clone RP23-61B14, complete sequence Length = 188589 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 60 cttttgtctgccatggtat 78 ||||||||||||||||||| Sbjct: 116107 cttttgtctgccatggtat 116089 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,321,205 Number of Sequences: 3902068 Number of extensions: 1321205 Number of successful extensions: 130107 Number of sequences better than 10.0: 49 Number of HSP's better than 10.0 without gapping: 49 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 129914 Number of HSP's gapped (non-prelim): 193 length of query: 117 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 96 effective length of database: 17,151,101,840 effective search space: 1646505776640 effective search space used: 1646505776640 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
