>emb|AL590065.3| Human DNA sequence from clone RP11-307A17 on chromosome X Contains a
              novel gene (MGC34831) and the 5' end of a novel gene(
              FLJ36601), complete sequence
          Length = 187386

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 398    tgggatgaacaactgaatgat 418
              |||||||||||||||||||||
Sbjct: 137140 tgggatgaacaactgaatgat 137120

>gb|AC099060.2| Homo sapiens chromosome 1 clone RP11-415A20, complete sequence
          Length = 152692

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 402    atgaacaactgaatgattatt 422
              |||||||||||||||||||||
Sbjct: 141324 atgaacaactgaatgattatt 141304

>emb|CT485605.3| RP43-010N04, complete sequence
          Length = 162117

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 398    tgggatgaacaactgaatgat 418
              |||||||||||||||||||||
Sbjct: 115518 tgggatgaacaactgaatgat 115498

>emb|CT485994.3| RP43-077B08, complete sequence
          Length = 140305

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 398    tgggatgaacaactgaatgat 418
              |||||||||||||||||||||
Sbjct: 138841 tgggatgaacaactgaatgat 138821

>gb|AC167172.3| Mus musculus BAC clone RP23-166M7 from chromosome 3, complete sequence
          Length = 204419

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 453   gctgtggctggctccccaaa 472
             ||||||||||||||||||||
Sbjct: 84288 gctgtggctggctccccaaa 84307

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 22      tcaggcaagccggtcatgta 41
               ||||||||||||||||||||
Sbjct: 4283225 tcaggcaagccggtcatgta 4283206

>gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, complete sequence
          Length = 170236

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 627    gcaagtcaatgagaaatact 646
              ||||||||||||||||||||
Sbjct: 111376 gcaagtcaatgagaaatact 111357

>gb|AC138116.4| Mus musculus BAC clone RP24-242H5 from chromosome 15, complete sequence
          Length = 164014

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 387   ccctgattccctgggatgaa 406
             ||||||||||||||||||||
Sbjct: 88301 ccctgattccctgggatgaa 88320

>gb|AC158512.2| Mus musculus BAC clone RP24-319O6 from chromosome 9, complete sequence
          Length = 171723

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 113    ttctgccagggtgcagcccc 132
              ||||||||||||||||||||
Sbjct: 171071 ttctgccagggtgcagcccc 171052

>emb|AL162727.20| Human DNA sequence from clone RP11-168K11 on chromosome 9 Contains the
             3' end of the RGS3 gene for regulator of G-protein
             signalling 3, a novel gene, a novel gene (FLJ31516) and
             the 5' end of a novel gene, complete sequence
          Length = 112099

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 452   tgctgtggctggctccccaa 471
             ||||||||||||||||||||
Sbjct: 30014 tgctgtggctggctccccaa 29995

>gb|AC134420.8| Mus musculus chromosome 15, clone RP23-478J5, complete sequence
          Length = 190455

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 387    ccctgattccctgggatgaa 406
              ||||||||||||||||||||
Sbjct: 145237 ccctgattccctgggatgaa 145218

>emb|CR318639.6| Mouse DNA sequence from clone RP23-317N11 on chromosome 2, complete
              sequence
          Length = 193326

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 387    ccctgattccctgggatgaa 406
              ||||||||||||||||||||
Sbjct: 163357 ccctgattccctgggatgaa 163338



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   ccctgattccctgggatgaa 406
             ||||||||||||||||||||
Sbjct: 63365 ccctgattccctgggatgaa 63346

>emb|CR354442.5| Mouse DNA sequence from clone RP24-562O19 on chromosome 2, complete
             sequence
          Length = 145110

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   ccctgattccctgggatgaa 406
             ||||||||||||||||||||
Sbjct: 99452 ccctgattccctgggatgaa 99433



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 387  ccctgattccctgggatgaa 406
            ||||||||||||||||||||
Sbjct: 1877 ccctgattccctgggatgaa 1858

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 221     tgtctcctcattccccctcg 240
               ||||||||||||||||||||
Sbjct: 9052074 tgtctcctcattccccctcg 9052093

>gb|AC165377.4| Nomascus leucogenys leucogenys clone CH271-412A17, complete sequence
          Length = 195646

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 402   atgaacaactgaatgattat 421
             ||||||||||||||||||||
Sbjct: 83525 atgaacaactgaatgattat 83506

>gb|AC123835.4| Mus musculus BAC clone RP23-365J20 from chromosome 9, complete sequence
          Length = 219799

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 113   ttctgccagggtgcagcccc 132
             ||||||||||||||||||||
Sbjct: 28101 ttctgccagggtgcagcccc 28082

>emb|BX682537.3| Mouse DNA sequence from clone RP23-376N23 on chromosome 2, complete
              sequence
          Length = 186050

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 387    ccctgattccctgggatgaa 406
              ||||||||||||||||||||
Sbjct: 162243 ccctgattccctgggatgaa 162262



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 387    ccctgattccctgggatgaa 406
              ||||||||||||||||||||
Sbjct: 116658 ccctgattccctgggatgaa 116639

>emb|BX511235.10| Mouse DNA sequence from clone RP23-232H13 on chromosome 2, complete
             sequence
          Length = 169581

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   ccctgattccctgggatgaa 406
             ||||||||||||||||||||
Sbjct: 31466 ccctgattccctgggatgaa 31447

>emb|AL845476.15| Mouse DNA sequence from clone RP23-355G16 on chromosome 2, complete
              sequence
          Length = 218484

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 387    ccctgattccctgggatgaa 406
              ||||||||||||||||||||
Sbjct: 128443 ccctgattccctgggatgaa 128462

>emb|BX000428.10| Mouse DNA sequence from clone RP23-474G7 on chromosome X, complete
              sequence
          Length = 162246

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 387    ccctgattccctgggatgaa 406
              ||||||||||||||||||||
Sbjct: 101322 ccctgattccctgggatgaa 101341

>emb|AL732455.6| Zebrafish DNA sequence from clone CH211-225J17 in linkage group 7,
              complete sequence
          Length = 192578

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 35     tcatgtatatatccttcagatatt 58
              ||||||||||| ||||||||||||
Sbjct: 157381 tcatgtatatacccttcagatatt 157358

>emb|BX005071.4| Zebrafish DNA sequence from clone CH211-139O14 in linkage group 7,
             complete sequence
          Length = 174225

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 35    tcatgtatatatccttcagatatt 58
             ||||||||||| ||||||||||||
Sbjct: 82162 tcatgtatatacccttcagatatt 82185

>emb|BX005149.16| Mouse DNA sequence from clone RP24-574J13 on chromosome 2, complete
             sequence
          Length = 179228

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   ccctgattccctgggatgaa 406
             ||||||||||||||||||||
Sbjct: 88912 ccctgattccctgggatgaa 88893

>emb|CT010482.9| Mouse DNA sequence from clone RP23-282O12 on chromosome 2, complete
             sequence
          Length = 188883

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 387   ccctgattccctgggatgaa 406
             ||||||||||||||||||||
Sbjct: 99096 ccctgattccctgggatgaa 99115



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 387  ccctgattccctgggatgaa 406
            ||||||||||||||||||||
Sbjct: 1515 ccctgattccctgggatgaa 1534

>emb|CR955031.3| Mouse DNA sequence from clone RP24-395K22 on chromosome 2, complete
             sequence
          Length = 178000

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 387   ccctgattccctgggatgaa 406
             ||||||||||||||||||||
Sbjct: 86265 ccctgattccctgggatgaa 86284

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 221     tgtctcctcattccccctcg 240
               ||||||||||||||||||||
Sbjct: 9051959 tgtctcctcattccccctcg 9051978

>emb|AL844496.4|CNS08CAT Oryza sativa chromosome 12, . BAC OSJNBb0026N09 of library OSJNBb from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 135462

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 221    tgtctcctcattccccctcg 240
              ||||||||||||||||||||
Sbjct: 120843 tgtctcctcattccccctcg 120862

>emb|AL713903.5|CNS07YQ3 Oryza sativa chromosome 12, . BAC OJ1471_C07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 103007

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 221   tgtctcctcattccccctcg 240
             ||||||||||||||||||||
Sbjct: 66019 tgtctcctcattccccctcg 66000

>emb|CR848808.14| Mouse DNA sequence from clone RP23-442I10 on chromosome 2, complete
              sequence
          Length = 128936

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 387    ccctgattccctgggatgaa 406
              ||||||||||||||||||||
Sbjct: 128813 ccctgattccctgggatgaa 128794



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   ccctgattccctgggatgaa 406
             ||||||||||||||||||||
Sbjct: 31232 ccctgattccctgggatgaa 31213


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,846,032
Number of Sequences: 3902068
Number of extensions: 4846032
Number of successful extensions: 82718
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82581
Number of HSP's gapped (non-prelim): 137
length of query: 653
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 630
effective length of database: 17,143,297,704
effective search space: 10800277553520
effective search space used: 10800277553520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)