ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags10k05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY846825.1| Triticum aestivum ribosomal protein L30 mRNA, com... 482 e-133
2dbj|AK120984.1| Oryza sativa (japonica cultivar-group) cDNA clon... 359 5e-96
3gb|BT018019.1| Zea mays clone EL01N0529A10.c mRNA sequence 331 1e-87
4gb|AY106576.1| Zea mays PCO093173 mRNA sequence 323 3e-85
5ref|NM_191057.1| Oryza sativa (japonica cultivar-group), predic... 212 8e-52
6dbj|AK062929.1| Oryza sativa (japonica cultivar-group) cDNA clon... 212 8e-52
7ref|NM_188088.1| Oryza sativa (japonica cultivar-group), Ozsa852... 186 4e-44
8dbj|AK122128.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 4e-44
9dbj|AK119715.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 4e-44
10dbj|AK058917.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 4e-44
11gb|AF475116.1| Triticum aestivum ribosomal protein L30 mRNA, par... 137 4e-29
12gb|AY107738.1| Zea mays PCO142140 mRNA sequence 135 1e-28
13gb|AF034949.1|AF034949 Zea mays ribosomal protein L30 (rpl30) mR... 135 1e-28
14gb|AC097175.2| Oryza sativa (japonica cultivar-group) chromosome... 125 1e-25
15gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome... 125 1e-25
16dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 125 1e-25
17gb|AY109857.1| Zea mays CL1835_1 mRNA sequence 103 5e-19
18ref|NM_103317.1| Arabidopsis thaliana structural constituent of ... 94 5e-16
19dbj|AP003570.3| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
20dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
21dbj|AP003247.4| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
22dbj|AP000836.1| Oryza sativa (japonica cultivar-group) genomic D... 84 5e-13
23gb|BT012860.1| Lycopersicon esculentum clone 113948F, mRNA sequence 76 1e-10
24emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5... 76 1e-10
25gb|AY674241.1| Ixodes pacificus clone IP_7_60_92_88_CLU ribosoma... 66 1e-07
26emb|AJ223316.1|LLAJ3316 Lupinus luteus mRNA for ribosomal protei... 66 1e-07
27gb|AF366453.1|AF366453 Allium cepa clone AGF176 maintainer line ... 66 1e-07
28gb|AF526198.1| Argopecten irradians isolate iolsaicl2ct3cn3 ribo... 64 4e-07
29gb|DQ066191.1| Ixodes scapularis isolate ISUFL99 ribosomal prote... 62 2e-06
30gb|AC025781.8|AC025781 Arabidopsis thaliana chromosome 1 BAC F15... 62 2e-06
31gb|AY909412.1| Siniperca chuatsi clone C457 60S ribosomal protei... 62 2e-06
32gb|AF227621.1|AF227621 Euphorbia esula 60S ribosomal protein L30... 60 7e-06
33gb|AF401585.1| Ictalurus punctatus ribosomal protein L30 mRNA, c... 58 3e-05
34dbj|AB188378.1| Pelodiscus sinensis PsRPL30 mRNA for ribosomal p... 56 1e-04
35gb|L40477.1|PEAFRR Pisum sativum (clone HW57) gene fragment 56 1e-04
36gb|DQ226656.1| Boechera divaricarpa isolate SLW-6-C09 mRNA sequence 54 4e-04
37emb|CR721155.2|CNS0GJE1 Tetraodon nigroviridis full-length cDNA 54 4e-04
38emb|CR718967.2|CNS0GHP9 Tetraodon nigroviridis full-length cDNA 54 4e-04
39emb|CR718960.2|CNS0GHP2 Tetraodon nigroviridis full-length cDNA 54 4e-04
40emb|CR717748.2|CNS0GGRE Tetraodon nigroviridis full-length cDNA 54 4e-04
41emb|CR717129.2|CNS0GGAA Tetraodon nigroviridis full-length cDNA 54 4e-04
42emb|CR716828.2|CNS0GG1X Tetraodon nigroviridis full-length cDNA 54 4e-04
43emb|CR716264.2|CNS0GFM9 Tetraodon nigroviridis full-length cDNA 54 4e-04
44emb|CR711499.2|CNS0GBXZ Tetraodon nigroviridis full-length cDNA 54 4e-04
45emb|CR714447.2|CNS0GE7V Tetraodon nigroviridis full-length cDNA 54 4e-04
46emb|CR712086.2|CNS0GCEA Tetraodon nigroviridis full-length cDNA 54 4e-04
47emb|CR711079.2|CNS0GBMB Tetraodon nigroviridis full-length cDNA 54 4e-04
48emb|CR710690.2|CNS0GBBI Tetraodon nigroviridis full-length cDNA 54 4e-04
49emb|CR710614.2|CNS0GB9E Tetraodon nigroviridis full-length cDNA 54 4e-04
50emb|CR709795.2|CNS0GAMN Tetraodon nigroviridis full-length cDNA 54 4e-04
51emb|CR708965.2|CNS0G9ZL Tetraodon nigroviridis full-length cDNA 54 4e-04
52emb|CR708596.2|CNS0G9PC Tetraodon nigroviridis full-length cDNA 54 4e-04
53emb|CR708116.2|CNS0G9C0 Tetraodon nigroviridis full-length cDNA 54 4e-04
54emb|CR707915.2|CNS0G96F Tetraodon nigroviridis full-length cDNA 54 4e-04
55emb|CR707460.2|CNS0G8TS Tetraodon nigroviridis full-length cDNA 54 4e-04
56emb|CR707159.2|CNS0G8LF Tetraodon nigroviridis full-length cDNA 54 4e-04
57emb|CR705036.2|CNS0G6YG Tetraodon nigroviridis full-length cDNA 54 4e-04
58emb|CR704959.2|CNS0G6WB Tetraodon nigroviridis full-length cDNA 54 4e-04
59emb|CR705247.2|CNS0G74B Tetraodon nigroviridis full-length cDNA 54 4e-04
60emb|CR705188.2|CNS0G72O Tetraodon nigroviridis full-length cDNA 54 4e-04
61emb|CR632724.2|CNS0EN6I Tetraodon nigroviridis full-length cDNA 54 4e-04
62emb|CR632713.2|CNS0EN67 Tetraodon nigroviridis full-length cDNA 54 4e-04
63emb|CR633367.2|CNS0ENOD Tetraodon nigroviridis full-length cDNA 54 4e-04
64emb|CR633135.2|CNS0ENHX Tetraodon nigroviridis full-length cDNA 54 4e-04
65emb|CR632953.2|CNS0ENCV Tetraodon nigroviridis full-length cDNA 54 4e-04
66emb|CR632643.2|CNS0EN49 Tetraodon nigroviridis full-length cDNA 54 4e-04
67emb|CR631858.2|CNS0EMIG Tetraodon nigroviridis full-length cDNA 54 4e-04
68emb|CR631456.2|CNS0EM79 Tetraodon nigroviridis full-length cDNA 54 4e-04
69emb|CR717496.2|CNS0GGKE Tetraodon nigroviridis full-length cDNA 52 0.002
70ref|NM_112760.2| Arabidopsis thaliana structural constituent of ... 50 0.007
71ref|XM_630717.1| Dictyostelium discoideum hypothetical protein (... 50 0.007
72gb|AC158554.6| Mus musculus chromosome 15, clone RP23-353O17, co... 50 0.007
73gb|BC073560.1| Xenopus laevis MGC82844 protein, mRNA (cDNA clone... 50 0.007
74gb|BT012850.1| Lycopersicon esculentum clone 113928F, mRNA sequence 50 0.007
75gb|AC148348.6| Medicago truncatula clone mth2-28b4, complete seq... 50 0.007
76gb|AF446880.1|AF446880 Arabidopsis thaliana AT3g18740/MVE11_10 m... 50 0.007
77gb|AC153570.9| Mus musculus 10 BAC RP23-221F6 (Roswell Park Canc... 50 0.007
78gb|AY052710.1| Arabidopsis thaliana AT3g18740/MVE11_10 mRNA, com... 50 0.007
79gb|BC077047.1| Xenopus tropicalis MGC89963 protein, mRNA (cDNA c... 50 0.007
80ref|NM_001005110.1| Xenopus tropicalis MGC89963 protein (MGC8996... 50 0.007
81gb|AY088285.1| Arabidopsis thaliana clone 5180 mRNA, complete se... 50 0.007
82emb|AJ009294.1|XLAJ9294 Xenopus laevis cDNA clone 19E1-2 50 0.007
83dbj|AB026654.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 50 0.007
84emb|CR855835.2| Xenopus tropicalis finished cDNA, clone TTpA022e03 50 0.007
85ref|XM_637943.1| Dictyostelium discoideum hypothetical protein (... 48 0.026
86gb|DQ214212.1| Taeniopygia guttata clone 0065P0009H12 ribosomal ... 48 0.026
87gb|DQ214210.1| Taeniopygia guttata clone 0058P0030G07 ribosomal ... 48 0.026
88gb|AY432828.1| Aedes aegypti ASAP ID: 35483 cytosolic large ribo... 48 0.026
89ref|NM_200028.1| Danio rerio ribosomal protein L30 (rpl30), mRNA 48 0.026
90gb|AY231694.1| Drosophila yakuba clone yak-em_CG10652 mRNA sequence 48 0.026
91emb|AL031279.1|HS163O16 Human DNA sequence from clone RP1-163O16... 48 0.026
92emb|AL606457.3|OSJN00002 Oryza sativa genomic DNA, chromosome 4,... 48 0.026
93gb|AY118425.1| Drosophila melanogaster RH09938 full insert cDNA 48 0.026
94ref|NM_165271.1| Drosophila melanogaster Ribosomal protein L30 C... 48 0.026
95ref|NM_079948.2| Drosophila melanogaster Ribosomal protein L30 C... 48 0.026
96gb|AY071208.1| Drosophila melanogaster RE25263 full length cDNA 48 0.026
97gb|BC062278.1| Danio rerio ribosomal protein L30, mRNA (cDNA clo... 48 0.026
98gb|BC049055.1| Danio rerio ribosomal protein L30, mRNA (cDNA clo... 48 0.026
99dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.026
100dbj|AK120940.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
101emb|AL732344.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 48 0.026
102emb|AL732351.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 48 0.026
103gb|AC115844.7| Mus musculus chromosome 15, clone RP24-240I3, com... 46 0.10
104gb|AC167126.6| Mus musculus chromosome 1, clone RP24-104I19, com... 46 0.10
105gb|AC167168.5| Mus musculus chromosome 1, clone RP23-100P14, com... 46 0.10
106gb|AY432180.1| Aedes aegypti ASAP ID: 34535 cytosolic large ribo... 46 0.10
107gb|AC113323.12| Mus musculus chromosome 15, clone RP23-451O9, co... 46 0.10
108gb|DQ440259.1| Aedes aegypti clone AET-3168 60S ribosomal protei... 46 0.10
109gb|AC123072.4| Mus musculus BAC clone RP23-87D8 from chromosome ... 46 0.10
110gb|AC123859.4| Mus musculus BAC clone RP23-346B13 from chromosom... 46 0.10
111emb|CR711725.2|CNS0GC49 Tetraodon nigroviridis full-length cDNA 46 0.10
112emb|CR711634.2|CNS0GC1Q Tetraodon nigroviridis full-length cDNA 46 0.10
113emb|CR719628.2|CNS0GI7M Tetraodon nigroviridis full-length cDNA 46 0.10
114emb|CR719214.2|CNS0GHW4 Tetraodon nigroviridis full-length cDNA 46 0.10
115emb|CR719124.2|CNS0GHTM Tetraodon nigroviridis full-length cDNA 46 0.10
116emb|CR718910.2|CNS0GHNO Tetraodon nigroviridis full-length cDNA 46 0.10
117emb|CR718637.2|CNS0GHG3 Tetraodon nigroviridis full-length cDNA 46 0.10
118emb|CR718633.2|CNS0GHFZ Tetraodon nigroviridis full-length cDNA 46 0.10
119emb|CR718227.2|CNS0GH4P Tetraodon nigroviridis full-length cDNA 46 0.10
120emb|CR717320.2|CNS0GGFI Tetraodon nigroviridis full-length cDNA 46 0.10
121emb|CR717298.2|CNS0GGEW Tetraodon nigroviridis full-length cDNA 46 0.10
122emb|CR717100.2|CNS0GG9H Tetraodon nigroviridis full-length cDNA 46 0.10
123emb|CR716614.2|CNS0GFVZ Tetraodon nigroviridis full-length cDNA 46 0.10
124emb|CR716342.2|CNS0GFOF Tetraodon nigroviridis full-length cDNA 46 0.10
125emb|CR716300.2|CNS0GFN9 Tetraodon nigroviridis full-length cDNA 46 0.10
126emb|CR715857.2|CNS0GFB1 Tetraodon nigroviridis full-length cDNA 46 0.10
127emb|CR715829.2|CNS0GFA9 Tetraodon nigroviridis full-length cDNA 46 0.10
128emb|CR715785.2|CNS0GF91 Tetraodon nigroviridis full-length cDNA 46 0.10
129emb|CR715634.2|CNS0GF4U Tetraodon nigroviridis full-length cDNA 46 0.10
130emb|CR715552.2|CNS0GF2K Tetraodon nigroviridis full-length cDNA 46 0.10
131emb|CR715281.2|CNS0GEV1 Tetraodon nigroviridis full-length cDNA 46 0.10
132emb|CR715190.2|CNS0GESI Tetraodon nigroviridis full-length cDNA 46 0.10
133emb|CR715086.2|CNS0GEPM Tetraodon nigroviridis full-length cDNA 46 0.10
134emb|CR714767.2|CNS0GEGR Tetraodon nigroviridis full-length cDNA 46 0.10
135emb|CR714650.2|CNS0GEDI Tetraodon nigroviridis full-length cDNA 46 0.10
136emb|CR714514.2|CNS0GE9Q Tetraodon nigroviridis full-length cDNA 46 0.10
137emb|CR714512.2|CNS0GE9O Tetraodon nigroviridis full-length cDNA 46 0.10
138emb|CR714458.2|CNS0GE86 Tetraodon nigroviridis full-length cDNA 46 0.10
139emb|CR714442.2|CNS0GE7Q Tetraodon nigroviridis full-length cDNA 46 0.10
140emb|CR714295.2|CNS0GE3N Tetraodon nigroviridis full-length cDNA 46 0.10
141emb|CR714244.2|CNS0GE28 Tetraodon nigroviridis full-length cDNA 46 0.10
142emb|CR712362.2|CNS0GCLY Tetraodon nigroviridis full-length cDNA 46 0.10
143emb|CR714007.2|CNS0GDVN Tetraodon nigroviridis full-length cDNA 46 0.10
144emb|CR713837.2|CNS0GDQX Tetraodon nigroviridis full-length cDNA 46 0.10
145emb|CR713206.2|CNS0GD9E Tetraodon nigroviridis full-length cDNA 46 0.10
146emb|CR713089.2|CNS0GD65 Tetraodon nigroviridis full-length cDNA 46 0.10
147emb|CR711265.2|CNS0GBRH Tetraodon nigroviridis full-length cDNA 46 0.10
148emb|CR710746.2|CNS0GBD2 Tetraodon nigroviridis full-length cDNA 46 0.10
149emb|CR710692.2|CNS0GBBK Tetraodon nigroviridis full-length cDNA 46 0.10
150emb|CR710458.2|CNS0GB52 Tetraodon nigroviridis full-length cDNA 46 0.10
151emb|CR710442.2|CNS0GB4M Tetraodon nigroviridis full-length cDNA 46 0.10
152emb|CR710415.2|CNS0GB3V Tetraodon nigroviridis full-length cDNA 46 0.10
153emb|CR710172.2|CNS0GAX4 Tetraodon nigroviridis full-length cDNA 46 0.10
154emb|CR710053.2|CNS0GATT Tetraodon nigroviridis full-length cDNA 46 0.10
155emb|CR708924.2|CNS0G9YG Tetraodon nigroviridis full-length cDNA 46 0.10
156emb|CR707528.2|CNS0G8VO Tetraodon nigroviridis full-length cDNA 46 0.10
157emb|CR705955.2|CNS0G7NZ Tetraodon nigroviridis full-length cDNA 46 0.10
158emb|CR707035.2|CNS0G8HZ Tetraodon nigroviridis full-length cDNA 46 0.10
159emb|CR706967.2|CNS0G8G3 Tetraodon nigroviridis full-length cDNA 46 0.10
160emb|CR706904.2|CNS0G8EC Tetraodon nigroviridis full-length cDNA 46 0.10
161emb|CR706853.2|CNS0G8CX Tetraodon nigroviridis full-length cDNA 46 0.10
162emb|CR706786.2|CNS0G8B2 Tetraodon nigroviridis full-length cDNA 46 0.10
163emb|CR706734.2|CNS0G89M Tetraodon nigroviridis full-length cDNA 46 0.10
164emb|CR706603.2|CNS0G85Z Tetraodon nigroviridis full-length cDNA 46 0.10
165emb|CR706254.2|CNS0G7WA Tetraodon nigroviridis full-length cDNA 46 0.10
166emb|CR706191.2|CNS0G7UJ Tetraodon nigroviridis full-length cDNA 46 0.10
167emb|CR699755.2|CNS0G2VR Tetraodon nigroviridis full-length cDNA 46 0.10
168emb|CR700179.2|CNS0G37J Tetraodon nigroviridis full-length cDNA 46 0.10
169emb|CR697838.2|CNS0G1EI Tetraodon nigroviridis full-length cDNA 46 0.10
170emb|CR696260.2|CNS0G06O Tetraodon nigroviridis full-length cDNA 46 0.10
171emb|CR694316.2|CNS0FYOO Tetraodon nigroviridis full-length cDNA 46 0.10
172emb|CR693971.3|CNS0FYF3 Tetraodon nigroviridis full-length cDNA 46 0.10
173emb|CR688011.2|CNS0FTTJ Tetraodon nigroviridis full-length cDNA 46 0.10
174emb|CR686515.2|CNS0FSNZ Tetraodon nigroviridis full-length cDNA 46 0.10
175emb|CR676104.2|CNS0FKNI Tetraodon nigroviridis full-length cDNA 46 0.10
176emb|CR673664.2|CNS0FIRQ Tetraodon nigroviridis full-length cDNA 46 0.10
177emb|CR657577.2|CNS0F6CV Tetraodon nigroviridis full-length cDNA 46 0.10
178emb|CR632770.2|CNS0EN7S Tetraodon nigroviridis full-length cDNA 46 0.10
179emb|CR633399.2|CNS0ENP9 Tetraodon nigroviridis full-length cDNA 46 0.10
180emb|CR633182.2|CNS0ENJ8 Tetraodon nigroviridis full-length cDNA 46 0.10
181emb|CR633150.2|CNS0ENIC Tetraodon nigroviridis full-length cDNA 46 0.10
182emb|CR633084.2|CNS0ENGI Tetraodon nigroviridis full-length cDNA 46 0.10
183emb|CR632999.2|CNS0ENE5 Tetraodon nigroviridis full-length cDNA 46 0.10
184emb|CR632929.2|CNS0ENC7 Tetraodon nigroviridis full-length cDNA 46 0.10
185emb|CR632558.2|CNS0EN1W Tetraodon nigroviridis full-length cDNA 46 0.10
186emb|CR632550.2|CNS0EN1O Tetraodon nigroviridis full-length cDNA 46 0.10
187emb|CR632463.2|CNS0EMZ9 Tetraodon nigroviridis full-length cDNA 46 0.10
188emb|CR631300.2|CNS0EM2X Tetraodon nigroviridis full-length cDNA 46 0.10
189emb|CR631287.2|CNS0EM2K Tetraodon nigroviridis full-length cDNA 46 0.10
190emb|CR631156.2|CNS0ELYX Tetraodon nigroviridis full-length cDNA 46 0.10
191emb|CR632443.2|CNS0EMYP Tetraodon nigroviridis full-length cDNA 46 0.10
192emb|CR632435.2|CNS0EMYH Tetraodon nigroviridis full-length cDNA 46 0.10
193emb|CR632229.2|CNS0EMSR Tetraodon nigroviridis full-length cDNA 46 0.10
194emb|CR632155.2|CNS0EMQP Tetraodon nigroviridis full-length cDNA 46 0.10
195emb|CR632137.2|CNS0EMQ7 Tetraodon nigroviridis full-length cDNA 46 0.10
196emb|CR632021.2|CNS0EMMZ Tetraodon nigroviridis full-length cDNA 46 0.10
197emb|CR631508.2|CNS0EM8Q Tetraodon nigroviridis full-length cDNA 46 0.10
198emb|CR631377.2|CNS0EM52 Tetraodon nigroviridis full-length cDNA 46 0.10
199emb|CR631314.2|CNS0EM3B Tetraodon nigroviridis full-length cDNA 46 0.10
200emb|CR631750.2|CNS0EMFG Tetraodon nigroviridis full-length cDNA 46 0.10
201emb|CR631664.2|CNS0EMD2 Tetraodon nigroviridis full-length cDNA 46 0.10
202emb|CR631617.2|CNS0EMBR Tetraodon nigroviridis full-length cDNA 46 0.10
203emb|AJ843087.1| Platichthys flesus mRNA for 60S ribosomal protei... 46 0.10
204gb|DQ416021.1| Acyrthosiphon pisum ribosomal protein L30-like pr... 46 0.10
205gb|AC146333.35| Medicago truncatula clone mth2-8d3, complete seq... 46 0.10
206gb|DQ073391.1| Heliocidaris tuberculata homeobox protein Hox11/1... 46 0.10
207gb|DQ073390.1| Heliocidaris erythrogramma homeobox protein Hox11... 46 0.10
208gb|AC158361.3| Mus musculus BAC clone RP23-227A12 from chromosom... 46 0.10
209gb|AC009205.6|AC009205 Drosophila melanogaster, chromosome 2L, r... 46 0.10
210gb|AC011756.5|AC011756 Drosophila melanogaster, chromosome 2L, r... 46 0.10
211gb|AC008746.10| Homo sapiens chromosome 19 clone CTD-2587H19, co... 46 0.10
212gb|AF233374.1|AF233374 Volvox carteri argininosuccinate lyase (V... 46 0.10
213emb|AL929569.13| Mouse DNA sequence from clone RP23-325I3 on chr... 46 0.10
214gb|AC154222.2| Mus musculus BAC clone RP24-375M13 from 13, compl... 46 0.10
215gb|AE003661.3| Drosophila melanogaster chromosome 2L, section 70... 46 0.10
216gb|AC130720.3| Mus musculus BAC clone RP24-292B4 from chromosome... 46 0.10
217gb|U31564.1|HEU31564 Heliocidaris erythrogramma HEHBOX7 (HeHbox7... 46 0.10
218gb|AC170917.2| Mus musculus BAC clone RP23-160F6 from chromosome... 46 0.10
219emb|AL606914.9| Mouse DNA sequence from clone RP23-169H13 on chr... 46 0.10
220ref|NM_106443.3| Arabidopsis thaliana structural constituent of ... 44 0.41
221gb|AY787010.1| Lessonia nigrescens clone Ln2-E02 SSR marker sequ... 44 0.41
222ref|XM_637923.1| Dictyostelium discoideum hypothetical protein (... 44 0.41
223ref|XM_636937.1| Dictyostelium discoideum hypothetical protein (... 44 0.41
224ref|XM_630025.1| Dictyostelium discoideum hypothetical protein (... 44 0.41
225gb|AC112953.15| Mus musculus chromosome 7, clone RP23-44J21, com... 44 0.41
226ref|NM_008845.2| Mus musculus phosphatidylinositol-4-phosphate 5... 44 0.41
227gb|AC103388.6| Mus musculus chromosome 7, clone RP24-403B15, com... 44 0.41
228gb|AY524016.1| Salvia coccinea deficiens (DEF) mRNA, DEFB2 paral... 44 0.41
229gb|AC105076.25| Mus musculus chromosome 3, clone RP23-258P2, com... 44 0.41
230gb|AC093363.12| Mus musculus chromosome 7, clone RP23-60O3, comp... 44 0.41
231gb|BC079597.1| Mus musculus forkhead box G1, mRNA (cDNA clone IM... 44 0.41
232ref|XM_362901.1| Magnaporthe grisea 70-15 hypothetical protein (... 44 0.41
233gb|AC140355.3| Mus musculus BAC clone RP23-214D3 from chromosome... 44 0.41
234gb|BC046958.1| Mus musculus forkhead box G1, mRNA (cDNA clone MG... 44 0.41
235ref|XM_958853.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.41
236ref|XM_329977.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.41
237ref|XM_714216.1| Candida albicans SC5314 hypothetical protein (C... 44 0.41
238ref|NM_008241.1| Mus musculus forkhead box G1 (Foxg1), mRNA 44 0.41
239gb|AC139943.3| Mus musculus BAC clone RP23-472M3 from chromosome... 44 0.41
240gb|AC162690.2| Mus musculus chromosome 5, clone RP24-170F2, comp... 44 0.41
241gb|AC160533.6| Mus musculus chromosome 5, clone RP24-242L17, com... 44 0.41
242gb|AC161364.4| Mus musculus BAC clone RP24-353J16 from chromosom... 44 0.41
243ref|XM_992309.1| PREDICTED: Mus musculus forkhead box G1 (Foxg1)... 44 0.41
244gb|BC064449.1| Mus musculus forkhead box G1, mRNA (cDNA clone IM... 44 0.41
245gb|AC123941.3| Mus musculus BAC clone RP23-458G24 from chromosom... 44 0.41
246emb|AL389894.4|LMFLCHR4A Leishmania major Friedlin chromosome 4,... 44 0.41
247emb|AJ583100.1| Donax semiestriatus 5S rRNA gene, clone DSE2 44 0.41
248gb|BC055774.1| Mus musculus forkhead box G1, mRNA (cDNA clone IM... 44 0.41
249gb|AC121986.2| Mus musculus BAC clone RP24-293I7 from 10, comple... 44 0.41
250gb|AC122004.2| Mus musculus BAC clone RP24-337O4 from 18, comple... 44 0.41
251gb|AC125277.1| Mus musculus BAC clone RP24-554P24 from 13, compl... 44 0.41
252gb|AC116723.13| Mus musculus chromosome 3, clone RP23-266J14, co... 44 0.41
253emb|CR706404.2|CNS0G80G Tetraodon nigroviridis full-length cDNA 44 0.41
254gb|AC111127.11| Mus musculus chromosome 9, clone RP23-338I1, com... 44 0.41
255gb|AC134382.13| Mus musculus strain C57BL/6J clone rp23-167l1, c... 44 0.41
256emb|AL591890.31| Human DNA sequence from clone RP11-54A22 on chr... 44 0.41
257emb|AL391478.14| Human DNA sequence from clone RP11-552I13 on ch... 44 0.41
258gb|AC093250.3| Homo sapiens chromosome 5 clone RP11-147O19, comp... 44 0.41
259emb|AL050344.31|HSJ799D16 Human DNA sequence from clone RP4-799D... 44 0.41
260emb|AL035425.13|HS24A23 Human DNA sequence from clone RP6-24A23 ... 44 0.41
261emb|BX063921.1|CNS09LHH Single read from an extremity of a full-... 44 0.41
262emb|BX063920.1|CNS09LHG Single read from an extremity of a full-... 44 0.41
263emb|BX033115.1|CNS08XPR Single read from an extremity of a full-... 44 0.41
264emb|BX025218.1|CNS08RME Single read from an extremity of a full-... 44 0.41
265emb|BX023259.1|CNS08Q3Z Single read from an extremity of a full-... 44 0.41
266emb|BX019682.1|CNS08NCM Single read from an extremity of a full-... 44 0.41
267emb|BX011683.1|CNS08H6F Single read from an extremity of a full-... 44 0.41
268emb|BX011682.1|CNS08H6E Single read from an extremity of a full-... 44 0.41
269emb|BX007170.1|CNS08DP2 Single read from an extremity of a full-... 44 0.41
270emb|BX006109.1|CNS08CVL Single read from an extremity of a full-... 44 0.41
271emb|BX005751.1|CNS08CLN Single read from an extremity of a full-... 44 0.41
272emb|Z98763.1|SPAC9G1 S.pombe chromosome I cosmid c9G1 44 0.41
273gb|AY114036.1| Arabidopsis thaliana putative ribosomal protein L... 44 0.41
274gb|AY065370.1| Arabidopsis thaliana putative ribosomal protein L... 44 0.41
275gb|AC113615.3| Homo sapiens BAC clone RP11-586D19 from 4, comple... 44 0.41
276dbj|AK132305.1| Mus musculus 15 days embryo head cDNA, RIKEN ful... 44 0.41
277gb|AC005302.70| Mus musculus strain 129S6/SvEvTac chromosome 10 ... 44 0.41
278gb|AC021860.6| Homo sapiens BAC clone RP11-617D20 from 4, comple... 44 0.41
279dbj|AK144611.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 44 0.41
280gb|AY056469.1| Petromyzon marinus homeobox protein hox4x mRNA, p... 44 0.41
281dbj|AK040558.1| Mus musculus 0 day neonate thymus cDNA, RIKEN fu... 44 0.41
282gb|AC158529.2| Mus musculus BAC clone RP23-263H3 from chromosome... 44 0.41
283gb|AC160053.2| Mus musculus BAC clone RP23-339M18 from chromosom... 44 0.41
284gb|AC151986.4| Mus musculus BAC clone RP23-365E22 from chromosom... 44 0.41
285gb|AC162376.2| Mus musculus BAC clone RP24-490H13 from chromosom... 44 0.41
286gb|AC160929.2| Mus musculus BAC clone RP24-380G7 from chromosome... 44 0.41
287ref|NM_001018991.1| Schizosaccharomyces pombe 972h- hypothetical... 44 0.41
288dbj|AK012196.1| Mus musculus 10 days embryo whole body cDNA, RIK... 44 0.41
289ref|XM_394552.2| PREDICTED: Apis mellifera similar to CG12950-PA... 44 0.41
290emb|BX817330.1|CNS0ACQT Arabidopsis thaliana Full-length cDNA Co... 44 0.41
291emb|BX830023.1|CNS0A1B8 Arabidopsis thaliana Full-length cDNA Co... 44 0.41
292gb|AY167561.1| Hordeum vulgare subsp. vulgare GAMYB-binding prot... 44 0.41
293gb|AC114815.5| Homo sapiens BAC clone RP11-1369K4 from 4, comple... 44 0.41
294gb|BT004749.1| Arabidopsis thaliana At1g77940 gene, complete cds 44 0.41
295gb|AF297033.1|AF297033 Ophiophagus hannah ribosomal protein L30 ... 44 0.41
296gb|AY085881.1| Arabidopsis thaliana clone 19274 mRNA, complete s... 44 0.41
297gb|AC171141.2| Helobdella robusta clone CH306-1B3, complete sequ... 44 0.41
298gb|AC007736.3| Homo sapiens BAC clone RP11-15J24 from 2, complet... 44 0.41
299gb|AC016562.7| Homo sapiens chromosome 5 clone CTC-484A9, comple... 44 0.41
300gb|AY961506.1| Lysiphlebus testaceipes ribosomal protein L30 (Rp... 44 0.41
301gb|AY961499.1| Lysiphlebus testaceipes ribosomal protein L30 var... 44 0.41
302gb|AC140001.8| Mus musculus chromosome 5, clone RP24-276E6, comp... 44 0.41
303ref|XM_311177.2| Anopheles gambiae str. PEST ENSANGP00000019055 ... 44 0.41
304gb|BC011097.1| Mus musculus phosphatidylinositol-4-phosphate 5-k... 44 0.41
305emb|BX897658.10| Zebrafish DNA sequence from clone CH211-13K12 i... 44 0.41
306emb|CT030195.12| Mouse DNA sequence from clone RP23-191J8 on chr... 44 0.41
307gb|AC156789.1| Homo sapiens chromosome 9 clone WI2-2903G16, comp... 44 0.41
308gb|AC153864.5| Mus musculus 10 BAC RP23-345N8 (Roswell Park Canc... 44 0.41
309emb|AL772399.9| Mouse DNA sequence from clone RP23-220L1 on chro... 44 0.41
310gb|AC126039.3| Mus musculus BAC clone RP24-234N22 from 12, compl... 44 0.41
311gb|AC126931.4| Mus musculus BAC clone RP23-389M9 from 9, complet... 44 0.41
312emb|AL669970.10| Human DNA sequence from clone RP11-473E2 on chr... 44 0.41
313gb|U36760.1|MMU36760 Mus musculus brain factor-1 (Hfhbf1) mRNA, ... 44 0.41
314gb|U52080.1|SPU52080 Schizosaccharomyces pombe ribosomal protein... 44 0.41
315emb|AL158800.6|CNS01RGM Human chromosome 14 DNA sequence BAC R-3... 44 0.41
316emb|AL807247.10| Mouse DNA sequence from clone RP23-178D3 on chr... 44 0.41
317emb|AL845156.5| Mouse DNA sequence from clone RP23-340F21 on chr... 44 0.41
318emb|AL714023.12| Mouse DNA sequence from clone RP23-12H6 on chro... 44 0.41
319gb|U02933.1|AGACT1DB Anopheles gambiae clone 22 actin 1D mRNA, c... 44 0.41
320gb|U02930.1|AGACT1DC Anopheles gambiae G3 actin 1D gene, complet... 44 0.41
321emb|AL928680.5| Mouse DNA sequence from clone RP23-396N6 on chro... 44 0.41
322emb|AL732625.8| Mouse DNA sequence from clone RP23-169H17 on chr... 44 0.41
323gb|AC163685.4| Mus musculus BAC clone RP23-4M16 from chromosome ... 44 0.41
324ref|NM_012560.2| Rattus norvegicus forkhead box G1 (Foxg1), mRNA 44 0.41
325gb|M87634.1|RATBF1A Rat BF-1 mRNA, complete cds 44 0.41
326gb|M73768.1|ECCU1SNRNA E.multilocularis U1 small nuclear RNA gene 44 0.41
327gb|U02964.1|AGACT1DA Anopheles gambiae clone 47 actin 1D mRNA, c... 44 0.41
328gb|AC105163.12| Mus musculus chromosome 3, clone RP24-163F11, co... 42 1.6
329gb|AC115871.8| Mus musculus chromosome 5, clone RP24-343A12, com... 42 1.6
330gb|AY242057.1| Danio rerio foxi one (foo) gene, complete cds 42 1.6
331gb|AC146896.15| Mus musculus chromosome X clone xcat-28-97f16, c... 42 1.6
332gb|AC122560.8| Mus musculus chromosome 15, clone RP24-93E14, com... 42 1.6
333gb|AC110893.13| Mus musculus chromosome 3, clone RP24-141D20, co... 42 1.6
334gb|AC110544.13| Mus musculus chromosome 3, clone RP23-112A11, co... 42 1.6
335gb|AC162384.6| Mus musculus 10 BAC RP24-292K6 (Roswell Park Canc... 42 1.6
336ref|NM_127468.3| Arabidopsis thaliana HMA4; cadmium-transporting... 42 1.6
337gb|AY826394.1| Leishmania tropica microsatellite GTG1 sequence 42 1.6
338gb|AY826385.1| Leishmania tropica microsatellite GA1 sequence 42 1.6
339gb|AC113991.4| Mus musculus chromosome 3, clone RP24-138E17, com... 42 1.6
340gb|AC118700.10| Mus musculus chromosome 3, clone RP23-24O21, com... 42 1.6
341gb|AC162379.2| Mus musculus BAC clone RP23-132A15 from chromosom... 42 1.6
342gb|AC167172.3| Mus musculus BAC clone RP23-166M7 from chromosome... 42 1.6
343gb|AC169675.2| Mus musculus BAC clone RP24-200J3 from chromosome... 42 1.6
344gb|AC104862.15| Mus musculus chromosome 15, clone RP23-124I9, co... 42 1.6
345ref|XM_631944.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
346ref|XM_632937.1| Dictyostelium discoideum WD-40 repeat-containin... 42 1.6
347ref|XM_631807.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
348gb|AC131909.8| Mus musculus chromosome 5, clone RP24-250G11, com... 42 1.6
349ref|XM_642121.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
350gb|AC136217.4| Oryza sativa (japonica cultivar-group) chromosome... 42 1.6
351gb|AC109196.12| Mus musculus chromosome 5, clone RP23-313F5, com... 42 1.6
352ref|XM_638327.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
353ref|XM_637235.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
354ref|XM_635684.1| Dictyostelium discoideum phospholipase D1 (DDB0... 42 1.6
355ref|XM_634905.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
356ref|XM_634860.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
357ref|XM_631120.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
358ref|XM_630825.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
359ref|XM_630152.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
360ref|XM_629875.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
361gb|AC168070.2| Mus musculus BAC clone RP23-87E10 from chromosome... 42 1.6
362gb|AC166365.4| Mus musculus BAC clone RP24-428H14 from chromosom... 42 1.6
363gb|AC151592.2| Nematostella vectensis clone JGIAFIN-297A9, compl... 42 1.6
364gb|AC110214.7| Mus musculus chromosome 8, clone RP24-485L5, comp... 42 1.6
365gb|AC167331.3| Mus musculus chromosome 1, clone RP23-301L19, com... 42 1.6
366gb|AC161193.3| Mus musculus chromosome 8, clone RP23-308L22, com... 42 1.6
367gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, compl... 42 1.6
368gb|AY769300.1| Bombyx mori ribosomal protein L30 (RpL30) mRNA, c... 42 1.6
369gb|AC166150.2| Mus musculus chromosome 1, clone RP23-321N22, com... 42 1.6
370gb|AC158308.4| Mus musculus chromosome 3, clone RP23-182M12, com... 42 1.6
371gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 1.6
372gb|AC120870.8| Mus musculus chromosome 1, clone RP23-15D1, compl... 42 1.6
373gb|AC154861.2| Mus musculus BAC clone RP23-8E13 from chromosome ... 42 1.6
374gb|AC164430.3| Mus musculus BAC clone RP23-441D9 from chromosome... 42 1.6
375gb|AC165273.2| Mus musculus BAC clone RP24-267I1 from chromosome... 42 1.6
376gb|AC147004.2| Homo sapiens chromosome 8, clone RP13-895A16, com... 42 1.6
377gb|AC110536.10| Mus musculus chromosome 1, clone RP24-545N23, co... 42 1.6
378gb|AC101982.9| Mus musculus chromosome 3, clone RP24-346F13, com... 42 1.6
379gb|AC113600.19| Mus musculus chromosome 6, clone RP23-110A19, co... 42 1.6
380gb|AC117723.8| Mus musculus chromosome 1, clone RP24-232C21, com... 42 1.6
381gb|AC110180.10| Mus musculus chromosome 19, clone RP24-358B11, c... 42 1.6
382gb|AC120004.14| Mus musculus chromosome 5, clone RP24-150N15, co... 42 1.6
383gb|AC099695.15| Mus musculus chromosome 10, clone RP23-234P12, c... 42 1.6
384gb|AC116507.9| Mus musculus chromosome 19, clone RP24-309C17, co... 42 1.6
385gb|AC114613.12| Mus musculus chromosome 5, clone RP24-80F7, comp... 42 1.6
386gb|AC114662.11| Mus musculus chromosome 1, clone RP24-170M24, co... 42 1.6
387gb|AC118201.8| Mus musculus chromosome 7, clone RP23-339M11, com... 42 1.6
388gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's ... 42 1.6
389gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's... 42 1.6
390gb|AC121481.6| Rattus norvegicus NOVECTOR CH230-218J9 (Children... 42 1.6
391gb|AC115508.5| Rattus norvegicus 2 BAC CH230-355B17 (Children's ... 42 1.6
392gb|AC112633.6| Rattus norvegicus 11 BAC CH230-200K21 (Children's... 42 1.6
393gb|AC108321.5| Rattus norvegicus BAC CH230-261E4 (Children's Hos... 42 1.6
394gb|AC102999.7| Rattus norvegicus 7 BAC CH230-33J22 (Children's H... 42 1.6
395gb|AC102285.7| Mus musculus chromosome 19, clone RP24-329P13, co... 42 1.6
396gb|AC129931.19| Mus musculus chromosome 15, clone RP23-136I22, c... 42 1.6
397gb|AC141583.3| Rattus norvegicus 9 BAC CH230-486H15 (Children's ... 42 1.6
398gb|AC157797.5| Mus musculus chromosome 1, clone RP24-149G24, com... 42 1.6
399gb|AC027655.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 1.6
400gb|AC138766.20| Mus musculus chromosome 5, clone RP23-444J3, com... 42 1.6
401ref|XM_960490.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.6
402gb|AC101794.5| Mus musculus chromosome 1, clone RP24-188N24, com... 42 1.6
403gb|AC147628.4| Mus musculus BAC clone RP24-476D20 from chromosom... 42 1.6
404gb|AC129332.6| Mus musculus BAC clone RP23-91I19 from chromosome... 42 1.6
405gb|AC134898.4| Mus musculus BAC clone RP23-478H2 from chromosome... 42 1.6
406gb|AC140364.4| Mus musculus BAC clone RP24-75K5 from chromosome ... 42 1.6
407gb|AC150209.1| Pan troglodytes chromosome X clone PTB-085O24 map... 42 1.6
408gb|AC110261.25| Mus musculus chromosome 1, clone RP23-289I3, com... 42 1.6
409gb|AC126593.5| Rattus norvegicus 13 BAC CH230-103N15 (Children's... 42 1.6
410gb|AC127827.7| Rattus norvegicus 4 BAC CH230-314M17 (Children's ... 42 1.6
411gb|AC119382.7| Rattus norvegicus 4 BAC CH230-125G2 (Children's H... 42 1.6
412gb|AC119181.11| Mus musculus chromosome 18, clone RP24-111I16, c... 42 1.6
413gb|AC084220.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 1.6
414gb|AC091353.6| Rattus norvegicus 4 BAC CH230-1B20 (Children's Ho... 42 1.6
415ref|XM_951132.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.6
416gb|AC137107.7| Mus musculus chromosome 5, clone RP23-274I21, com... 42 1.6
417gb|AC095825.6| Rattus norvegicus 4 BAC CH230-9J6 (Children's Hos... 42 1.6
418ref|XM_330088.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.6
419ref|XM_330898.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.6
420gb|AC165278.4| Mus musculus chromosome 15, clone RP23-250O18, co... 42 1.6
421gb|AC167135.3| Mus musculus chromosome 1, clone RP24-335L18, com... 42 1.6
422gb|AC133508.3| Mus musculus BAC clone RP23-383K24 from chromosom... 42 1.6
423gb|AC147121.2| Mus musculus BAC clone RP24-160L14 from chromosom... 42 1.6
424ref|XM_711383.1| Candida albicans SC5314 putative a-pheromone ma... 42 1.6
425gb|AC147380.2| Mus musculus BAC clone RP24-119J10 from chromosom... 42 1.6
426gb|AC124417.5| Mus musculus BAC clone RP24-313G11 from chromosom... 42 1.6
427gb|AC139847.3| Mus musculus BAC clone RP23-387P21 from chromosom... 42 1.6
428gb|AC098390.6| Rattus norvegicus 1 BAC CH230-1M24 (Children's Ho... 42 1.6
429gb|AC117663.13| Mus musculus chromosome 5, clone RP23-354E8, com... 42 1.6
430gb|AC133906.9| Mus musculus chromosome 14, clone RP24-230P12, co... 42 1.6
431gb|AC120386.12| Mus musculus chromosome 9, clone RP24-294A16, co... 42 1.6
432gb|AC110521.14| Mus musculus chromosome 12, clone RP23-50H15, co... 42 1.6
433gb|AY814309.1| Schistosoma japonicum SJCHGC02036 protein mRNA, c... 42 1.6
434gb|AY814029.1| Schistosoma japonicum SJCHGC02037 protein mRNA, c... 42 1.6
435gb|AY813832.1| Schistosoma japonicum SJCHGC05995 protein mRNA, c... 42 1.6
436gb|AY812971.1| Schistosoma japonicum SJCHGC00913 protein mRNA, c... 42 1.6
437gb|AC160105.2| Mus musculus BAC clone RP24-353L12 from chromosom... 42 1.6
438gb|AC167969.2| Mus musculus BAC clone RP24-446H24 from chromosom... 42 1.6
439gb|AC121276.9| Mus musculus chromosome 1, clone RP24-249B16, com... 42 1.6
440gb|AC164304.2| Mus musculus BAC clone RP23-261B24 from chromosom... 42 1.6
441gb|AC161042.4| Mus musculus chromosome 8, clone RP24-278L20, com... 42 1.6
442gb|AC123665.9| Mus musculus chromosome 14, clone RP23-226A4, com... 42 1.6
443gb|AC157944.2| Mus musculus BAC clone RP23-456N8 from chromosome... 42 1.6
444gb|AC102545.9| Mus musculus chromosome 9, clone RP23-118J13, com... 42 1.6
445gb|AC022062.10| Mus musculus chromosome 5, clone RP23-57P23, com... 42 1.6
446gb|AC161346.7| Mus musculus chromosome 1, clone RP24-335G4, comp... 42 1.6
447gb|AC123947.5| Mus musculus BAC clone RP23-103O6 from chromosome... 42 1.6
448gb|AC109139.15| Mus musculus chromosome 8, clone RP23-47L13, com... 42 1.6
449gb|AC154396.11| Mus musculus chromosome 3, clone RP24-254D5, com... 42 1.6
450gb|DQ176015.1| Mytilus edulis coatomer alpha subunit (copa) mRNA... 42 1.6
451gb|AC093483.6| Mus musculus chromosome 9, clone RP23-79K5, compl... 42 1.6
452gb|AC162443.3| Mus musculus chromosome 7, clone RP23-457F4, comp... 42 1.6
453gb|AC159197.3| Mus musculus BAC clone RP23-421P10 from chromosom... 42 1.6
454gb|AY485979.1| Triticum turgidum cultivar Langdon ZCCT1-Td (VRN2... 42 1.6
455gb|AC158616.8| Mus musculus 10 BAC RP23-227E23 (Roswell Park Can... 42 1.6
456gb|AC166256.5| Mus musculus BAC RP23-440F21 (Roswell Park Cance... 42 1.6
457gb|AC159502.12| Mus musculus 10 BAC RP23-113B7 (Roswell Park Can... 42 1.6
458gb|AC160101.7| Mus musculus chromosome 1, clone RP24-126E20, com... 42 1.6
459gb|AC158527.2| Mus musculus BAC clone RP23-266E16 from chromosom... 42 1.6
460gb|AC115904.13| Mus musculus chromosome 16, clone RP24-472P22, c... 42 1.6
461gb|AC122396.4| Mus musculus BAC clone RP24-89O12 from chromosome... 42 1.6
462gb|AC183773.2| Pan troglodytes BAC clone CH251-2N7 from chromoso... 42 1.6
463gb|AC125331.4| Mus musculus chromosome 7 clone RP23-11L1, comple... 42 1.6
464gb|AC102358.5| Mus musculus chromosome 8, clone RP23-451H9, comp... 42 1.6
465gb|AC140413.3| Mus musculus BAC clone RP23-138H4 from chromosome... 42 1.6
466gb|AC102449.7| Mus musculus chromosome 5, clone RP24-216G12, com... 42 1.6
467gb|AC092689.2| Homo sapiens BAC clone RP11-809G18 from 7, comple... 42 1.6
468gb|AC113311.9| Mus musculus chromosome 1, clone RP23-440J24, com... 42 1.6
469gb|AC120922.4| Rattus norvegicus 9 BAC CH230-104J1 (Children's H... 42 1.6
470gb|AC126046.3| Mus musculus BAC clone RP23-176P24 from chromosom... 42 1.6
471gb|AC126459.3| Mus musculus BAC clone RP23-181A8 from chromosome... 42 1.6
472gb|AC125055.3| Mus musculus BAC clone RP23-397L11 from chromosom... 42 1.6
473gb|AC134591.4| Mus musculus BAC clone RP23-376L4 from chromosome... 42 1.6
474gb|AC132310.3| Mus musculus BAC clone RP24-295G16 from chromosom... 42 1.6
475ref|XM_753121.1| Ustilago maydis 521 hypothetical protein (UM020... 42 1.6
476ref|XM_753641.1| Ustilago maydis 521 hypothetical protein (UM025... 42 1.6
477ref|XM_756472.1| Ustilago maydis 521 hypothetical protein (UM054... 42 1.6
478emb|CT025527.7| Mouse DNA sequence from clone RP23-279J20 on chr... 42 1.6
479ref|XM_824619.1| Trypanosoma brucei TREU927 hypothetical protein... 42 1.6
480emb|CR956424.18| Pig DNA sequence from clone PigE-234J24 on chro... 42 1.6
481emb|CT025602.8| Mouse DNA sequence from clone RP23-458L4 on chro... 42 1.6
482emb|CT025600.8| Mouse DNA sequence from clone RP24-120I22 on chr... 42 1.6
483emb|AJ583099.1| Donax semiestriatus 5S rRNA gene, clone DSE1 42 1.6
484emb|CR936442.13| Zebrafish DNA sequence from clone DKEY-266F7 in... 42 1.6
485gb|AC117688.10| Mus musculus chromosome 9, clone RP23-444I6, com... 42 1.6
486gb|AC112950.9| Mus musculus chromosome 1, clone RP23-288K15, com... 42 1.6
487ref|XM_566608.1| Cryptococcus neoformans var. neoformans JEC21 6... 42 1.6
488gb|AC129200.4| Mus musculus BAC clone RP24-221J22 from chromosom... 42 1.6
489gb|AC124494.4| Mus musculus BAC clone RP23-464P12 from chromosom... 42 1.6
490gb|AC132302.3| Mus musculus BAC clone RP24-279N5 from chromosome... 42 1.6
491gb|AC123944.4| Mus musculus BAC clone RP24-87F18 from chromosome... 42 1.6
492gb|AC122449.4| Mus musculus BAC clone RP24-247O14 from chromosom... 42 1.6
493gb|AC127689.4| Mus musculus BAC clone RP24-206I5 from chromosome... 42 1.6
494gb|AC127264.4| Mus musculus BAC clone RP24-336J13 from chromosom... 42 1.6
495gb|AC132260.3| Mus musculus BAC clone RP24-370C1 from chromosome... 42 1.6
496gb|AC122036.3| Mus musculus BAC clone RP24-420C18 from chromosom... 42 1.6
497gb|AC124691.4| Mus musculus BAC clone RP24-158O8 from chromosome... 42 1.6
498gb|AC130821.3| Mus musculus BAC clone RP23-205K12 from chromosom... 42 1.6
499gb|AC127345.4| Mus musculus BAC clone RP23-217K23 from chromosom... 42 1.6
500ref|XM_801685.1| Trypanosoma cruzi strain CL Brener hypothetical... 42 1.6

>gb|AY846825.1| Triticum aestivum ribosomal protein L30 mRNA, complete cds
          Length = 341

 Score =  482 bits (243), Expect = e-133
 Identities = 261/267 (97%)
 Strand = Plus / Minus

                                                                       
Query: 205 ttcactgggtggtggtggtggtgttgatgatgtccgagtcaccagggtcaaggatgctga 264
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 341 ttcactgggtggtggtggtggtgttgatgatgtccgagtcaccagggtcgaggatgctga 282

                                                                       
Query: 265 ggcagcacacccggtagtacttgccgcaggcagttccaagatcaacattgtttccgtgga 324
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 281 ggcagcacacccggtagtacttgccgcaggcagttccaagatcaacattgtttccatgga 222

                                                                       
Query: 325 aatggtgcacgctaattttcgccaacatagcgtagtactcaatctctgacttcctaaggg 384
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 221 aatggtgcacgctaattttcgccaacatagcgtagcactcaatctctgacttcctaaggg 162

                                                                       
Query: 385 gagggcagttgttcgcgaggatgatcagcttccccttggagctgcggagcgtcttgagga 444
           ||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||
Sbjct: 161 gagggcagttgtttgcgaggattatcagcttcccctcggagctgcggagcgtcttgagga 102

                                      
Query: 445 cggtcttgtagccgagcgtgtacttgc 471
           |||||||||||||||||||||||||||
Sbjct: 101 cggtcttgtagccgagcgtgtacttgc 75



to top

>dbj|AK120984.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042D20, full
           insert sequence
          Length = 628

 Score =  359 bits (181), Expect = 5e-96
 Identities = 247/269 (91%)
 Strand = Plus / Minus

                                                                       
Query: 203 tcttcactgggtggtggtggtggtgttgatgatgtccgagtcaccagggtcaaggatgct 262
           ||||||||||| ||  | ||| ||||||||||||||||||||||||||||| | ||||||
Sbjct: 423 tcttcactgggaggcaggggttgtgttgatgatgtccgagtcaccagggtcgatgatgct 364

                                                                       
Query: 263 gaggcagcacacccggtagtacttgccgcaggcagttccaagatcaacattgtttccgtg 322
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 363 gaggcagcacacccggtagtacttgccgcaggcagttccaagatcaacattgtttccatg 304

                                                                       
Query: 323 gaaatggtgcacgctaattttcgccaacatagcgtagtactcaatctctgacttcctaag 382
           ||||||||| ||||||| |||  ||||||| ||||| ||||||||||| |||||||| ||
Sbjct: 303 gaaatggtgaacgctaacttttcccaacatggcgtaatactcaatctcagacttcctgag 244

                                                                       
Query: 383 gggagggcagttgttcgcgaggatgatcagcttccccttggagctgcggagcgtcttgag 442
            |||||||||||||| || ||||| |||||||||||||||||| |||| |||||||||||
Sbjct: 243 tggagggcagttgtttgcaaggataatcagcttccccttggagttgcgcagcgtcttgag 184

                                        
Query: 443 gacggtcttgtagccgagcgtgtacttgc 471
           |||||||||||||||||||||||||||||
Sbjct: 183 gacggtcttgtagccgagcgtgtacttgc 155



to top

>gb|BT018019.1| Zea mays clone EL01N0529A10.c mRNA sequence
          Length = 625

 Score =  331 bits (167), Expect = 1e-87
 Identities = 224/243 (92%)
 Strand = Plus / Minus

                                                                       
Query: 229 tgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttgc 288
           ||||||||||||||||||| ||||| | ||| |||||||||||||||| |||||||||||
Sbjct: 326 tgatgatgtccgagtcacctgggtcgatgatactgaggcagcacaccctgtagtacttgc 267

                                                                       
Query: 289 cgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaattttcgcca 348
           |||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||
Sbjct: 266 cgcaggcagtgccaagatcaacattgtttccgtggaaatggtgcacgctaactttggcca 207

                                                                       
Query: 349 acatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgaggatga 408
            ||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||
Sbjct: 206 gcatggcgtagtactcaatctcagacttcctaagtggagggcagttgtttgcgatgatga 147

                                                                       
Query: 409 tcagcttccccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtact 468
           ||||||| ||||||||| |||| |||||||||||||||||||||||||| || |||||||
Sbjct: 146 tcagctttcccttggagttgcgcagcgtcttgaggacggtcttgtagcccagggtgtact 87

              
Query: 469 tgc 471
           |||
Sbjct: 86  tgc 84



to top

>gb|AY106576.1| Zea mays PCO093173 mRNA sequence
          Length = 771

 Score =  323 bits (163), Expect = 3e-85
 Identities = 223/243 (91%)
 Strand = Plus / Minus

                                                                       
Query: 229 tgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttgc 288
           ||||||||||||||||||| ||||| | ||| |||||||||||||||| |||||||||||
Sbjct: 413 tgatgatgtccgagtcacctgggtcgatgatactgaggcagcacaccctgtagtacttgc 354

                                                                       
Query: 289 cgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaattttcgcca 348
           |||||||||| ||||||||||||||||||||||||||||||||||| |||| ||| ||||
Sbjct: 353 cgcaggcagtgccaagatcaacattgtttccgtggaaatggtgcacactaactttggcca 294

                                                                       
Query: 349 acatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgaggatga 408
            ||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||
Sbjct: 293 gcatggcgtagtactcaatctcagacttcctaagtggagggcagttgtttgcgatgatga 234

                                                                       
Query: 409 tcagcttccccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtact 468
           ||||||| ||||||||| |||| |||||||||||||||||||||||||| || |||||||
Sbjct: 233 tcagctttcccttggagttgcgcagcgtcttgaggacggtcttgtagcccagggtgtact 174

              
Query: 469 tgc 471
           |||
Sbjct: 173 tgc 171



to top

>ref|NM_191057.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 327

 Score =  212 bits (107), Expect = 8e-52
 Identities = 203/235 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 tccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttgccgcaggca 296
           |||||||||||||| || | ||  ||||| |||||||| |||||||||||||||||||||
Sbjct: 296 tccgagtcaccaggatcgacgacactgagacagcacactcggtagtacttgccgcaggca 237

                                                                       
Query: 297 gttccaagatcaacattgtttccgtggaaatggtgcacgctaattttcgccaacatagcg 356
           || |||||||||||||||||||| | ||| || | ||| |||| |||  ||| |||||| 
Sbjct: 236 gtgccaagatcaacattgtttccattgaagtgatacacactaacttttcccagcatagca 177

                                                                       
Query: 357 tagtactcaatctctgacttcctaaggggagggcagttgttcgcgaggatgatcagcttc 416
           ||||||||||| || ||||||||||| |||||||||||||| || | ||| |  ||||||
Sbjct: 176 tagtactcaatttcagacttcctaagtggagggcagttgtttgcaacgataactagcttc 117

                                                                  
Query: 417 cccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 471
           || |||||| ||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 116 cctttggagttgcggagggtcttgaggacggtcttgtagccgagggtgtacttgc 62



to top

>dbj|AK062929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-109-A05, full
           insert sequence
          Length = 635

 Score =  212 bits (107), Expect = 8e-52
 Identities = 203/235 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 tccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttgccgcaggca 296
           |||||||||||||| || | ||  ||||| |||||||| |||||||||||||||||||||
Sbjct: 364 tccgagtcaccaggatcgacgacactgagacagcacactcggtagtacttgccgcaggca 305

                                                                       
Query: 297 gttccaagatcaacattgtttccgtggaaatggtgcacgctaattttcgccaacatagcg 356
           || |||||||||||||||||||| | ||| || | ||| |||| |||  ||| |||||| 
Sbjct: 304 gtgccaagatcaacattgtttccattgaagtgatacacactaacttttcccagcatagca 245

                                                                       
Query: 357 tagtactcaatctctgacttcctaaggggagggcagttgttcgcgaggatgatcagcttc 416
           ||||||||||| || ||||||||||| |||||||||||||| || | ||| |  ||||||
Sbjct: 244 tagtactcaatttcagacttcctaagtggagggcagttgtttgcaacgataactagcttc 185

                                                                  
Query: 417 cccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 471
           || |||||| ||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 184 cctttggagttgcggagggtcttgaggacggtcttgtagccgagggtgtacttgc 130



to top

>ref|NM_188088.1| Oryza sativa (japonica cultivar-group), Ozsa8520 predicted mRNA
          Length = 336

 Score =  186 bits (94), Expect = 4e-44
 Identities = 211/250 (84%)
 Strand = Plus / Minus

                                                                       
Query: 222 gtggtgttgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtag 281
           ||||| |||||||| |||||||||||||| ||||  |||||||||||||| || ||| ||
Sbjct: 323 gtggtcttgatgatatccgagtcaccaggatcaataatgctgaggcagcaaacacggaag 264

                                                                       
Query: 282 tacttgccgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaatt 341
           || || || ||||| || || ||||| ||||| ||||||||||||||||| ||| | |  
Sbjct: 263 tatttaccacaggctgtccccagatcgacattatttccgtggaaatggtggacggtgacc 204

                                                                       
Query: 342 ttcgccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcg 401
           || ||||||||||||||||||||||| |||||||||| ||| || ||||||||||| |  
Sbjct: 203 ttggccaacatagcgtagtactcaatttctgacttccgaagaggtgggcagttgttagaa 144

                                                                       
Query: 402 aggatgatcagcttccccttggagctgcggagcgtcttgaggacggtcttgtagccgagc 461
           | ||| |  |||||| |||||||| | | ||| ||| |||||||||||||||||||||||
Sbjct: 143 atgatcactagcttcgccttggagttcctgagggtcctgaggacggtcttgtagccgagc 84

                     
Query: 462 gtgtacttgc 471
           ||||||||||
Sbjct: 83  gtgtacttgc 74



to top

>dbj|AK122128.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033132L17, full
           insert sequence
          Length = 569

 Score =  186 bits (94), Expect = 4e-44
 Identities = 211/250 (84%)
 Strand = Plus / Minus

                                                                       
Query: 222 gtggtgttgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtag 281
           ||||| |||||||| |||||||||||||| ||||  |||||||||||||| || ||| ||
Sbjct: 406 gtggtcttgatgatatccgagtcaccaggatcaataatgctgaggcagcaaacacggaag 347

                                                                       
Query: 282 tacttgccgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaatt 341
           || || || ||||| || || ||||| ||||| ||||||||||||||||| ||| | |  
Sbjct: 346 tatttaccacaggctgtccccagatcgacattatttccgtggaaatggtggacggtgacc 287

                                                                       
Query: 342 ttcgccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcg 401
           || ||||||||||||||||||||||| |||||||||| ||| || ||||||||||| |  
Sbjct: 286 ttggccaacatagcgtagtactcaatttctgacttccgaagaggtgggcagttgttagaa 227

                                                                       
Query: 402 aggatgatcagcttccccttggagctgcggagcgtcttgaggacggtcttgtagccgagc 461
           | ||| |  |||||| |||||||| | | ||| ||| |||||||||||||||||||||||
Sbjct: 226 atgatcactagcttcgccttggagttcctgagggtcctgaggacggtcttgtagccgagc 167

                     
Query: 462 gtgtacttgc 471
           ||||||||||
Sbjct: 166 gtgtacttgc 157



to top

>dbj|AK119715.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-F08, full
           insert sequence
          Length = 570

 Score =  186 bits (94), Expect = 4e-44
 Identities = 211/250 (84%)
 Strand = Plus / Minus

                                                                       
Query: 222 gtggtgttgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtag 281
           ||||| |||||||| |||||||||||||| ||||  |||||||||||||| || ||| ||
Sbjct: 406 gtggtcttgatgatatccgagtcaccaggatcaataatgctgaggcagcaaacacggaag 347

                                                                       
Query: 282 tacttgccgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaatt 341
           || || || ||||| || || ||||| ||||| ||||||||||||||||| ||| | |  
Sbjct: 346 tatttaccacaggctgtccccagatcgacattatttccgtggaaatggtggacggtgacc 287

                                                                       
Query: 342 ttcgccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcg 401
           || ||||||||||||||||||||||| |||||||||| ||| || ||||||||||| |  
Sbjct: 286 ttggccaacatagcgtagtactcaatttctgacttccgaagaggtgggcagttgttagaa 227

                                                                       
Query: 402 aggatgatcagcttccccttggagctgcggagcgtcttgaggacggtcttgtagccgagc 461
           | ||| |  |||||| |||||||| | | ||| ||| |||||||||||||||||||||||
Sbjct: 226 atgatcactagcttcgccttggagttcctgagggtcctgaggacggtcttgtagccgagc 167

                     
Query: 462 gtgtacttgc 471
           ||||||||||
Sbjct: 166 gtgtacttgc 157



to top

>dbj|AK058917.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A11, full
           insert sequence
          Length = 630

 Score =  186 bits (94), Expect = 4e-44
 Identities = 211/250 (84%)
 Strand = Plus / Minus

                                                                       
Query: 222 gtggtgttgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtag 281
           ||||| |||||||| |||||||||||||| ||||  |||||||||||||| || ||| ||
Sbjct: 409 gtggtcttgatgatatccgagtcaccaggatcaataatgctgaggcagcaaacacggaag 350

                                                                       
Query: 282 tacttgccgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaatt 341
           || || || ||||| || || ||||| ||||| ||||||||||||||||| ||| | |  
Sbjct: 349 tatttaccacaggctgtccccagatcgacattatttccgtggaaatggtggacggtgacc 290

                                                                       
Query: 342 ttcgccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcg 401
           || ||||||||||||||||||||||| |||||||||| ||| || ||||||||||| |  
Sbjct: 289 ttggccaacatagcgtagtactcaatttctgacttccgaagaggtgggcagttgttagaa 230

                                                                       
Query: 402 aggatgatcagcttccccttggagctgcggagcgtcttgaggacggtcttgtagccgagc 461
           | ||| |  |||||| |||||||| | | ||| ||| |||||||||||||||||||||||
Sbjct: 229 atgatcactagcttcgccttggagttcctgagggtcctgaggacggtcttgtagccgagc 170

                     
Query: 462 gtgtacttgc 471
           ||||||||||
Sbjct: 169 gtgtacttgc 160



to top

>gb|AF475116.1| Triticum aestivum ribosomal protein L30 mRNA, partial cds
          Length = 228

 Score =  137 bits (69), Expect = 4e-29
 Identities = 94/101 (93%), Gaps = 1/101 (0%)
 Strand = Plus / Minus

                                                                       
Query: 372 gacttcctaaggggagggcagttgttcgcgaggatgatcagcttccccttggagctgcgg 431
           |||||||| || |||||||||||||| |||||||| |||| ||||||||||||||| |||
Sbjct: 225 gacttcctgagcggagggcagttgtttgcgaggataatcaacttccccttggagctccgg 166

                                                    
Query: 432 agcgt-cttgaggacggtcttgtagccgagcgtgtacttgc 471
           ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 165 agcgtccttgaggacggtcttgtagccgagcgtgtacttgc 125



to top

>gb|AY107738.1| Zea mays PCO142140 mRNA sequence
          Length = 731

 Score =  135 bits (68), Expect = 1e-28
 Identities = 200/244 (81%)
 Strand = Plus / Minus

                                                                       
Query: 228 ttgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttg 287
           |||||||| || || |||||||| ||||  |||||||||||||| |||||  |||| || 
Sbjct: 409 ttgatgatatcagaatcaccaggatcaataatgctgaggcagcagacccgaaagtattta 350

                                                                       
Query: 288 ccgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaattttcgcc 347
           || |||||||||||||| || ||||||||||| ||||| ||||| ||  | |  || |||
Sbjct: 349 ccacaggcagttccaaggtcgacattgtttccatggaagtggtggacagtgaccttggcc 290

                                                                       
Query: 348 aacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgaggatg 407
           | |||||| ||||||||||| || ||||| | |||||| ||||||||||| |||| ||| 
Sbjct: 289 agcatagcatagtactcaatttcagacttacgaaggggcgggcagttgttagcgatgatc 230

                                                                       
Query: 408 atcagcttccccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtac 467
           |  ||||||  ||| ||| | | ||| ||| |||||||||||||||||||||| ||||||
Sbjct: 229 actagcttcgacttagagttcctgagagtcctgaggacggtcttgtagccgagagtgtac 170

               
Query: 468 ttgc 471
           ||||
Sbjct: 169 ttgc 166



to top

>gb|AF034949.1|AF034949 Zea mays ribosomal protein L30 (rpl30) mRNA, complete cds
          Length = 686

 Score =  135 bits (68), Expect = 1e-28
 Identities = 200/244 (81%)
 Strand = Plus / Minus

                                                                       
Query: 228 ttgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttg 287
           |||||||| || || |||||||| ||||  |||||||||||||| |||||  |||| || 
Sbjct: 398 ttgatgatatcagaatcaccaggatcaataatgctgaggcagcagacccgaaagtattta 339

                                                                       
Query: 288 ccgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaattttcgcc 347
           || |||||||||||||| || ||||||||||| ||||| ||||| ||  | |  || |||
Sbjct: 338 ccacaggcagttccaaggtcgacattgtttccatggaagtggtggacagtgaccttggcc 279

                                                                       
Query: 348 aacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgaggatg 407
           | |||||| ||||||||||| || ||||| | |||||| ||||||||||| |||| ||| 
Sbjct: 278 agcatagcatagtactcaatttcagacttacgaaggggcgggcagttgttagcgatgatc 219

                                                                       
Query: 408 atcagcttccccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtac 467
           |  ||||||  ||| ||| | | ||| ||| |||||||||||||||||||||| ||||||
Sbjct: 218 actagcttcgacttagagttcctgagagtcctgaggacggtcttgtagccgagagtgtac 159

               
Query: 468 ttgc 471
           ||||
Sbjct: 158 ttgc 155



to top

>gb|AC097175.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1119_H02,
              complete sequence
          Length = 138584

 Score =  125 bits (63), Expect = 1e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                          
Query: 245    accagggtcaaggatgctgaggcagcacacccggtagtacttgccgcaggcagttccaag 304
              ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 138154 accagggtcgatgatgctgaggcagcacacccggtagtacttgccgcaggcagttccaag 138095

                         
Query: 305    atcaacattgt 315
              |||||||||||
Sbjct: 138094 atcaacattgt 138084



 Score =  101 bits (51), Expect = 2e-18
 Identities = 90/103 (87%)
 Strand = Plus / Minus

                                                                          
Query: 316    ttccgtggaaatggtgcacgctaattttcgccaacatagcgtagtactcaatctctgact 375
              |||| ||||||||||| ||||||| |||  ||||||| ||||| ||||||||||| ||||
Sbjct: 137958 ttccatggaaatggtgaacgctaacttttcccaacatggcgtaatactcaatctcagact 137899

                                                         
Query: 376    tcctaaggggagggcagttgttcgcgaggatgatcagcttccc 418
              |||| || |||||||||||||| || ||||| |||||||||||
Sbjct: 137898 tcctgagtggagggcagttgtttgcaaggataatcagcttccc 137856



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 53/55 (96%)
 Strand = Plus / Minus

                                                                     
Query: 417    cccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 471
              ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 137032 cccttggagttgcgcagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 136978



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                           
Query: 203    tcttcactgggtggtggtggtggtgttgatgatgtccgagtcacc 247
              ||||||||||| ||  | ||| |||||||||||||||||||||||
Sbjct: 138284 tcttcactgggaggcaggggttgtgttgatgatgtccgagtcacc 138240



to top

>gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
            OSJNBa0088I06, complete sequence
          Length = 187651

 Score =  125 bits (63), Expect = 1e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                        
Query: 245  accagggtcaaggatgctgaggcagcacacccggtagtacttgccgcaggcagttccaag 304
            ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2808 accagggtcgatgatgctgaggcagcacacccggtagtacttgccgcaggcagttccaag 2749

                       
Query: 305  atcaacattgt 315
            |||||||||||
Sbjct: 2748 atcaacattgt 2738



 Score =  101 bits (51), Expect = 2e-18
 Identities = 90/103 (87%)
 Strand = Plus / Minus

                                                                        
Query: 316  ttccgtggaaatggtgcacgctaattttcgccaacatagcgtagtactcaatctctgact 375
            |||| ||||||||||| ||||||| |||  ||||||| ||||| ||||||||||| ||||
Sbjct: 2612 ttccatggaaatggtgaacgctaacttttcccaacatggcgtaatactcaatctcagact 2553

                                                       
Query: 376  tcctaaggggagggcagttgttcgcgaggatgatcagcttccc 418
            |||| || |||||||||||||| || ||||| |||||||||||
Sbjct: 2552 tcctgagtggagggcagttgtttgcaaggataatcagcttccc 2510



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 53/55 (96%)
 Strand = Plus / Minus

                                                                   
Query: 417  cccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 471
            ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1686 cccttggagttgcgcagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 1632



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 203  tcttcactgggtggtggtggtggtgttgatgatgtccgagtcacc 247
            ||||||||||| ||  | ||| |||||||||||||||||||||||
Sbjct: 2938 tcttcactgggaggcaggggttgtgttgatgatgtccgagtcacc 2894



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  125 bits (63), Expect = 1e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                            
Query: 245      accagggtcaaggatgctgaggcagcacacccggtagtacttgccgcaggcagttccaag 304
                ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23934319 accagggtcgatgatgctgaggcagcacacccggtagtacttgccgcaggcagttccaag 23934260

                           
Query: 305      atcaacattgt 315
                |||||||||||
Sbjct: 23934259 atcaacattgt 23934249



 Score =  101 bits (51), Expect = 2e-18
 Identities = 90/103 (87%)
 Strand = Plus / Minus

                                                                            
Query: 316      ttccgtggaaatggtgcacgctaattttcgccaacatagcgtagtactcaatctctgact 375
                |||| ||||||||||| ||||||| |||  ||||||| ||||| ||||||||||| ||||
Sbjct: 23934123 ttccatggaaatggtgaacgctaacttttcccaacatggcgtaatactcaatctcagact 23934064

                                                           
Query: 376      tcctaaggggagggcagttgttcgcgaggatgatcagcttccc 418
                |||| || |||||||||||||| || ||||| |||||||||||
Sbjct: 23934063 tcctgagtggagggcagttgtttgcaaggataatcagcttccc 23934021



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 53/55 (96%)
 Strand = Plus / Minus

                                                                       
Query: 417      cccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 471
                ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 23933197 cccttggagttgcgcagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 23933143



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                             
Query: 203      tcttcactgggtggtggtggtggtgttgatgatgtccgagtcacc 247
                ||||||||||| ||  | ||| |||||||||||||||||||||||
Sbjct: 23934449 tcttcactgggaggcaggggttgtgttgatgatgtccgagtcacc 23934405



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 207      cactgggtggtggtggtggtg 227
                |||||||||||||||||||||
Sbjct: 29375686 cactgggtggtggtggtggtg 29375666



to top

>gb|AY109857.1| Zea mays CL1835_1 mRNA sequence
          Length = 645

 Score =  103 bits (52), Expect = 5e-19
 Identities = 196/244 (80%)
 Strand = Plus / Minus

                                                                       
Query: 228 ttgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttg 287
           |||||||| || || |||||||| || |  |||||||||||||| || ||| |||| || 
Sbjct: 382 ttgatgatatcagaatcaccaggatcgataatgctgaggcagcagacacggaagtatttt 323

                                                                       
Query: 288 ccgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaattttcgcc 347
           || ||||| |||||||| |||||||||||||| ||||| ||||| ||  | |  || |||
Sbjct: 322 ccacaggctgttccaaggtcaacattgtttccatggaagtggtggactgtcaccttagcc 263

                                                                       
Query: 348 aacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgaggatg 407
           | |||||| ||||||||||| || ||||||| ||| ||||| |||||||| || | ||| 
Sbjct: 262 agcatagcatagtactcaatttcagacttccgaagcggaggacagttgttagcaatgatc 203

                                                                       
Query: 408 atcagcttccccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtac 467
           |  |||||   ||| ||  | | ||| ||| ||||||| |||||||||||||||||||||
Sbjct: 202 actagctttgacttagaattcctgagggtcctgaggacagtcttgtagccgagcgtgtac 143

               
Query: 468 ttgc 471
           ||||
Sbjct: 142 ttgc 139



to top

>ref|NM_103317.1| Arabidopsis thaliana structural constituent of ribosome AT1G36240
           mRNA, complete cds
          Length = 339

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                       
Query: 228 ttgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttg 287
           ||||||||||| |||||||| |||||||  |||||||||||  |||| ||| |||| || 
Sbjct: 317 ttgatgatgtcagagtcacctgggtcaactatgctgaggcatgacacacggaagtattta 258

                                          
Query: 288 ccgcaggcagttccaagatcaacattgtttc 318
           ||||||||||| |||||||||||||||||||
Sbjct: 257 ccgcaggcagtaccaagatcaacattgtttc 227



to top

>dbj|AP003570.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0432B10
          Length = 131918

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                    
Query: 261   ctgaggcagcacacccggtagtacttgccgcaggcagttccaagatcaacattgt 315
             ||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 41377 ctgagacagcacactcggtagtacttgccgcaggcagtgccaagatcaacattgt 41431



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                                 
Query: 420   ttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 471
             |||||| ||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 42899 ttggagttgcggagggtcttgaggacggtcttgtagccgagggtgtacttgc 42950



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                             
Query: 350   catagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
             |||||| ||||||||||| || ||||||||||| ||||||||||||||
Sbjct: 41622 catagcatagtactcaatttcagacttcctaagtggagggcagttgtt 41669



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                       
Query: 261      ctgaggcagcacacccggtagtacttgccgcaggcagttccaagatcaacattgt 315
                ||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 34544083 ctgagacagcacactcggtagtacttgccgcaggcagtgccaagatcaacattgt 34544137



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                           
Query: 316     ttccgtggaaatggtgcacgctaattttcgccaacatagcgtagtactcaatctctgact 375
               |||||||||||||||| ||| | |  || ||||||||||||||||||||||| |||||||
Sbjct: 9657922 ttccgtggaaatggtggacggtgaccttggccaacatagcgtagtactcaatttctgact 9657981

                                     
Query: 376     tcctaaggggagggcagttgtt 397
               ||| ||| || |||||||||||
Sbjct: 9657982 tccgaagaggtgggcagttgtt 9658003



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                                    
Query: 420      ttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 471
                |||||| ||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 34545605 ttggagttgcggagggtcttgaggacggtcttgtagccgagggtgtacttgc 34545656



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                      
Query: 417     cccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 471
               ||||||||| | | ||| ||| |||||||||||||||||||||||||||||||||
Sbjct: 9659894 cccttggagttcctgagggtcctgaggacggtcttgtagccgagcgtgtacttgc 9659948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                                
Query: 350      catagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
                |||||| ||||||||||| || ||||||||||| ||||||||||||||
Sbjct: 34544328 catagcatagtactcaatttcagacttcctaagtggagggcagttgtt 34544375



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 213     gtggtggtggtggtgttgat 232
               ||||||||||||||||||||
Sbjct: 3953906 gtggtggtggtggtgttgat 3953887



to top

>dbj|AP003247.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0425G02
          Length = 155432

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                     
Query: 261    ctgaggcagcacacccggtagtacttgccgcaggcagttccaagatcaacattgt 315
              ||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 119802 ctgagacagcacactcggtagtacttgccgcaggcagtgccaagatcaacattgt 119856



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                                  
Query: 420    ttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 471
              |||||| ||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 121324 ttggagttgcggagggtcttgaggacggtcttgtagccgagggtgtacttgc 121375



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                              
Query: 350    catagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
              |||||| ||||||||||| || ||||||||||| ||||||||||||||
Sbjct: 120047 catagcatagtactcaatttcagacttcctaagtggagggcagttgtt 120094



to top

>dbj|AP000836.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0038F12
          Length = 190014

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                         
Query: 316   ttccgtggaaatggtgcacgctaattttcgccaacatagcgtagtactcaatctctgact 375
             |||||||||||||||| ||| | |  || ||||||||||||||||||||||| |||||||
Sbjct: 95925 ttccgtggaaatggtggacggtgaccttggccaacatagcgtagtactcaatttctgact 95984

                                   
Query: 376   tcctaaggggagggcagttgtt 397
             ||| ||| || |||||||||||
Sbjct: 95985 tccgaagaggtgggcagttgtt 96006



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                    
Query: 417   cccttggagctgcggagcgtcttgaggacggtcttgtagccgagcgtgtacttgc 471
             ||||||||| | | ||| ||| |||||||||||||||||||||||||||||||||
Sbjct: 97897 cccttggagttcctgagggtcctgaggacggtcttgtagccgagcgtgtacttgc 97951



to top

>gb|BT012860.1| Lycopersicon esculentum clone 113948F, mRNA sequence
          Length = 645

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 137/170 (80%)
 Strand = Plus / Minus

                                                                       
Query: 228 ttgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttg 287
           ||||| ||||| || ||||| ||||||| |||||| |||||  |||| |||| | |||| 
Sbjct: 366 ttgataatgtcggaatcacctgggtcaatgatgctcaggcatgacacacggtggaacttt 307

                                                                       
Query: 288 ccgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaattttcgcc 347
           || || || || |||||||||||||||||||| | ||||||||| || | || ||| || 
Sbjct: 306 ccacatgctgtaccaagatcaacattgtttccattgaaatggtgaacaccaactttagcg 247

                                                             
Query: 348 aacatagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
           | |||||| || ||||||||||| || ||||| |  || |||||||||||
Sbjct: 246 agcatagcataatactcaatctcagatttcctcaaaggtgggcagttgtt 197



to top

>emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5, COMPLETE SEQUENCE
          Length = 210708

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 137/170 (80%)
 Strand = Plus / Plus

                                                                          
Query: 228    ttgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttg 287
              ||||||||||| || |||||||| ||||  |||| |||||||||||| | ||||||||| 
Sbjct: 112788 ttgatgatgtcggaatcaccaggatcaataatgccgaggcagcacactctgtagtacttt 112847

                                                                          
Query: 288    ccgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaattttcgcc 347
              ||||| ||||| || |  |||||||||||||| | |  |||||  || | ||  || |||
Sbjct: 112848 ccgcaagcagtgcccaagtcaacattgtttccattgtgatggtagactccaaccttagcc 112907

                                                                
Query: 348    aacatagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
              |||||||| ||||||||||  || |||||||| |  ||||| ||||||||
Sbjct: 112908 aacatagcatagtactcaaattcagacttcctcaacggaggacagttgtt 112957



to top

>gb|AY674241.1| Ixodes pacificus clone IP_7_60_92_88_CLU ribosomal protein L30
           mRNA, complete cds
          Length = 339

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 atgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttgccg 290
           ||||||||||| ||||| |||||   ||||||||| ||||| |||| ||||||||| |||
Sbjct: 314 atgatgtccgaatcacctgggtcggtgatgctgagacagcagaccctgtagtactttccg 255

                                        
Query: 291 caggcagttccaagatcaacattgtttcc 319
           ||||| || ||||| ||||  ||||||||
Sbjct: 254 caggcggtgccaagctcaatgttgtttcc 226



to top

>emb|AJ223316.1|LLAJ3316 Lupinus luteus mRNA for ribosomal protein L30
          Length = 558

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 147/185 (79%)
 Strand = Plus / Minus

                                                                       
Query: 243 tcaccagggtcaaggatgctgaggcagcacacccggtagtacttgccgcaggcagttcca 302
           ||||| |||||||  ||||||||||| || || | ||| ||||| || || ||||| |||
Sbjct: 376 tcacctgggtcaacaatgctgaggcaacaaactctgtaatactttccacatgcagtgcca 317

                                                                       
Query: 303 agatcaacattgtttccgtggaaatggtgcacgctaattttcgccaacatagcgtagtac 362
           ||||| ||||||||||| | | |||| || || | ||  || ||||||||||||||||| 
Sbjct: 316 agatccacattgtttccattgtaatgatgaactccaacctttgccaacatagcgtagtat 257

                                                                       
Query: 363 tcaatctctgacttcctaaggggagggcagttgttcgcgaggatgatcagcttccccttg 422
           || || || |||||||| |  ||||| |||||||| || | ||| ||||| || ||||| 
Sbjct: 256 tcgatttcagacttcctcaaaggaggacagttgttggcaatgataatcagtttacccttt 197

                
Query: 423 gagct 427
           |||||
Sbjct: 196 gagct 192



to top

>gb|AF366453.1|AF366453 Allium cepa clone AGF176 maintainer line sequence
          Length = 568

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 231 atgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttgccg 290
           ||||||||||| ||||| || ||||  ||||| |||||||| || ||  | ||||| || 
Sbjct: 207 atgatgtccgaatcacctggatcaataatgctcaggcagcaaacacgaaaatactttcca 266

                                        
Query: 291 caggcagttccaagatcaacattgtttcc 319
           || ||||||||||||||||||||||||||
Sbjct: 267 catgcagttccaagatcaacattgtttcc 295



to top

>gb|AF526198.1| Argopecten irradians isolate iolsaicl2ct3cn3 ribosomal protein L30
           mRNA, complete cds
          Length = 441

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 340 ttttcgccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcg 399
           |||| ||||||||||||||||||||||||||   |||||| ||||| |||  |||||| |
Sbjct: 244 ttttagccaacatagcgtagtactcaatctcgctcttcctgaggggtggggtgttgttgg 185

                           
Query: 400 cgaggatgatcagctt 415
           ||| ||||| ||||||
Sbjct: 184 cgatgatgaccagctt 169



to top

>gb|DQ066191.1| Ixodes scapularis isolate ISUFL99 ribosomal protein L30 mRNA,
           complete cds
          Length = 339

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 atgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttgccg 290
           ||||||||||| ||||| |||||   ||||||||| ||||| |||| ||||||||| |||
Sbjct: 314 atgatgtccgaatcacctgggtcggtgatgctgagacagcagaccctgtagtactttccg 255

                              
Query: 291 caggcagttccaagatcaa 309
           ||||| || ||||| ||||
Sbjct: 254 caggcggtaccaagctcaa 236



to top

>gb|AC025781.8|AC025781 Arabidopsis thaliana chromosome 1 BAC F15C21 genomic sequence, complete
             sequence
          Length = 112862

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                         
Query: 249   gggtcaaggatgctgaggcagcacacccggtagtacttgccgcaggcagttccaagatca 308
             |||||||  |||||||||||  |||| ||| |||| || ||||||||||| |||||||||
Sbjct: 80040 gggtcaactatgctgaggcatgacacacggaagtatttaccgcaggcagtaccaagatca 79981

                    
Query: 309   acattgt 315
             |||||||
Sbjct: 79980 acattgt 79974



to top

>gb|AY909412.1| Siniperca chuatsi clone C457 60S ribosomal protein L30 mRNA,
           complete cds
          Length = 469

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 357 tagtactcaatctctgacttcctaaggggagggcagttgttcgcgaggatgatcagctt 415
           |||||||||||||| || ||||| |||| |||||||||||| || ||||||| ||||||
Sbjct: 259 tagtactcaatctcagatttcctgagggcagggcagttgttggccaggatgaccagctt 201



to top

>gb|AF227621.1|AF227621 Euphorbia esula 60S ribosomal protein L30 mRNA, complete cds
          Length = 537

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagtt 394
           ||||||||||| ||||| ||||| || ||||||||||||||||| |||||
Sbjct: 212 gccaacatagcatagtattcaatttcggacttcctaaggggaggacagtt 163



to top

>gb|AF401585.1| Ictalurus punctatus ribosomal protein L30 mRNA, complete cds
          Length = 414

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 347 caacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgaggat 406
           |||||| ||||||||||| || ||||| ||||| || | |||||||||||| || |||||
Sbjct: 213 caacatggcgtagtactcgatttctgatttcctcagagcagggcagttgttggccaggat 154

                    
Query: 407 gatcagctt 415
           || ||||||
Sbjct: 153 gaccagctt 145



to top

>dbj|AB188378.1| Pelodiscus sinensis PsRPL30 mRNA for ribosomal protein L30,
           complete cds
          Length = 461

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 342 ttcgccaacatagcgtagtactcaatctctga 373
           |||||||||||||| |||||||||||||||||
Sbjct: 250 ttcgccaacatagcatagtactcaatctctga 219



to top

>gb|L40477.1|PEAFRR Pisum sativum (clone HW57) gene fragment
          Length = 250

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 231 atgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtactt 286
           |||||||| || |||||||| ||||  ||||||||||||||||| | |||||||||
Sbjct: 69  atgatgtcagaatcaccaggatcaacaatgctgaggcagcacactctgtagtactt 14



to top

>gb|DQ226656.1| Boechera divaricarpa isolate SLW-6-C09 mRNA sequence
          Length = 287

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 228 ttgatgatgtccgagtcaccagggtcaaggatgctgaggcagcacacccggtagtacttg 287
           ||||||||||| |||||||| |||||||  |||||||||||  | || ||| |||| || 
Sbjct: 217 ttgatgatgtcagagtcacctgggtcaactatgctgaggcatgaaacacggaagtattta 276

                      
Query: 288 ccgcaggcagt 298
           |||||||||||
Sbjct: 277 ccgcaggcagt 287



to top

>emb|CR721155.2|CNS0GJE1 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR718967.2|CNS0GHP9 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR718960.2|CNS0GHP2 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR717748.2|CNS0GGRE Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 259 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 200

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 199 ataaccagctt 189



to top

>emb|CR717129.2|CNS0GGAA Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR716828.2|CNS0GG1X Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR716264.2|CNS0GFM9 Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR711499.2|CNS0GBXZ Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR714447.2|CNS0GE7V Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR712086.2|CNS0GCEA Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 259 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 200

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 199 ataaccagctt 189



to top

>emb|CR711079.2|CNS0GBMB Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR710690.2|CNS0GBBI Tetraodon nigroviridis full-length cDNA
          Length = 431

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 228 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 169

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 168 ataaccagctt 158



to top

>emb|CR710614.2|CNS0GB9E Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR709795.2|CNS0GAMN Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR708965.2|CNS0G9ZL Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR708596.2|CNS0G9PC Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR708116.2|CNS0G9C0 Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 259 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 200

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 199 ataaccagctt 189



to top

>emb|CR707915.2|CNS0G96F Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 261 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 202

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 201 ataaccagctt 191



to top

>emb|CR707460.2|CNS0G8TS Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR707159.2|CNS0G8LF Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR705036.2|CNS0G6YG Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR704959.2|CNS0G6WB Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR705247.2|CNS0G74B Tetraodon nigroviridis full-length cDNA
          Length = 481

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 278 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 219

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 218 ataaccagctt 208



to top

>emb|CR705188.2|CNS0G72O Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR632724.2|CNS0EN6I Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR632713.2|CNS0EN67 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR633367.2|CNS0ENOD Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR633135.2|CNS0ENHX Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR632953.2|CNS0ENCV Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR632643.2|CNS0EN49 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR631858.2|CNS0EMIG Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR631456.2|CNS0EM79 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR717496.2|CNS0GGKE Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 354 gcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgaggatgatcagc 413
           ||||| |||||||||||||||||||| || |  ||||||||||| || ||||| | ||||
Sbjct: 254 gcgtaatactcaatctctgacttcctgagcgctgggcagttgttggccaggataaccagc 195

             
Query: 414 tt 415
           ||
Sbjct: 194 tt 193



to top

>ref|NM_112760.2| Arabidopsis thaliana structural constituent of ribosome AT3G18740
           mRNA, complete cds
          Length = 543

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 228 ttgatgatgtccgagtcaccagggtcaaggatgctgaggca 268
           ||||||||||| || |||||||| |||| ||||||||||||
Sbjct: 386 ttgatgatgtcggaatcaccaggatcaacgatgctgaggca 346



to top

>ref|XM_630717.1| Dictyostelium discoideum hypothetical protein (DDB0188846), partial
            mRNA
          Length = 2439

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 212  ggtggtggtggtggtgttgatgatg 236
            |||||||||||||||||||||||||
Sbjct: 1283 ggtggtggtggtggtgttgatgatg 1259



to top

>gb|AC158554.6| Mus musculus chromosome 15, clone RP23-353O17, complete sequence
          Length = 192019

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 212    ggtggtggtggtggtgttgatgatg 236
              |||||||||||||||||||||||||
Sbjct: 148666 ggtggtggtggtggtgttgatgatg 148690



to top

>gb|BC073560.1| Xenopus laevis MGC82844 protein, mRNA (cDNA clone MGC:82844
           IMAGE:5506948), complete cds
          Length = 512

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
           |||||||| || |||||||||||||| |||||||| || |  |||||||||||
Sbjct: 240 gccaacattgcatagtactcaatctccgacttcctcagagctgggcagttgtt 188



to top

>gb|BT012850.1| Lycopersicon esculentum clone 113928F, mRNA sequence
          Length = 611

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
           ||||||||||| |||||||| ||||| |||||||| |  ||||| ||||||||
Sbjct: 272 gccaacatagcatagtactctatctcagacttcctgataggaggacagttgtt 220



to top

>gb|AC148348.6| Medicago truncatula clone mth2-28b4, complete sequence
          Length = 118633

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 212   ggtggtggtggtggtgttgatgatg 236
             |||||||||||||||||||||||||
Sbjct: 52565 ggtggtggtggtggtgttgatgatg 52541



to top

>gb|AF446880.1|AF446880 Arabidopsis thaliana AT3g18740/MVE11_10 mRNA, complete cds
          Length = 339

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 228 ttgatgatgtccgagtcaccagggtcaaggatgctgaggca 268
           ||||||||||| || |||||||| |||| ||||||||||||
Sbjct: 317 ttgatgatgtcggaatcaccaggatcaacgatgctgaggca 277



to top

>gb|AC153570.9| Mus musculus 10 BAC RP23-221F6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 216030

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 212    ggtggtggtggtggtgttgatgatg 236
              |||||||||||||||||||||||||
Sbjct: 102632 ggtggtggtggtggtgttgatgatg 102656



to top

>gb|AY052710.1| Arabidopsis thaliana AT3g18740/MVE11_10 mRNA, complete cds
          Length = 526

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 228 ttgatgatgtccgagtcaccagggtcaaggatgctgaggca 268
           ||||||||||| || |||||||| |||| ||||||||||||
Sbjct: 368 ttgatgatgtcggaatcaccaggatcaacgatgctgaggca 328



to top

>gb|BC077047.1| Xenopus tropicalis MGC89963 protein, mRNA (cDNA clone MGC:89963
           IMAGE:7025770), complete cds
          Length = 470

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
           |||||||| || ||||||||||||||||| ||||| || |  |||||||||||
Sbjct: 264 gccaacattgcatagtactcaatctctgatttcctcagagctgggcagttgtt 212



to top

>ref|NM_001005110.1| Xenopus tropicalis MGC89963 protein (MGC89963), mRNA
          Length = 470

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
           |||||||| || ||||||||||||||||| ||||| || |  |||||||||||
Sbjct: 264 gccaacattgcatagtactcaatctctgatttcctcagagctgggcagttgtt 212



to top

>gb|AY088285.1| Arabidopsis thaliana clone 5180 mRNA, complete sequence
          Length = 531

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 228 ttgatgatgtccgagtcaccagggtcaaggatgctgaggca 268
           ||||||||||| || |||||||| |||| ||||||||||||
Sbjct: 386 ttgatgatgtcggaatcaccaggatcaacgatgctgaggca 346



to top

>emb|AJ009294.1|XLAJ9294 Xenopus laevis cDNA clone 19E1-2
          Length = 584

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
           |||||||| || |||||||||||||| |||||||| || |  |||||||||||
Sbjct: 272 gccaacattgcatagtactcaatctccgacttcctcagagctgggcagttgtt 220



to top

>dbj|AB026654.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MVE11
          Length = 75508

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 228   ttgatgatgtccgagtcaccagggtcaaggatgctgaggca 268
             ||||||||||| || |||||||| |||| ||||||||||||
Sbjct: 37682 ttgatgatgtcggaatcaccaggatcaacgatgctgaggca 37642



to top

>emb|CR855835.2| Xenopus tropicalis finished cDNA, clone TTpA022e03
          Length = 564

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
           |||||||| || ||||||||||||||||| ||||| || |  |||||||||||
Sbjct: 237 gccaacattgcatagtactcaatctctgatttcctcagagctgggcagttgtt 185



to top

>ref|XM_637943.1| Dictyostelium discoideum hypothetical protein (DDB0202956), partial
            mRNA
          Length = 6354

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 212  ggtggtggtggtggtgttgatgat 235
            ||||||||||||||||||||||||
Sbjct: 4232 ggtggtggtggtggtgttgatgat 4209



to top

>gb|DQ214212.1| Taeniopygia guttata clone 0065P0009H12 ribosomal protein L30-like
           mRNA, complete sequence
          Length = 642

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 350 catagcgtagtactcaatctctga 373
           ||||||||||||||||||||||||
Sbjct: 397 catagcgtagtactcaatctctga 374



to top

>gb|DQ214210.1| Taeniopygia guttata clone 0058P0030G07 ribosomal protein L30-like
           mRNA, complete sequence
          Length = 577

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 350 catagcgtagtactcaatctctga 373
           ||||||||||||||||||||||||
Sbjct: 358 catagcgtagtactcaatctctga 335



to top

>gb|AY432828.1| Aedes aegypti ASAP ID: 35483 cytosolic large ribosomal subunit L30
           mRNA sequence
          Length = 704

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 345 gccaacatagcgtagtactcaatctctgacttccta 380
           ||||||||||||||||| || ||||| |||||||||
Sbjct: 634 gccaacatagcgtagtattcgatctcggacttccta 599



to top

>ref|NM_200028.1| Danio rerio ribosomal protein L30 (rpl30), mRNA
          Length = 607

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 340 ttttcgccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcg 399
           |||| |||||||| || |||||||| ||||| |||||||| || |  ||||||||||| |
Sbjct: 281 tttttgccaacatggcatagtactcgatctcggacttcctcagagcggggcagttgttgg 222

                           
Query: 400 cgaggatgatcagctt 415
           | ||||| | ||||||
Sbjct: 221 ccaggatcaccagctt 206



to top

>gb|AY231694.1| Drosophila yakuba clone yak-em_CG10652 mRNA sequence
          Length = 333

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggg 384
           |||| ||||||||||||||| ||||| |||||||| ||||
Sbjct: 200 gccagcatagcgtagtactcgatctcggacttcctcaggg 161



to top

>emb|AL031279.1|HS163O16 Human DNA sequence from clone RP1-163O16 on chromosome 1p35.1-36.13
              Contains CA repeat, STS, complete sequence
          Length = 135628

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 202    ctcttcactgggtggtggtggtgg 225
              ||||||||||||||||||||||||
Sbjct: 108651 ctcttcactgggtggtggtggtgg 108674



to top

>emb|AL606457.3|OSJN00002 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0018M05,
             complete sequence
          Length = 164943

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 210   tgggtggtggtggtggtgttgatgatgt 237
             |||||||||||||||||| |||||||||
Sbjct: 89376 tgggtggtggtggtggtggtgatgatgt 89403



to top

>gb|AY118425.1| Drosophila melanogaster RH09938 full insert cDNA
          Length = 497

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggg 384
           |||| ||||||||||||||| ||||| |||||||| ||||
Sbjct: 258 gccagcatagcgtagtactcgatctcggacttcctcaggg 219



to top

>ref|NM_165271.1| Drosophila melanogaster Ribosomal protein L30 CG10652-RB,
           transcript variant B (RpL30), mRNA
          Length = 493

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggg 384
           |||| ||||||||||||||| ||||| |||||||| ||||
Sbjct: 253 gccagcatagcgtagtactcgatctcggacttcctcaggg 214



to top

>ref|NM_079948.2| Drosophila melanogaster Ribosomal protein L30 CG10652-RA,
           transcript variant A (RpL30), mRNA
          Length = 472

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggg 384
           |||| ||||||||||||||| ||||| |||||||| ||||
Sbjct: 232 gccagcatagcgtagtactcgatctcggacttcctcaggg 193



to top

>gb|AY071208.1| Drosophila melanogaster RE25263 full length cDNA
          Length = 473

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggg 384
           |||| ||||||||||||||| ||||| |||||||| ||||
Sbjct: 254 gccagcatagcgtagtactcgatctcggacttcctcaggg 215



to top

>gb|BC062278.1| Danio rerio ribosomal protein L30, mRNA (cDNA clone MGC:77683
           IMAGE:6997451), complete cds
          Length = 483

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 340 ttttcgccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcg 399
           |||| |||||||| || |||||||| ||||| |||||||| || |  ||||||||||| |
Sbjct: 250 tttttgccaacatggcatagtactcgatctcggacttcctcagagcggggcagttgttgg 191

                           
Query: 400 cgaggatgatcagctt 415
           | ||||| | ||||||
Sbjct: 190 ccaggatcaccagctt 175



to top

>gb|BC049055.1| Danio rerio ribosomal protein L30, mRNA (cDNA clone MGC:56640
           IMAGE:5916027), complete cds
          Length = 607

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 340 ttttcgccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcg 399
           |||| |||||||| || |||||||| ||||| |||||||| || |  ||||||||||| |
Sbjct: 281 tttttgccaacatggcatagtactcgatctcggacttcctcagagcggggcagttgttgg 222

                           
Query: 400 cgaggatgatcagctt 415
           | ||||| | ||||||
Sbjct: 221 ccaggatcaccagctt 206



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 210      tgggtggtggtggtggtgttgatgatgt 237
                |||||||||||||||||| |||||||||
Sbjct: 34471891 tgggtggtggtggtggtggtgatgatgt 34471918



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 211      gggtggtggtggtggtgttg 230
                ||||||||||||||||||||
Sbjct: 34937148 gggtggtggtggtggtgttg 34937167



to top

>dbj|AK120940.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023037H21, full
           insert sequence
          Length = 2055

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 210 tgggtggtggtggtggtgttgatgatgt 237
           |||||||||||||||||| |||||||||
Sbjct: 102 tgggtggtggtggtggtggtgatgatgt 129



to top

>emb|AL732344.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0403D02, complete
             sequence
          Length = 138387

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 210   tgggtggtggtggtggtgttgatgatgt 237
             |||||||||||||||||| |||||||||
Sbjct: 93439 tgggtggtggtggtggtggtgatgatgt 93466



to top

>emb|AL732351.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0103C06, complete
            sequence
          Length = 104146

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 210  tgggtggtggtggtggtgttgatgatgt 237
            |||||||||||||||||| |||||||||
Sbjct: 3772 tgggtggtggtggtggtggtgatgatgt 3799



to top

>gb|AC115844.7| Mus musculus chromosome 15, clone RP24-240I3, complete sequence
          Length = 164109

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 210   tgggtggtggtggtggtgttgatgatg 236
             |||||||||||||||||| ||||||||
Sbjct: 75993 tgggtggtggtggtggtgatgatgatg 75967



to top

>gb|AC167126.6| Mus musculus chromosome 1, clone RP24-104I19, complete sequence
          Length = 156900

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 212   ggtggtggtggtggtgttgatgatgtc 238
             |||||||||||||||| ||||||||||
Sbjct: 17133 ggtggtggtggtggtgatgatgatgtc 17107



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 212   ggtggtggtggtggtgttgatgatg 236
             |||||||||||||||| ||||||||
Sbjct: 17136 ggtggtggtggtggtggtgatgatg 17112



to top

>gb|AC167168.5| Mus musculus chromosome 1, clone RP23-100P14, complete sequence
          Length = 204256

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 212   ggtggtggtggtggtgttgatgatgtc 238
             |||||||||||||||| ||||||||||
Sbjct: 33236 ggtggtggtggtggtgatgatgatgtc 33262



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 212   ggtggtggtggtggtgttgatgatg 236
             |||||||||||||||| ||||||||
Sbjct: 33233 ggtggtggtggtggtggtgatgatg 33257



to top

>gb|AY432180.1| Aedes aegypti ASAP ID: 34535 cytosolic large ribosomal subunit L30
           mRNA sequence
          Length = 583

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 345 gccaacatagcgtagtactcaatctctgacttcct 379
           ||||||||||||||||| || ||||| ||||||||
Sbjct: 266 gccaacatagcgtagtattcgatctcggacttcct 232



to top

>gb|AC113323.12| Mus musculus chromosome 15, clone RP23-451O9, complete sequence
          Length = 175138

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 210    tgggtggtggtggtggtgttgatgatg 236
              |||||||||||||||||| ||||||||
Sbjct: 157739 tgggtggtggtggtggtgatgatgatg 157713



to top

>gb|DQ440259.1| Aedes aegypti clone AET-3168 60S ribosomal protein L30 mRNA,
           complete cds
          Length = 351

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 345 gccaacatagcgtagtactcaatctctgacttcct 379
           ||||||||||||||||| || ||||| ||||||||
Sbjct: 200 gccaacatagcgtagtattcgatctcggacttcct 166



to top

>gb|AC123072.4| Mus musculus BAC clone RP23-87D8 from chromosome 1, complete sequence
          Length = 248675

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 212    ggtggtggtggtggtgttgatgatgtc 238
              |||||||||||||||| ||||||||||
Sbjct: 182938 ggtggtggtggtggtggtgatgatgtc 182912



to top

>gb|AC123859.4| Mus musculus BAC clone RP23-346B13 from chromosome 3, complete sequence
          Length = 221423

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 214    tggtggtggtggtgttgatgatg 236
              |||||||||||||||||||||||
Sbjct: 121366 tggtggtggtggtgttgatgatg 121344



to top

>emb|CR711725.2|CNS0GC49 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR711634.2|CNS0GC1Q Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR719628.2|CNS0GI7M Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR719214.2|CNS0GHW4 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR719124.2|CNS0GHTM Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR718910.2|CNS0GHNO Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR718637.2|CNS0GHG3 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR718633.2|CNS0GHFZ Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR718227.2|CNS0GH4P Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR717320.2|CNS0GGFI Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR717298.2|CNS0GGEW Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 260 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 201

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 200 ataaccagctt 190



to top

>emb|CR717100.2|CNS0GG9H Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 261 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 202

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 201 ataaccagctt 191



to top

>emb|CR716614.2|CNS0GFVZ Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR716342.2|CNS0GFOF Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR716300.2|CNS0GFN9 Tetraodon nigroviridis full-length cDNA
          Length = 468

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 265 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 206

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 205 ataaccagctt 195



to top

>emb|CR715857.2|CNS0GFB1 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR715829.2|CNS0GFA9 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR715785.2|CNS0GF91 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR715634.2|CNS0GF4U Tetraodon nigroviridis full-length cDNA
          Length = 468

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 265 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 206

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 205 ataaccagctt 195



to top

>emb|CR715552.2|CNS0GF2K Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 261 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 202

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 201 ataaccagctt 191



to top

>emb|CR715281.2|CNS0GEV1 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR715190.2|CNS0GESI Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR715086.2|CNS0GEPM Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 261 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 202

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 201 ataaccagctt 191



to top

>emb|CR714767.2|CNS0GEGR Tetraodon nigroviridis full-length cDNA
          Length = 456

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 253 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 194

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 193 ataaccagctt 183



to top

>emb|CR714650.2|CNS0GEDI Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR714514.2|CNS0GE9Q Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 261 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 202

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 201 ataaccagctt 191



to top

>emb|CR714512.2|CNS0GE9O Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR714458.2|CNS0GE86 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR714442.2|CNS0GE7Q Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR714295.2|CNS0GE3N Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR714244.2|CNS0GE28 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR712362.2|CNS0GCLY Tetraodon nigroviridis full-length cDNA
          Length = 529

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 326 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 267

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 266 ataaccagctt 256



to top

>emb|CR714007.2|CNS0GDVN Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR713837.2|CNS0GDQX Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 260 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 201

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 200 ataaccagctt 190



to top

>emb|CR713206.2|CNS0GD9E Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR713089.2|CNS0GD65 Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR711265.2|CNS0GBRH Tetraodon nigroviridis full-length cDNA
          Length = 479

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 276 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 217

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 216 ataaccagctt 206



to top

>emb|CR710746.2|CNS0GBD2 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR710692.2|CNS0GBBK Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR710458.2|CNS0GB52 Tetraodon nigroviridis full-length cDNA
          Length = 551

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 351 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 292

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 291 ataaccagctt 281



to top

>emb|CR710442.2|CNS0GB4M Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR710415.2|CNS0GB3V Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR710172.2|CNS0GAX4 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR710053.2|CNS0GATT Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR708924.2|CNS0G9YG Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR707528.2|CNS0G8VO Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR705955.2|CNS0G7NZ Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR707035.2|CNS0G8HZ Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR706967.2|CNS0G8G3 Tetraodon nigroviridis full-length cDNA
          Length = 467

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 264 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 205

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 204 ataaccagctt 194



to top

>emb|CR706904.2|CNS0G8EC Tetraodon nigroviridis full-length cDNA
          Length = 468

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 265 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 206

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 205 ataaccagctt 195



to top

>emb|CR706853.2|CNS0G8CX Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR706786.2|CNS0G8B2 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR706734.2|CNS0G89M Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR706603.2|CNS0G85Z Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR706254.2|CNS0G7WA Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 261 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 202

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 201 ataaccagctt 191



to top

>emb|CR706191.2|CNS0G7UJ Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR699755.2|CNS0G2VR Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR700179.2|CNS0G37J Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 116/147 (78%)
 Strand = Plus / Minus

                                                                       
Query: 269 gcacacccggtagtacttgccgcaggcagttccaagatcaacattgtttccgtggaaatg 328
           |||||||| |||||| || || ||||| |||||||| || |  |||||||||  | | ||
Sbjct: 339 gcacaccctgtagtattttccacaggctgttccaagctcgatgttgtttccgctgtagtg 280

                                                                       
Query: 329 gtgcacgctaattttcgccaacatagcgtagtactcaatctctgacttcctaaggggagg 388
           ||| || | | |||| |||| ||| ||||| ||||||||||| || ||||| || |  ||
Sbjct: 279 gtggacaccagttttggccagcatggcgtaatactcaatctcagatttcctgagcgctgg 220

                                      
Query: 389 gcagttgttcgcgaggatgatcagctt 415
           ||||||||| || ||||| | ||||||
Sbjct: 219 gcagttgttggccaggataaccagctt 193



to top

>emb|CR697838.2|CNS0G1EI Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| ||||||||||| |||||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctcagacttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR696260.2|CNS0G06O Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR694316.2|CNS0FYOO Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 259 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 200

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 199 ataaccagctt 189



to top

>emb|CR693971.3|CNS0FYF3 Tetraodon nigroviridis full-length cDNA
          Length = 449

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 116/147 (78%)
 Strand = Plus / Minus

                                                                       
Query: 269 gcacacccggtagtacttgccgcaggcagttccaagatcaacattgtttccgtggaaatg 328
           |||||||| |||||| || || ||||| |||||||| || |  |||||||||  | | ||
Sbjct: 339 gcacaccctgtagtattttccacaggctgttccaagctcgatgttgtttccgctgtagtg 280

                                                                       
Query: 329 gtgcacgctaattttcgccaacatagcgtagtactcaatctctgacttcctaaggggagg 388
           ||| || | | |||| |||| ||| ||||| ||||||||||| || ||||| || |  ||
Sbjct: 279 gtggacaccagttttggccagcatggcgtaatactcaatctcagatttcctgagcgctgg 220

                                      
Query: 389 gcagttgttcgcgaggatgatcagctt 415
           ||||||||| || ||||| | ||||||
Sbjct: 219 gcagttgttggccaggataaccagctt 193



to top

>emb|CR688011.2|CNS0FTTJ Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR686515.2|CNS0FSNZ Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR676104.2|CNS0FKNI Tetraodon nigroviridis full-length cDNA
          Length = 470

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 116/147 (78%)
 Strand = Plus / Minus

                                                                       
Query: 269 gcacacccggtagtacttgccgcaggcagttccaagatcaacattgtttccgtggaaatg 328
           |||||||| |||||| || || ||||| |||||||| || |  |||||||||  | | ||
Sbjct: 343 gcacaccctgtagtattttccacaggctgttccaagctcgatgttgtttccgctgtagtg 284

                                                                       
Query: 329 gtgcacgctaattttcgccaacatagcgtagtactcaatctctgacttcctaaggggagg 388
           ||| || | | |||| |||| ||| ||||| ||||||||||| || ||||| || |  ||
Sbjct: 283 gtggacaccagttttggccagcatggcgtaatactcaatctcagatttcctgagcgctgg 224

                                      
Query: 389 gcagttgttcgcgaggatgatcagctt 415
           ||||||||| || ||||| | ||||||
Sbjct: 223 gcagttgttggccaggataaccagctt 197



to top

>emb|CR673664.2|CNS0FIRQ Tetraodon nigroviridis full-length cDNA
          Length = 551

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 116/147 (78%)
 Strand = Plus / Minus

                                                                       
Query: 269 gcacacccggtagtacttgccgcaggcagttccaagatcaacattgtttccgtggaaatg 328
           |||||||| |||||| || || ||||| |||||||| || |  |||||||||  | | ||
Sbjct: 427 gcacaccctgtagtattttccacaggctgttccaagctcgatgttgtttccgctgtagtg 368

                                                                       
Query: 329 gtgcacgctaattttcgccaacatagcgtagtactcaatctctgacttcctaaggggagg 388
           ||| || | | |||| |||| ||| ||||| ||||||||||| || ||||| || |  ||
Sbjct: 367 gtggacaccagttttggccagcatggcgtaatactcaatctcagatttcctgagcgctgg 308

                                      
Query: 389 gcagttgttcgcgaggatgatcagctt 415
           ||||||||| || ||||| | ||||||
Sbjct: 307 gcagttgttggccaggataaccagctt 281



to top

>emb|CR657577.2|CNS0F6CV Tetraodon nigroviridis full-length cDNA
          Length = 529

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 116/147 (78%)
 Strand = Plus / Minus

                                                                       
Query: 269 gcacacccggtagtacttgccgcaggcagttccaagatcaacattgtttccgtggaaatg 328
           |||||||| |||||| || || ||||| |||||||| || |  |||||||||  | | ||
Sbjct: 405 gcacaccctgtagtattttccacaggctgttccaagctcgatgttgtttccgctgtagtg 346

                                                                       
Query: 329 gtgcacgctaattttcgccaacatagcgtagtactcaatctctgacttcctaaggggagg 388
           ||| || | | |||| |||| ||| ||||| ||||||||||| || ||||| || |  ||
Sbjct: 345 gtggacaccagttttggccagcatggcgtaatactcaatctcagatttcctgagcgctgg 286

                                      
Query: 389 gcagttgttcgcgaggatgatcagctt 415
           ||||||||| || ||||| | ||||||
Sbjct: 285 gcagttgttggccaggataaccagctt 259



to top

>emb|CR632770.2|CNS0EN7S Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR633399.2|CNS0ENP9 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR633182.2|CNS0ENJ8 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR633150.2|CNS0ENIC Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR633084.2|CNS0ENGI Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR632999.2|CNS0ENE5 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR632929.2|CNS0ENC7 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR632558.2|CNS0EN1W Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR632550.2|CNS0EN1O Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR632463.2|CNS0EMZ9 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR631300.2|CNS0EM2X Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR631287.2|CNS0EM2K Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR631156.2|CNS0ELYX Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 261 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 202

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 201 ataaccagctt 191



to top

>emb|CR632443.2|CNS0EMYP Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR632435.2|CNS0EMYH Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR632229.2|CNS0EMSR Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR632155.2|CNS0EMQP Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR632137.2|CNS0EMQ7 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR632021.2|CNS0EMMZ Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR631508.2|CNS0EM8Q Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR631377.2|CNS0EM52 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR631314.2|CNS0EM3B Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR631750.2|CNS0EMFG Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 262 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 203

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 202 ataaccagctt 192



to top

>emb|CR631664.2|CNS0EMD2 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|CR631617.2|CNS0EMBR Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||| |||||||||||||| ||||| || |  ||||||||||| || |||
Sbjct: 263 gccagcatggcgtaatactcaatctctgatttcctgagcgctgggcagttgttggccagg 204

                      
Query: 405 atgatcagctt 415
           || | ||||||
Sbjct: 203 ataaccagctt 193



to top

>emb|AJ843087.1| Platichthys flesus mRNA for 60S ribosomal protein L30 (rpl30 gene)
          Length = 486

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 gccaacatagcgtagtactcaatctctgacttcctaaggggagggcagttgttcgcgagg 404
           |||| ||| ||||||||||| | ||| || ||||| ||||  ||||||||||| || |||
Sbjct: 290 gccagcatggcgtagtactccacctcagatttcctgagggccgggcagttgttggccagg 231

                      
Query: 405 atgatcagctt 415
           |||| ||||||
Sbjct: 230 atgaccagctt 220



to top

>gb|DQ416021.1| Acyrthosiphon pisum ribosomal protein L30-like protein mRNA,
           complete cds
          Length = 348

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 347 caacatagcgtagtactcaatctctga 373
           |||||| ||||||||||||||||||||
Sbjct: 198 caacatggcgtagtactcaatctctga 172



to top

>gb|AC146333.35| Medicago truncatula clone mth2-8d3, complete sequence
          Length = 122694

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                         
Query: 245   accagggtcaaggatgctgaggcagcacacccggtagtacttgccgcaggcagttccaag 304
             |||||| ||||  ||||||||||||||||| | ||| ||||| ||||| ||||| || | 
Sbjct: 59939 accaggatcaacaatgctgaggcagcacactctgtaatactttccgcaagcagtgcccaa 59880

                        
Query: 305   atcaacattgt 315
              ||||||||||
Sbjct: 59879 gtcaacattgt 59869



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 348   aacatagcgtagtactcaatctctgacttcctaaggggagggcagttgtt 397
             |||||||| ||||||||||| || |||||||| |  ||||| ||||||||
Sbjct: 58910 aacatagcatagtactcaatttcagacttcctcaaaggaggacagttgtt 58861



to top

>gb|DQ073391.1| Heliocidaris tuberculata homeobox protein Hox11/13 (Hox11/13) mRNA,
            complete cds
          Length = 3032

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 214  tggtggtggtggtgttgatgatg 236
            |||||||||||||||||||||||
Sbjct: 1198 tggtggtggtggtgttgatgatg 1176



to top

>gb|DQ073390.1| Heliocidaris erythrogramma homeobox protein Hox11/13 (Hox11/13) mRNA,
            complete cds
          Length = 3372

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 214  tggtggtggtggtgttgatgatg 236
            |||||||||||||||||||||||
Sbjct: 1128 tggtggtggtggtgttgatgatg 1106



to top

>gb|AC158361.3| Mus musculus BAC clone RP23-227A12 from chromosome 3, complete sequence
          Length = 211804

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 214    tggtggtggtggtgttgatgatg 236
              |||||||||||||||||||||||
Sbjct: 189287 tggtggtggtggtgttgatgatg 189309



to top

>gb|AC009205.6|AC009205 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone
             BACR04C20, complete sequence
          Length = 166918

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 345   gccaacatagcgtagtactcaatctctgacttcct 379
             |||| ||||||||||||||| ||||| ||||||||
Sbjct: 48026 gccagcatagcgtagtactcgatctcggacttcct 48060



to top

>gb|AC011756.5|AC011756 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone
              BACR17A06, complete sequence
          Length = 170546

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 345    gccaacatagcgtagtactcaatctctgacttcct 379
              |||| ||||||||||||||| ||||| ||||||||
Sbjct: 133594 gccagcatagcgtagtactcgatctcggacttcct 133628



to top

>gb|AC008746.10| Homo sapiens chromosome 19 clone CTD-2587H19, complete sequence
          Length = 200070

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 214   tggtggtggtggtgttgatgatg 236
             |||||||||||||||||||||||
Sbjct: 89002 tggtggtggtggtgttgatgatg 88980



to top

>gb|AF233374.1|AF233374 Volvox carteri argininosuccinate lyase (VASL) gene, complete cds
          Length = 7637

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 210  tgggtggtggtggtggtgttgatgatg 236
            |||||||||||||||||| ||||||||
Sbjct: 2921 tgggtggtggtggtggtggtgatgatg 2895



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 212  ggtggtggtggtggtgttgatgat 235
            |||||||||||||||| |||||||
Sbjct: 2916 ggtggtggtggtggtgatgatgat 2893



to top

>emb|AL929569.13| Mouse DNA sequence from clone RP23-325I3 on chromosome 2, complete
             sequence
          Length = 166963

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 205   ttcactgggtggtggtggtggtg 227
             |||||||||||||||||||||||
Sbjct: 85840 ttcactgggtggtggtggtggtg 85862



to top

>gb|AC154222.2| Mus musculus BAC clone RP24-375M13 from 13, complete sequence
          Length = 169114

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 214   tggtggtggtggtgttgatgatg 236
             |||||||||||||||||||||||
Sbjct: 86841 tggtggtggtggtgttgatgatg 86819



to top

>gb|AE003661.3| Drosophila melanogaster chromosome 2L, section 70 of 83 of the complete
             sequence
          Length = 265558

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 345   gccaacatagcgtagtactcaatctctgacttcct 379
             |||| ||||||||||||||| ||||| ||||||||
Sbjct: 98732 gccagcatagcgtagtactcgatctcggacttcct 98766



to top

>gb|AC130720.3| Mus musculus BAC clone RP24-292B4 from chromosome 1, complete sequence
          Length = 176143

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 214   tggtggtggtggtgttgatgatg 236
             |||||||||||||||||||||||
Sbjct: 97136 tggtggtggtggtgttgatgatg 97114



to top

>gb|U31564.1|HEU31564 Heliocidaris erythrogramma HEHBOX7 (HeHbox7) gene, partial cds
          Length = 680

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 214 tggtggtggtggtgttgatgatg 236
           |||||||||||||||||||||||
Sbjct: 513 tggtggtggtggtgttgatgatg 491



to top

>gb|AC170917.2| Mus musculus BAC clone RP23-160F6 from chromosome 1, complete sequence
          Length = 195784

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 214    tggtggtggtggtgttgatgatg 236
              |||||||||||||||||||||||
Sbjct: 130888 tggtggtggtggtgttgatgatg 130866



to top

>emb|AL606914.9| Mouse DNA sequence from clone RP23-169H13 on chromosome 4, complete
             sequence
          Length = 197061

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 212   ggtggtggtggtggtgttgatgatgtc 238
             |||||||||||||||| ||||||||||
Sbjct: 35790 ggtggtggtggtggtggtgatgatgtc 35764



to top

>ref|NM_106443.3| Arabidopsis thaliana structural constituent of ribosome AT1G77940
           mRNA, complete cds
          Length = 635

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 76/94 (80%)
 Strand = Plus / Minus

                                                                       
Query: 280 agtacttgccgcaggcagttccaagatcaacattgtttccgtggaaatggtgcacgctaa 339
           ||||||| ||||| || ||||| | |||||| || ||||| | | ||||||| || | ||
Sbjct: 342 agtactttccgcaagctgttcccaaatcaacgttatttccattgtaatggtggacaccaa 283

                                             
Query: 340 ttttcgccaacatagcgtagtactcaatctctga 373
            ||| || | ||| ||||||||||||||||||||
Sbjct: 282 ctttagcgagcattgcgtagtactcaatctctga 249



to top

>gb|AY787010.1| Lessonia nigrescens clone Ln2-E02 SSR marker sequence
          Length = 591

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 212 ggtggtggtggtggtgttgatg 233
           ||||||||||||||||||||||
Sbjct: 143 ggtggtggtggtggtgttgatg 122



to top

>ref|XM_637923.1| Dictyostelium discoideum hypothetical protein (DDB0217841), partial
            mRNA
          Length = 2055

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 212  ggtggtggtggtggtgttgatgatgt 237
            |||||||||||||||| |||||||||
Sbjct: 1178 ggtggtggtggtggtggtgatgatgt 1153



to top

>ref|XM_636937.1| Dictyostelium discoideum hypothetical protein (DDB0204322), partial
            mRNA
          Length = 3324

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 212  ggtggtggtggtggtgttgatgatgt 237
            |||||||||||||||| |||||||||
Sbjct: 2555 ggtggtggtggtggtggtgatgatgt 2530



to top

>ref|XM_630025.1| Dictyostelium discoideum hypothetical protein (DDB0183795), partial
            mRNA
          Length = 1494

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 215  ggtggtggtggtgttgatgatg 236
            ||||||||||||||||||||||
Sbjct: 1198 ggtggtggtggtgttgatgatg 1219



to top

>gb|AC112953.15| Mus musculus chromosome 7, clone RP23-44J21, complete sequence
          Length = 205513

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 212   ggtggtggtggtggtgttgatgatgt 237
             |||||||||||||||| |||||||||
Sbjct: 95775 ggtggtggtggtggtgatgatgatgt 95750



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 212   ggtggtggtggtggtgttgatgatg 236
             |||||||||||||||| ||||||||
Sbjct: 95778 ggtggtggtggtggtggtgatgatg 95754



to top

>ref|NM_008845.2| Mus musculus phosphatidylinositol-4-phosphate 5-kinase, type II,
            alpha (Pip5k2a), mRNA
          Length = 3470

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 211  gggtggtggtggtggtgttgatgatg 236
            ||||||||||||||||| ||||||||
Sbjct: 1811 gggtggtggtggtggtggtgatgatg 1836



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 212  ggtggtggtggtggtgttgatgatg 236
            |||||||||||||||| ||||||||
Sbjct: 1815 ggtggtggtggtggtgatgatgatg 1839



to top

>gb|AC103388.6| Mus musculus chromosome 7, clone RP24-403B15, complete sequence
          Length = 164394

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 210    tgggtggtggtggtggtgttga 231
              ||||||||||||||||||||||
Sbjct: 153747 tgggtggtggtggtggtgttga 153726



to top

>gb|AY524016.1| Salvia coccinea deficiens (DEF) mRNA, DEFB2 paralog, complete cds
          Length = 729

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 211 gggtggtggtggtggtgttgatgatg 236
           ||||||||||||||||| ||||||||
Sbjct: 671 gggtggtggtggtggtggtgatgatg 646



to top

>gb|AC105076.25| Mus musculus chromosome 3, clone RP23-258P2, complete sequence
          Length = 193458

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 212   ggtggtggtggtggtgttgatgatgt 237
             ||||||||||||||||||| ||||||
Sbjct: 30518 ggtggtggtggtggtgttgttgatgt 30543



to top

>gb|AC093363.12| Mus musculus chromosome 7, clone RP23-60O3, complete sequence
          Length = 254081

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 212   ggtggtggtggtggtgttgatgatgt 237
             |||||||||||||||| |||||||||
Sbjct: 49167 ggtggtggtggtggtgatgatgatgt 49192



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 212   ggtggtggtggtggtgttgatgatgt 237
             |||||||||||||||| |||||||||
Sbjct: 49059 ggtggtggtggtggtgatgatgatgt 49084



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 212   ggtggtggtggtggtgttgatgatg 236
             |||||||||||||||| ||||||||
Sbjct: 49203 ggtggtggtggtggtggtgatgatg 49227



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 212   ggtggtggtggtggtgttgatgatg 236
             |||||||||||||||| ||||||||
Sbjct: 49056 ggtggtggtggtggtggtgatgatg 49080



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 212   ggtggtggtggtggtgttgatgatg 236
             |||||||||||||||| ||||||||
Sbjct: 48909 ggtggtggtggtggtggtgatgatg 48933



to top

>gb|BC079597.1| Mus musculus forkhead box G1, mRNA (cDNA clone IMAGE:6851938)
          Length = 3662

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 211  gggtggtggtggtggtgttgatgatg 236
            ||||||||||||||||| ||||||||
Sbjct: 1439 gggtggtggtggtggtgatgatgatg 1414



to top

>ref|XM_362901.1| Magnaporthe grisea 70-15 hypothetical protein (MG08536.4) partial
           cds
          Length = 2244

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 212 ggtggtggtggtggtgttgatgatgt 237
           ||||||||||||||||||| ||||||
Sbjct: 391 ggtggtggtggtggtgttggtgatgt 416



to top

>gb|AC140355.3| Mus musculus BAC clone RP23-214D3 from chromosome 9, complete sequence
          Length = 221753

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 193   agctctcttctcttcactgggt 214
             ||||||||||||||||||||||
Sbjct: 21794 agctctcttctcttcactgggt 21815



to top

>gb|BC046958.1| Mus musculus forkhead box G1, mRNA (cDNA clone MGC:54714
           IMAGE:6314329), complete cds
          Length = 2611

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 211 gggtggtggtggtggtgttgatgatg 236
           ||||||||||||||||| ||||||||
Sbjct: 373 gggtggtggtggtggtgatgatgatg 348



to top

>ref|XM_958853.1| Neurospora crassa OR74A hypothetical protein (NCU02790.1) partial
           mRNA
          Length = 2289

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 212 ggtggtggtggtggtgttgatg 233
           ||||||||||||||||||||||
Sbjct: 59  ggtggtggtggtggtgttgatg 38



to top

>ref|XM_329977.1| Neurospora crassa OR74A hypothetical protein (NCU02790.1) partial
           mRNA
          Length = 2289

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 212 ggtggtggtggtggtgttgatg 233
           ||||||||||||||||||||||
Sbjct: 59  ggtggtggtggtggtgttgatg 38



to top

>ref|XM_714216.1| Candida albicans SC5314 hypothetical protein (CaO19_7547), mRNA
          Length = 1089

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 212 ggtggtggtggtggtgttgatgatgt 237
           |||||||||||||||| |||||||||
Sbjct: 391 ggtggtggtggtggtggtgatgatgt 416



to top

>ref|NM_008241.1| Mus musculus forkhead box G1 (Foxg1), mRNA
          Length = 2934

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 211 gggtggtggtggtggtgttgatgatg 236
           ||||||||||||||||| ||||||||
Sbjct: 735 gggtggtggtggtggtgatgatgatg 710



to top

>gb|AC139943.3| Mus musculus BAC clone RP23-472M3 from chromosome 7, complete sequence
          Length = 183421

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 243    tcaccagggtcaaggatgctga 264
              ||||||||||||||||||||||
Sbjct: 155635 tcaccagggtcaaggatgctga 155614



to top

>gb|AC162690.2| Mus musculus chromosome 5, clone RP24-170F2, complete sequence
          Length = 180370

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 212  ggtggtggtggtggtgttgatg 233
            ||||||||||||||||||||||
Sbjct: 9706 ggtggtggtggtggtgttgatg 9685



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 212  ggtggtggtggtggtgttgatg 233
            ||||||||||||||||||||||
Sbjct: 9658 ggtggtggtggtggtgttgatg 9637



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 216  gtggtggtggtgttgatgatgt 237
            ||||||||||||||||||||||
Sbjct: 9609 gtggtggtggtgttgatgatgt 9588



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  tggtggtggtgttgatgatgt 237
            |||||||||||||||||||||
Sbjct: 9983 tggtggtggtgttgatgatgt 9963



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 214  tggtggtggtggtgttgatg 233
            ||||||||||||||||||||
Sbjct: 9542 tggtggtggtggtgttgatg 9523



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 217  tggtggtggtgttgatgatg 236
            ||||||||||||||||||||
Sbjct: 9518 tggtggtggtgttgatgatg 9499



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 214  tggtggtggtggtgttgatgatgt 237
            |||||||||||||| |||||||||
Sbjct: 9494 tggtggtggtggtgatgatgatgt 9471



to top

>gb|AC160533.6| Mus musculus chromosome 5, clone RP24-242L17, complete sequence
          Length = 170409

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 216   gtggtggtggtgttgatgatgt 237
             ||||||||||||||||||||||
Sbjct: 23000 gtggtggtggtgttgatgatgt 23021



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 212   ggtggtggtggtggtgttgatg 233
             ||||||||||||||||||||||
Sbjct: 22951 ggtggtggtggtggtgttgatg 22972



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 212   ggtggtggtggtggtgttgatg 233
             ||||||||||||||||||||||
Sbjct: 22903 ggtggtggtggtggtgttgatg 22924



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 217   tggtggtggtgttgatgatgt 237
             |||||||||||||||||||||
Sbjct: 22626 tggtggtggtgttgatgatgt 22646



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 214   tggtggtggtggtgttgatgatgt 237
             |||||||||||||| |||||||||
Sbjct: 23115 tggtggtggtggtgatgatgatgt 23138



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 217   tggtggtggtgttgatgatg 236
             ||||||||||||||||||||
Sbjct: 23091 tggtggtggtgttgatgatg 23110



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 214   tggtggtggtggtgttgatg 233
             ||||||||||||||||||||
Sbjct: 23067 tggtggtggtggtgttgatg 23086



to top

>gb|AC161364.4| Mus musculus BAC clone RP24-353J16 from chromosome 6, complete sequence
          Length = 182872

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 206    tcactgggtggtggtggtggtg 227
              ||||||||||||||||||||||
Sbjct: 127292 tcactgggtggtggtggtggtg 127271



to top

>ref|XM_992309.1| PREDICTED: Mus musculus forkhead box G1 (Foxg1), mRNA
          Length = 4592

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 211 gggtggtggtggtggtgttgatgatg 236
           ||||||||||||||||| ||||||||
Sbjct: 170 gggtggtggtggtggtgatgatgatg 145



to top

>gb|BC064449.1| Mus musculus forkhead box G1, mRNA (cDNA clone IMAGE:6416227),
           partial cds
          Length = 2896

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 211 gggtggtggtggtggtgttgatgatg 236
           ||||||||||||||||| ||||||||
Sbjct: 678 gggtggtggtggtggtgatgatgatg 653



to top

>gb|AC123941.3| Mus musculus BAC clone RP23-458G24 from chromosome 19, complete
             sequence
          Length = 182733

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 212   ggtggtggtggtggtgttgatg 233
             ||||||||||||||||||||||
Sbjct: 88631 ggtggtggtggtggtgttgatg 88610



to top

>emb|AL389894.4|LMFLCHR4A Leishmania major Friedlin chromosome 4, left end
          Length = 225394

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 211    gggtggtggtggtggtgttgatgatg 236
              ||||||||||||||||| ||||||||
Sbjct: 144788 gggtggtggtggtggtgatgatgatg 144813



to top

>emb|AJ583100.1| Donax semiestriatus 5S rRNA gene, clone DSE2
          Length = 500

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 212 ggtggtggtggtggtgttgatgatgt 237
           |||||||||||||||||||| |||||
Sbjct: 294 ggtggtggtggtggtgttgacgatgt 319



to top

>gb|BC055774.1| Mus musculus forkhead box G1, mRNA (cDNA clone IMAGE:6811138), with
           apparent retained intron
          Length = 2293

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 211 gggtggtggtggtggtgttgatgatg 236
           ||||||||||||||||| ||||||||
Sbjct: 67  gggtggtggtggtggtgatgatgatg 42



to top

>gb|AC121986.2| Mus musculus BAC clone RP24-293I7 from 10, complete sequence
          Length = 182686

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 212    ggtggtggtggtggtgttgatgatgt 237
              |||||||||||||||| |||||||||
Sbjct: 121811 ggtggtggtggtggtggtgatgatgt 121836



to top

>gb|AC122004.2| Mus musculus BAC clone RP24-337O4 from 18, complete sequence
          Length = 133247

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 211   gggtggtggtggtggtgttgatgatg 236
             ||||||||||||||||| ||||||||
Sbjct: 38465 gggtggtggtggtggtggtgatgatg 38490


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,092,547
Number of Sequences: 3902068
Number of extensions: 5092547
Number of successful extensions: 277890
Number of sequences better than 10.0: 1285
Number of HSP's better than 10.0 without gapping: 1289
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 263098
Number of HSP's gapped (non-prelim): 13949
length of query: 471
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 449
effective length of database: 17,147,199,772
effective search space: 7699092697628
effective search space used: 7699092697628
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top