ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags10j04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC137744.2| Oryza sativa (japonica cultivar-group) chromosome... 242 1e-60
2dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 242 1e-60
3dbj|AK066319.1| Oryza sativa (japonica cultivar-group) cDNA clon... 242 1e-60
4gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 242 1e-60
5emb|AL023581.1|HS45I4 Human DNA sequence from clone RP1-45I4 on ... 50 0.010
6gb|AC145381.4| Oryza sativa (japonica cultivar-group) chromosome... 46 0.16
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 46 0.16
8emb|AL627427.11| Human DNA sequence from clone RP11-350G11 on ch... 46 0.16
9gb|AC138001.2| Oryza sativa chromosome 3 BAC OSJNBa0093M23 genom... 46 0.16
10dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.16
11gb|AC154052.1| Drosophila melanogaster clone BACR01B21, complete... 44 0.62
12gb|AE003515.4| Drosophila melanogaster chromosome 3L, section 70... 44 0.62
13gb|AC150855.6| Bos taurus BAC CH240-472P12 (Children's Hospital... 42 2.4
14gb|AC160335.6| Mus musculus BAC clone RP23-38N19 from chromosome... 42 2.4
15gb|AC113263.19| Mus musculus strain 129S6/SvEvTac clone rp22-365... 42 2.4
16gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 42 2.4
17gb|AC007998.10| Homo sapiens chromosome 18, clone RP11-322E11, c... 42 2.4
18gb|AC158592.4| Mus musculus 10 BAC RP23-198D4 (Roswell Park Canc... 42 2.4
19gb|AC007236.5| Arabidopsis thaliana chromosome 2 clone T3D7 map ... 42 2.4
20gb|AC091885.2| Homo sapiens chromosome 5 clone RP11-116O11, comp... 42 2.4
21dbj|AK163289.1| Mus musculus 2 cells egg cDNA, RIKEN full-length... 42 2.4
22gb|AC159478.7| Mus musculus 10 BAC RP23-460F17 (Roswell Park Can... 42 2.4
23gb|AC068614.5| Homo sapiens BAC clone RP11-512N1 from 2, complet... 42 2.4
24gb|AC125455.3| Mus musculus BAC clone RP24-170L2 from chromosome... 42 2.4
25gb|AY328168.1| Vatica mangachapoi specimen-voucher Jian 20011129... 40 9.7
26gb|AY328167.1| Hopea hainanensis specimen-voucher Jian 200110040... 40 9.7
27gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete... 40 9.7
28gb|AY305720.1| Parashorea chinensis var. kwangsiensis tRNA-Leu (... 40 9.7
29gb|AY305719.1| Parashorea chinensis tRNA-Leu (trnL) gene, intron... 40 9.7
30gb|AC167559.2| Echinops telfairi, clone Echinops telfairi -24239... 40 9.7
31gb|L20809.1| Trypanosoma cruzi mucin-like protein gene, complete... 40 9.7
32emb|Z66514.1|CEK01A11 Caenorhabditis elegans Cosmid K01A11, comp... 40 9.7
33emb|CR626887.6| Zebrafish DNA sequence from clone DKEY-46I14 in ... 40 9.7
34emb|AL603783.14| Human DNA sequence from clone RP11-216B13 on ch... 40 9.7
35gb|AY026581.1| Shorea virescens trnL gene, partial intron sequence 40 9.7
36gb|AY026580.1| Shorea stenoptera trnL gene, partial intron sequence 40 9.7
37gb|AY026579.1| Shorea splendida trnL gene, partial intron sequence 40 9.7
38gb|AY026578.1| Shorea smithiana trnL gene, partial intron sequence 40 9.7
39gb|AY026577.1| Shorea singkawang trnL gene, partial intron sequence 40 9.7
40gb|AY026576.1| Shorea seminis trnL gene, partial intron sequence 40 9.7
41gb|AY026574.1| Shorea scaberrima trnL gene, partial intron sequence 40 9.7
42gb|AY026572.1| Shorea richetia trnL gene, partial intron sequence 40 9.7
43gb|AY026571.1| Shorea pinanga trnL gene, partial intron sequence 40 9.7
44gb|AY026570.1| Shorea pilosa trnL gene, partial intron sequence 40 9.7
45gb|AY026569.1| Shorea parvistipulata trnL gene, partial intron s... 40 9.7
46gb|AY026568.1| Shorea parvifolia trnL gene, partial intron sequence 40 9.7
47gb|AY026567.1| Shorea palembanica trnL gene, partial intron sequ... 40 9.7
48gb|AY026566.1| Shorea ovalis trnL gene, partial intron sequence 40 9.7
49gb|AY026565.1| Shorea multiflora trnL gene, partial intron sequence 40 9.7
50gb|AY026563.1| Shorea maxwelliana trnL gene, partial intron sequ... 40 9.7
51gb|AY026562.1| Shorea maxima trnL gene, partial intron sequence 40 9.7
52gb|AY026561.1| Shorea materialis trnL gene, partial intron sequence 40 9.7
53gb|AY026560.1| Shorea macrophylla trnL gene, partial intron sequ... 40 9.7
54gb|AY026559.1| Shorea longisperma trnL gene, partial intron sequ... 40 9.7
55gb|AY026558.1| Shorea leprosula trnL gene, partial intron sequence 40 9.7
56gb|AY026556.1| Shorea kunstleri trnL gene, partial intron sequence 40 9.7
57gb|AY026555.1| Shorea johorensis trnL gene, partial intron sequence 40 9.7
58gb|AY026554.1| Shorea javanica trnL gene, partial intron sequence 40 9.7
59gb|AY026553.1| Shorea isoptera trnL gene, partial intron sequence 40 9.7
60gb|AY026552.1| Shorea hopeifolia trnL gene, partial intron sequence 40 9.7
61gb|AY026551.1| Shorea guiso trnL gene, partial intron sequence 40 9.7
62gb|AY026550.1| Shorea foxworthyi trnL gene, partial intron sequence 40 9.7
63gb|AY026549.1| Shorea faguetiana trnL gene, partial intron sequence 40 9.7
64gb|AY026548.1| Shorea exelliptica trnL gene, partial intron sequ... 40 9.7
65gb|AY026547.1| Shorea beccariana trnL gene, partial intron sequence 40 9.7
66gb|AY026546.1| Shorea balangeran trnL gene, partial intron sequence 40 9.7
67gb|AY026545.1| Hopea wightiana trnL gene, partial intron sequence 40 9.7
68gb|AY026544.1| Hopea pubescens trnL gene, partial intron sequence 40 9.7
69gb|AY026543.1| Hopea pierrei trnL gene, partial intron sequence 40 9.7
70gb|AY026541.1| Hopea mengarawan trnL gene, partial intron sequence 40 9.7
71gb|AY026540.1| Hopea jucunda trnL gene, partial intron sequence 40 9.7
72gb|AY026539.1| Hopea ferruginea trnL gene, partial intron sequence 40 9.7
73gb|AY026538.1| Hopea dryobalanoides trnL gene, partial intron se... 40 9.7
74gb|AY026536.1| Hopea cernua trnL gene, partial intron sequence 40 9.7
75gb|AY026535.1| Hopea celtidifolia trnL gene, partial intron sequ... 40 9.7
76gb|AY026534.1| Hopea celebica trnL gene, partial intron sequence 40 9.7
77gb|AY026533.1| Hopea brevipetiolaris trnL gene, partial intron s... 40 9.7
78gb|AY026532.1| Hopea apiculata trnL gene, partial intron sequence 40 9.7
79gb|AY026530.1| Dryobalanops aromatica trnL gene, partial intron ... 40 9.7
80gb|AC090701.5| Homo sapiens chromosome 18, clone RP11-810M21, co... 40 9.7
81gb|AC025575.21| Homo sapiens 12 BAC RP11-934P3 (Roswell Park Can... 40 9.7
82emb|BX546482.15| Zebrafish DNA sequence from clone DKEY-226B20 i... 40 9.7
83gb|AC183387.3| Pan troglodytes BAC clone CH251-113M12 from chrom... 40 9.7
84gb|AC019077.9| Homo sapiens BAC clone RP11-323J4 from 4, complet... 40 9.7
85gb|AC023943.6| Homo sapiens chromosome , clone RP11-1G18, comple... 40 9.7
86ref|XM_689467.1| PREDICTED: Danio rerio similar to MGC85571 prot... 40 9.7
87ref|XM_688456.1| PREDICTED: Danio rerio similar to MGC85571 prot... 40 9.7
88emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in... 40 9.7
89gb|AC091108.5| Homo sapiens chromosome 18, clone RP11-765H19, co... 40 9.7
90gb|AC078961.23| Homo sapiens 4 BAC RP11-486H4 (Roswell Park Canc... 40 9.7
91gb|AC116015.16| Homo sapiens chromosome 11, clone RP11-356D19, c... 40 9.7
92emb|AL935161.18| Mouse DNA sequence from clone RP23-433M8 on chr... 40 9.7
93gb|U61533.1|TCU61533 Trypanosoma cruzi mucin-like protein (MUC.T... 40 9.7
94dbj|AB246600.1| Shorea zeylanica chloroplast trnL DNA, intron re... 40 9.7
95dbj|AB246599.1| Shorea worthingtonii chloroplast trnL DNA, intro... 40 9.7
96dbj|AB246598.1| Shorea gardneri chloroplast trnL DNA, intron reg... 40 9.7
97dbj|AB246597.1| Shorea ovalifolia chloroplast trnL DNA, intron r... 40 9.7
98dbj|AB246596.1| Shorea trapezifolia chloroplast trnL DNA, intron... 40 9.7
99dbj|AB246595.1| Shorea disticha chloroplast trnL DNA, intron reg... 40 9.7
100dbj|AB246594.1| Shorea megistophylla chloroplast trnL DNA, intro... 40 9.7
101dbj|AB246593.1| Shorea congestiflora chloroplast trnL DNA, intro... 40 9.7
102dbj|AB246592.1| Shorea cordifolia chloroplast trnL DNA, intron r... 40 9.7
103dbj|AB246591.1| Hopea wightiana chloroplast trnL DNA, intron reg... 40 9.7
104dbj|AB246587.1| Hopea helferi chloroplast trnL DNA, intron regio... 40 9.7
105dbj|AB246586.1| Hopea latifolia chloroplast trnL DNA, intron reg... 40 9.7
106dbj|AB246584.1| Shorea stipularis chloroplast trnL DNA, intron r... 40 9.7
107dbj|AB246583.1| Shorea assamica chloroplast trnL DNA, intron reg... 40 9.7
108dbj|AB246582.1| Shorea xanthophylla chloroplast trnL DNA, intron... 40 9.7
109dbj|AB246581.1| Shorea multiflora chloroplast trnL DNA, intron r... 40 9.7
110dbj|AB246580.1| Shorea seminis chloroplast trnL DNA, intron regi... 40 9.7
111dbj|AB246578.1| Shorea pallescens chloroplast trnL DNA, intron r... 40 9.7
112dbj|AB246577.1| Shorea lissophylla chloroplast trnL DNA, intron ... 40 9.7
113dbj|AB246576.1| Shorea dyeri chloroplast trnL DNA, intron region... 40 9.7
114dbj|AB246575.1| Shorea pinanga chloroplast trnL DNA, intron regi... 40 9.7
115dbj|AB246574.1| Shorea elliptica chloroplast trnL DNA, intron re... 40 9.7
116dbj|AB246573.1| Shorea splendens chloroplast trnL DNA, intron re... 40 9.7
117dbj|AB246572.1| Shorea richetia chloroplast trnL DNA, intron reg... 40 9.7
118dbj|AB246571.1| Shorea macrophylla chloroplast trnL DNA, intron ... 40 9.7
119dbj|AB246570.1| Shorea acuminata chloroplast trnL DNA, intron re... 40 9.7
120dbj|AB246569.1| Shorea leprosula chloroplast trnL DNA, intron re... 40 9.7
121dbj|AB246568.1| Shorea macroptera chloroplast trnL DNA, intron r... 40 9.7
122dbj|AB246567.1| Shorea parvifolia chloroplast trnL DNA, intron r... 40 9.7
123dbj|AB246566.1| Shorea quadrinervis chloroplast trnL DNA, intron... 40 9.7
124dbj|AB246565.1| Shorea bullata chloroplast trnL DNA, intron regi... 40 9.7
125dbj|AB246564.1| Shorea fallax chloroplast trnL DNA, intron regio... 40 9.7
126dbj|AB246563.1| Shorea curtisii chloroplast trnL DNA, intron reg... 40 9.7
127dbj|AB246562.1| Vateriopsis seychellarum chloroplast trnL DNA, i... 40 9.7
128dbj|AB246561.1| Vateria copallifera chloroplast trnL DNA, intron... 40 9.7
129dbj|AB246551.1| Vatica affinis chloroplast trnL DNA, intron regi... 40 9.7
130dbj|AB246550.1| Vatica chinensis chloroplast trnL DNA, intron re... 40 9.7
131dbj|AB246549.1| Vatica micrantha chloroplast trnL DNA, intron re... 40 9.7
132dbj|AB246548.1| Vatica coriacea chloroplast trnL DNA, intron reg... 40 9.7
133dbj|AB246547.1| Vatica pauciflora chloroplast trnL DNA, intron r... 40 9.7
134dbj|AB246546.1| Vatica bella chloroplast trnL DNA, intron region... 40 9.7
135dbj|AB246545.1| Cotylelobium scabriusculum chloroplast trnL DNA,... 40 9.7
136dbj|AB246544.1| Cotylelobium malayanum chloroplast trnL DNA, int... 40 9.7
137dbj|AB246608.1| Monotes madagascariensis chloroplast trnL DNA, i... 40 9.7
138dbj|AB246601.1| Shorea affinis chloroplast trnL DNA, intron regi... 40 9.7
139emb|AL935335.5| Zebrafish DNA sequence from clone CH211-244M22, ... 40 9.7
140emb|AL935136.4| Zebrafish DNA sequence from clone CH211-180B2, c... 40 9.7
141dbj|AB006402.1| Hopea odorata chloroplast DNA, intron of trnL, p... 40 9.7
142dbj|AB006401.1| Hopea nervosa chloroplast DNA, intron of trnL, p... 40 9.7
143dbj|AB006400.1| Neobalanocarpus heimii chloroplast DNA, intron o... 40 9.7
144dbj|AB006399.1| Parashorea lucida chloroplast DNA, intron of trn... 40 9.7
145dbj|AB006397.1| Shorea ovalis chloroplast DNA, intron of trnL, p... 40 9.7
146dbj|AB006396.1| Shorea macroptera chloroplast DNA, intron of trn... 40 9.7
147dbj|AB006395.1| Dryobalanops oblongifolia chloroplast DNA, intro... 40 9.7
148dbj|AB006394.1| Dryobalanops aromatica chloroplast DNA, intron o... 40 9.7
149dbj|AB006390.1| Vatica odorata chloroplast DNA, intron of trnL, ... 40 9.7
150dbj|AB006389.1| Cotylelobium malayanum chloroplast DNA, intron o... 40 9.7
151dbj|AB006388.1| Anisoptera oblonga chloroplast DNA, intron of tr... 40 9.7
152dbj|AB006387.1| Anisoptera laevis chloroplast DNA, intron of trn... 40 9.7
153dbj|AP002015.3| Homo sapiens genomic DNA, chromosome 4q22-q24, c... 40 9.7

>gb|AC137744.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0074L11, complete sequence
          Length = 180703

 Score =  242 bits (122), Expect = 1e-60
 Identities = 321/388 (82%)
 Strand = Plus / Plus

                                                                         
Query: 317   caacaacatgtgcgtcagatgcatgattcttgcagtacatgcccaagcttgtgcgtgcaa 376
             ||||| ||||||| ||||||| |||||||||| || |  ||| |||||||||||| || |
Sbjct: 60014 caacagcatgtgcttcagatgaatgattcttgtagaatttgctcaagcttgtgcgcgcga 60073

                                                                         
Query: 377   ttggctctccagataacgatgctgtcgatgacctgagaatttttacctcaacaaagtcac 436
             ||   || || ||||| ||||||||||||||| ||   ||||| |||||||  |||||||
Sbjct: 60074 ttacatccccggataatgatgctgtcgatgacttggtgattttcacctcaatgaagtcac 60133

                                                                         
Query: 437   caaccactggcttacgagctccgtcaccttcagatgtatgtgttacagggagactagtaa 496
             ||||||||||||| ||   | | ||||||||| ||||||| | ||||||||  || | ||
Sbjct: 60134 caaccactggcttgcgcagttcatcaccttcaaatgtatgcggtacagggacgctcgcaa 60193

                                                                         
Query: 497   acgaaaccctgtgcccccggtcagttttaccaaacagctctgtttcaggagctcgcttat 556
             |||||||||| ||||||| ||| ||||| |||| || ||||||||||||||| ||||| |
Sbjct: 60194 acgaaaccctatgccccctgtcggtttttccaatcatctctgtttcaggagcccgcttgt 60253

                                                                         
Query: 557   taggtccctcgactagaactacttgagtggtaccaatctgagaatcatagatctttcttg 616
             | |||||||||||||||||||  ||    || |||| ||||||||| ||||||||   ||
Sbjct: 60254 tcggtccctcgactagaactagctgtactgtcccaacctgagaatcgtagatcttcgctg 60313

                                                                         
Query: 617   tggtctcacggaangtgttgatcagttctgcaagtctnctctgcttaacatcattgggga 676
             | || |||||||| ||| |||| || ||||||||||| |||||||| ||||||| |||||
Sbjct: 60314 tagtttcacggaaggtgctgattagctctgcaagtctcctctgcttgacatcatcgggga 60373

                                         
Query: 677   catcatcctcataattccgatgagcatg 704
             |||||||| |||||||||||||||||||
Sbjct: 60374 catcatccacataattccgatgagcatg 60401



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  242 bits (122), Expect = 1e-60
 Identities = 321/388 (82%)
 Strand = Plus / Plus

                                                                            
Query: 317      caacaacatgtgcgtcagatgcatgattcttgcagtacatgcccaagcttgtgcgtgcaa 376
                ||||| ||||||| ||||||| |||||||||| || |  ||| |||||||||||| || |
Sbjct: 21707961 caacagcatgtgcttcagatgaatgattcttgtagaatttgctcaagcttgtgcgcgcga 21708020

                                                                            
Query: 377      ttggctctccagataacgatgctgtcgatgacctgagaatttttacctcaacaaagtcac 436
                ||   || || ||||| ||||||||||||||| ||   ||||| |||||||  |||||||
Sbjct: 21708021 ttacatccccggataatgatgctgtcgatgacttggtgattttcacctcaatgaagtcac 21708080

                                                                            
Query: 437      caaccactggcttacgagctccgtcaccttcagatgtatgtgttacagggagactagtaa 496
                ||||||||||||| ||   | | ||||||||| ||||||| | ||||||||  || | ||
Sbjct: 21708081 caaccactggcttgcgcagttcatcaccttcaaatgtatgcggtacagggacgctcgcaa 21708140

                                                                            
Query: 497      acgaaaccctgtgcccccggtcagttttaccaaacagctctgtttcaggagctcgcttat 556
                |||||||||| ||||||| ||| ||||| |||| || ||||||||||||||| ||||| |
Sbjct: 21708141 acgaaaccctatgccccctgtcggtttttccaatcatctctgtttcaggagcccgcttgt 21708200

                                                                            
Query: 557      taggtccctcgactagaactacttgagtggtaccaatctgagaatcatagatctttcttg 616
                | |||||||||||||||||||  ||    || |||| ||||||||| ||||||||   ||
Sbjct: 21708201 tcggtccctcgactagaactagctgtactgtcccaacctgagaatcgtagatcttcgctg 21708260

                                                                            
Query: 617      tggtctcacggaangtgttgatcagttctgcaagtctnctctgcttaacatcattgggga 676
                | || |||||||| ||| |||| || ||||||||||| |||||||| ||||||| |||||
Sbjct: 21708261 tagtttcacggaaggtgctgattagctctgcaagtctcctctgcttgacatcatcgggga 21708320

                                            
Query: 677      catcatcctcataattccgatgagcatg 704
                |||||||| |||||||||||||||||||
Sbjct: 21708321 catcatccacataattccgatgagcatg 21708348



to top

>dbj|AK066319.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013067A17, full
            insert sequence
          Length = 2156

 Score =  242 bits (122), Expect = 1e-60
 Identities = 321/388 (82%)
 Strand = Plus / Minus

                                                                        
Query: 317  caacaacatgtgcgtcagatgcatgattcttgcagtacatgcccaagcttgtgcgtgcaa 376
            ||||| ||||||| ||||||| |||||||||| || |  ||| |||||||||||| || |
Sbjct: 1805 caacagcatgtgcttcagatgaatgattcttgtagaatttgctcaagcttgtgcgcgcga 1746

                                                                        
Query: 377  ttggctctccagataacgatgctgtcgatgacctgagaatttttacctcaacaaagtcac 436
            ||   || || ||||| ||||||||||||||| ||   ||||| |||||||  |||||||
Sbjct: 1745 ttacatccccggataatgatgctgtcgatgacttggtgattttcacctcaatgaagtcac 1686

                                                                        
Query: 437  caaccactggcttacgagctccgtcaccttcagatgtatgtgttacagggagactagtaa 496
            ||||||||||||| ||   | | ||||||||| ||||||| | ||||||||  || | ||
Sbjct: 1685 caaccactggcttgcgcagttcatcaccttcaaatgtatgcggtacagggacgctcgcaa 1626

                                                                        
Query: 497  acgaaaccctgtgcccccggtcagttttaccaaacagctctgtttcaggagctcgcttat 556
            |||||||||| ||||||| ||| ||||| |||| || ||||||||||||||| ||||| |
Sbjct: 1625 acgaaaccctatgccccctgtcggtttttccaatcatctctgtttcaggagcccgcttgt 1566

                                                                        
Query: 557  taggtccctcgactagaactacttgagtggtaccaatctgagaatcatagatctttcttg 616
            | |||||||||||||||||||  ||    || |||| ||||||||| ||||||||   ||
Sbjct: 1565 tcggtccctcgactagaactagctgtactgtcccaacctgagaatcgtagatcttcgctg 1506

                                                                        
Query: 617  tggtctcacggaangtgttgatcagttctgcaagtctnctctgcttaacatcattgggga 676
            | || |||||||| ||| |||| || ||||||||||| |||||||| ||||||| |||||
Sbjct: 1505 tagtttcacggaaggtgctgattagctctgcaagtctcctctgcttgacatcatcgggga 1446

                                        
Query: 677  catcatcctcataattccgatgagcatg 704
            |||||||| |||||||||||||||||||
Sbjct: 1445 catcatccacataattccgatgagcatg 1418



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  242 bits (122), Expect = 1e-60
 Identities = 321/388 (82%)
 Strand = Plus / Plus

                                                                            
Query: 317      caacaacatgtgcgtcagatgcatgattcttgcagtacatgcccaagcttgtgcgtgcaa 376
                ||||| ||||||| ||||||| |||||||||| || |  ||| |||||||||||| || |
Sbjct: 22018160 caacagcatgtgcttcagatgaatgattcttgtagaatttgctcaagcttgtgcgcgcga 22018219

                                                                            
Query: 377      ttggctctccagataacgatgctgtcgatgacctgagaatttttacctcaacaaagtcac 436
                ||   || || ||||| ||||||||||||||| ||   ||||| |||||||  |||||||
Sbjct: 22018220 ttacatccccggataatgatgctgtcgatgacttggtgattttcacctcaatgaagtcac 22018279

                                                                            
Query: 437      caaccactggcttacgagctccgtcaccttcagatgtatgtgttacagggagactagtaa 496
                ||||||||||||| ||   | | ||||||||| ||||||| | ||||||||  || | ||
Sbjct: 22018280 caaccactggcttgcgcagttcatcaccttcaaatgtatgcggtacagggacgctcgcaa 22018339

                                                                            
Query: 497      acgaaaccctgtgcccccggtcagttttaccaaacagctctgtttcaggagctcgcttat 556
                |||||||||| ||||||| ||| ||||| |||| || ||||||||||||||| ||||| |
Sbjct: 22018340 acgaaaccctatgccccctgtcggtttttccaatcatctctgtttcaggagcccgcttgt 22018399

                                                                            
Query: 557      taggtccctcgactagaactacttgagtggtaccaatctgagaatcatagatctttcttg 616
                | |||||||||||||||||||  ||    || |||| ||||||||| ||||||||   ||
Sbjct: 22018400 tcggtccctcgactagaactagctgtactgtcccaacctgagaatcgtagatcttcgctg 22018459

                                                                            
Query: 617      tggtctcacggaangtgttgatcagttctgcaagtctnctctgcttaacatcattgggga 676
                | || |||||||| ||| |||| || ||||||||||| |||||||| ||||||| |||||
Sbjct: 22018460 tagtttcacggaaggtgctgattagctctgcaagtctcctctgcttgacatcatcgggga 22018519

                                            
Query: 677      catcatcctcataattccgatgagcatg 704
                |||||||| |||||||||||||||||||
Sbjct: 22018520 catcatccacataattccgatgagcatg 22018547



to top

>emb|AL023581.1|HS45I4 Human DNA sequence from clone RP1-45I4 on chromosome 6q24.1-24.3 Contains
              part of a novel gene (FLJ32928), two novel genes, and the
              5' end of the gene for androgen induced protein (AIG-1,
              CGI-103) (includes FLJ10485). Contains a CpG island,
              complete sequence
          Length = 137947

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 8      cagtaagcaaaaacaattatatgaaaaat 36
              ||||||||||||| |||||||||||||||
Sbjct: 100375 cagtaagcaaaaaaaattatatgaaaaat 100347



to top

>gb|AC145381.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0024K17
              map near S16403, complete sequence
          Length = 172238

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 603    atagatctttcttgtggtctcac 625
              |||||||||||||||||||||||
Sbjct: 124785 atagatctttcttgtggtctcac 124763



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 603      atagatctttcttgtggtctcac 625
                |||||||||||||||||||||||
Sbjct: 25008340 atagatctttcttgtggtctcac 25008318



to top

>emb|AL627427.11| Human DNA sequence from clone RP11-350G11 on chromosome 13, complete
             sequence
          Length = 102564

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 588   accaatctgagaatcatagatctttct 614
             ||||| |||||||||||||||||||||
Sbjct: 52655 accaacctgagaatcatagatctttct 52681



to top

>gb|AC138001.2| Oryza sativa chromosome 3 BAC OSJNBa0093M23 genomic sequence, complete
             sequence
          Length = 170020

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 603   atagatctttcttgtggtctcac 625
             |||||||||||||||||||||||
Sbjct: 40147 atagatctttcttgtggtctcac 40125



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 603      atagatctttcttgtggtctcac 625
                |||||||||||||||||||||||
Sbjct: 25099657 atagatctttcttgtggtctcac 25099635



to top

>gb|AC154052.1| Drosophila melanogaster clone BACR01B21, complete sequence
          Length = 167163

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 247   aaacattatgcaggcttaactaattc 272
             ||||||||| ||||||||||||||||
Sbjct: 70248 aaacattattcaggcttaactaattc 70273



to top

>gb|AE003515.4| Drosophila melanogaster chromosome 3L, section 70 of 83 of the complete
             sequence
          Length = 234263

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 247   aaacattatgcaggcttaactaattc 272
             ||||||||| ||||||||||||||||
Sbjct: 21743 aaacattattcaggcttaactaattc 21718



to top

>gb|AC150855.6| Bos taurus  BAC CH240-472P12 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 168955

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 516   gtcagttttaccaaacagctc 536
             |||||||||||||||||||||
Sbjct: 57489 gtcagttttaccaaacagctc 57509



to top

>gb|AC160335.6| Mus musculus BAC clone RP23-38N19 from chromosome 15, complete sequence
          Length = 212090

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 12    aagcaaaaacaattatatgaaaaat 36
             |||||||||||| ||||||||||||
Sbjct: 83330 aagcaaaaacaactatatgaaaaat 83306



to top

>gb|AC113263.19| Mus musculus strain 129S6/SvEvTac clone rp22-365j8 map 10, complete
             sequence
          Length = 123833

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 106   aaaattctttggatttcagct 126
             |||||||||||||||||||||
Sbjct: 31535 aaaattctttggatttcagct 31555



to top

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 11      taagcaaaaacaattatatgaaaaa 35
               |||||||||||||||| ||||||||
Sbjct: 1241982 taagcaaaaacaattaaatgaaaaa 1242006



to top

>gb|AC007998.10| Homo sapiens chromosome 18, clone RP11-322E11, complete sequence
          Length = 207799

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 670   ttggggacatcatcctcataa 690
             |||||||||||||||||||||
Sbjct: 51514 ttggggacatcatcctcataa 51494



to top

>gb|AC158592.4| Mus musculus 10 BAC RP23-198D4 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 196286

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 106    aaaattctttggatttcagct 126
              |||||||||||||||||||||
Sbjct: 112283 aaaattctttggatttcagct 112263



to top

>gb|AC007236.5| Arabidopsis thaliana chromosome 2 clone T3D7 map mi79a, complete
            sequence
          Length = 16031

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 17   aaaacaattatatgaaaaatg 37
            |||||||||||||||||||||
Sbjct: 9674 aaaacaattatatgaaaaatg 9654



to top

>gb|AC091885.2| Homo sapiens chromosome 5 clone RP11-116O11, complete sequence
          Length = 167297

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 207   aaattggatgatatgctccca 227
             |||||||||||||||||||||
Sbjct: 24141 aaattggatgatatgctccca 24161



to top

>dbj|AK163289.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
            clone:B020010C21 product:unclassifiable, full insert
            sequence
          Length = 4167

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 12   aagcaaaaacaattatatgaaaaat 36
            |||||||||||| ||||||||||||
Sbjct: 3871 aagcaaaaacaactatatgaaaaat 3895



to top

>gb|AC159478.7| Mus musculus 10 BAC RP23-460F17 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 174480

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 106    aaaattctttggatttcagct 126
              |||||||||||||||||||||
Sbjct: 164946 aaaattctttggatttcagct 164966



to top

>gb|AC068614.5| Homo sapiens BAC clone RP11-512N1 from 2, complete sequence
          Length = 164706

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 45    acaactacttccctctaaagaaaaa 69
             ||||||||||||||||||| |||||
Sbjct: 60535 acaactacttccctctaaaaaaaaa 60559



to top

>gb|AC125455.3| Mus musculus BAC clone RP24-170L2 from chromosome 15, complete sequence
          Length = 145059

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 12    aagcaaaaacaattatatgaaaaat 36
             |||||||||||| ||||||||||||
Sbjct: 17572 aagcaaaaacaactatatgaaaaat 17596



to top

>gb|AY328168.1| Vatica mangachapoi specimen-voucher Jian 2001112901 tRNA-Leu (trnL)
           gene, partial sequence; trnL-trnF intergenic spacer,
           complete sequence; and tRNA-Phe (trnF) gene, partial
           sequence; chloroplast
          Length = 1030

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 329 agcaaaaagaattatatgaaaaat 352



to top

>gb|AY328167.1| Hopea hainanensis specimen-voucher Jian 2001100402 tRNA-Leu (trnL)
           gene, partial sequence; trnL-trnF intergenic spacer,
           complete sequence; and tRNA-Phe (trnF) gene, partial
           sequence; chloroplast
          Length = 1062

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 353 agcaaaaagaattatatgaaaaat 376



to top

>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome
          Length = 2201561

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 13      agcaaaaacaattatatgaaaaat 36
               |||||||| |||||||||||||||
Sbjct: 1860144 agcaaaaaaaattatatgaaaaat 1860167



to top

>gb|AY305720.1| Parashorea chinensis var. kwangsiensis tRNA-Leu (trnL) gene,
           intron; chloroplast gene for chloroplast product
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY305719.1| Parashorea chinensis tRNA-Leu (trnL) gene, intron; chloroplast gene
           for chloroplast product
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AC167559.2| Echinops telfairi, clone Echinops telfairi -24239157I1, complete
             sequence
          Length = 35266

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    aacaattatatgaaaaatgt 38
             ||||||||||||||||||||
Sbjct: 26889 aacaattatatgaaaaatgt 26870



to top

>gb|L20809.1| Trypanosoma cruzi mucin-like protein gene, complete cds
          Length = 775

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 420 tacctcaacaaagtcaccaaccac 443
           |||| |||||||||||||||||||
Sbjct: 198 taccacaacaaagtcaccaaccac 221



to top

>emb|Z66514.1|CEK01A11 Caenorhabditis elegans Cosmid K01A11, complete sequence
          Length = 33650

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    aaaacaattatatgaaaaat 36
             ||||||||||||||||||||
Sbjct: 12286 aaaacaattatatgaaaaat 12305



to top

>emb|CR626887.6| Zebrafish DNA sequence from clone DKEY-46I14 in linkage group 15,
              complete sequence
          Length = 198090

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     aaaaacaattatatgaaaaa 35
              ||||||||||||||||||||
Sbjct: 113394 aaaaacaattatatgaaaaa 113375



to top

>emb|AL603783.14| Human DNA sequence from clone RP11-216B13 on chromosome 6 Contains two
             CpG islands, complete sequence
          Length = 94482

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 109   attctttggatttcagctgctcca 132
             ||||| ||||||||||||||||||
Sbjct: 87149 attctgtggatttcagctgctcca 87172



to top

>gb|AY026581.1| Shorea virescens trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026580.1| Shorea stenoptera trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026579.1| Shorea splendida trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026578.1| Shorea smithiana trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026577.1| Shorea singkawang trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026576.1| Shorea seminis trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026574.1| Shorea scaberrima trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026572.1| Shorea richetia trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026571.1| Shorea pinanga trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026570.1| Shorea pilosa trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 281 agcaaaaagaattatatgaaaaat 304



to top

>gb|AY026569.1| Shorea parvistipulata trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026568.1| Shorea parvifolia trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026567.1| Shorea palembanica trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026566.1| Shorea ovalis trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026565.1| Shorea multiflora trnL gene, partial intron sequence
          Length = 478

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026563.1| Shorea maxwelliana trnL gene, partial intron sequence
          Length = 481

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026562.1| Shorea maxima trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 281 agcaaaaagaattatatgaaaaat 304



to top

>gb|AY026561.1| Shorea materialis trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026560.1| Shorea macrophylla trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026559.1| Shorea longisperma trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026558.1| Shorea leprosula trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026556.1| Shorea kunstleri trnL gene, partial intron sequence
          Length = 481

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026555.1| Shorea johorensis trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026554.1| Shorea javanica trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026553.1| Shorea isoptera trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 281 agcaaaaagaattatatgaaaaat 304



to top

>gb|AY026552.1| Shorea hopeifolia trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026551.1| Shorea guiso trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026550.1| Shorea foxworthyi trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 280 agcaaaaagaattatatgaaaaat 303



to top

>gb|AY026549.1| Shorea faguetiana trnL gene, partial intron sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026548.1| Shorea exelliptica trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026547.1| Shorea beccariana trnL gene, partial intron sequence
          Length = 481

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026546.1| Shorea balangeran trnL gene, partial intron sequence
          Length = 478

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AY026545.1| Hopea wightiana trnL gene, partial intron sequence
          Length = 481

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026544.1| Hopea pubescens trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026543.1| Hopea pierrei trnL gene, partial intron sequence
          Length = 481

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 284 agcaaaaagaattatatgaaaaat 307



to top

>gb|AY026541.1| Hopea mengarawan trnL gene, partial intron sequence
          Length = 481

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 284 agcaaaaagaattatatgaaaaat 307



to top

>gb|AY026540.1| Hopea jucunda trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026539.1| Hopea ferruginea trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026538.1| Hopea dryobalanoides trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026536.1| Hopea cernua trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026535.1| Hopea celtidifolia trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026534.1| Hopea celebica trnL gene, partial intron sequence
          Length = 481

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 284 agcaaaaagaattatatgaaaaat 307



to top

>gb|AY026533.1| Hopea brevipetiolaris trnL gene, partial intron sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>gb|AY026532.1| Hopea apiculata trnL gene, partial intron sequence
          Length = 482

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 284 agcaaaaagaattatatgaaaaat 307



to top

>gb|AY026530.1| Dryobalanops aromatica trnL gene, partial intron sequence
          Length = 478

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>gb|AC090701.5| Homo sapiens chromosome 18, clone RP11-810M21, complete sequence
          Length = 188779

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     aacaattatatgaaaaatgt 38
              ||||||||||||||||||||
Sbjct: 168233 aacaattatatgaaaaatgt 168214



to top

>gb|AC025575.21| Homo sapiens 12 BAC RP11-934P3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 158531

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                              
Query: 182    atcatgagaacatatc-aaccaacttaaattg 212
              |||||||||||||||| |||||||| ||||||
Sbjct: 155121 atcatgagaacatatcaaaccaactcaaattg 155090



to top

>emb|BX546482.15| Zebrafish DNA sequence from clone DKEY-226B20 in linkage group 13,
              complete sequence
          Length = 206949

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 9      agtaagcaaaaacaattatatgaa 32
              |||||| |||||||||||||||||
Sbjct: 111237 agtaagtaaaaacaattatatgaa 111260



to top

>gb|AC183387.3| Pan troglodytes BAC clone CH251-113M12 from chromosome unknown, complete
              sequence
          Length = 175955

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 414    aatttttacctcaacaaagt 433
              ||||||||||||||||||||
Sbjct: 131461 aatttttacctcaacaaagt 131442



to top

>gb|AC019077.9| Homo sapiens BAC clone RP11-323J4 from 4, complete sequence
          Length = 190437

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 416    tttttacctcaacaaagtca 435
              ||||||||||||||||||||
Sbjct: 128870 tttttacctcaacaaagtca 128889



to top

>gb|AC023943.6| Homo sapiens chromosome , clone RP11-1G18, complete sequence
          Length = 153061

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 9     agtaagcaaaaacaattatatgaaaaat 36
             ||||||||  ||||||||||||||||||
Sbjct: 67293 agtaagcagtaacaattatatgaaaaat 67266



to top

>ref|XM_689467.1| PREDICTED: Danio rerio similar to MGC85571 protein (LOC566197),
           mRNA
          Length = 640

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 16  aaaaacaattatatgaaaaa 35
           ||||||||||||||||||||
Sbjct: 402 aaaaacaattatatgaaaaa 383



to top

>ref|XM_688456.1| PREDICTED: Danio rerio similar to MGC85571 protein (LOC565171),
           mRNA
          Length = 640

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 16  aaaaacaattatatgaaaaa 35
           ||||||||||||||||||||
Sbjct: 402 aaaaacaattatatgaaaaa 383



to top

>emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in linkage group 21,
             complete sequence
          Length = 153142

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 13    agcaaaaacaattatatgaaaaat 36
             ||||||||||||||||| ||||||
Sbjct: 13896 agcaaaaacaattatataaaaaat 13919



to top

>gb|AC091108.5| Homo sapiens chromosome 18, clone RP11-765H19, complete sequence
          Length = 164790

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    aacaattatatgaaaaatgt 38
             ||||||||||||||||||||
Sbjct: 27829 aacaattatatgaaaaatgt 27810



to top

>gb|AC078961.23| Homo sapiens 4 BAC RP11-486H4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 179762

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 416   tttttacctcaacaaagtca 435
             ||||||||||||||||||||
Sbjct: 95254 tttttacctcaacaaagtca 95235



to top

>gb|AC116015.16| Homo sapiens chromosome 11, clone RP11-356D19, complete sequence
          Length = 180634

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 9      agtaagcaaaaacaattatatgaaaaat 36
              ||||||||  ||||||||||||||||||
Sbjct: 138660 agtaagcagtaacaattatatgaaaaat 138687



to top

>emb|AL935161.18| Mouse DNA sequence from clone RP23-433M8 on chromosome 2, complete
              sequence
          Length = 144625

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 105    gaaaattctttggatttcag 124
              ||||||||||||||||||||
Sbjct: 122922 gaaaattctttggatttcag 122941



to top

>gb|U61533.1|TCU61533 Trypanosoma cruzi mucin-like protein (MUC.T0-1) gene, complete cds
          Length = 531

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 420 tacctcaacaaagtcaccaaccac 443
           |||| |||||||||||||||||||
Sbjct: 150 taccacaacaaagtcaccaaccac 173



to top

>dbj|AB246600.1| Shorea zeylanica chloroplast trnL DNA, intron region, partial
           sequence
          Length = 454

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246599.1| Shorea worthingtonii chloroplast trnL DNA, intron region, partial
           sequence
          Length = 454

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246598.1| Shorea gardneri chloroplast trnL DNA, intron region, partial
           sequence
          Length = 454

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246597.1| Shorea ovalifolia chloroplast trnL DNA, intron region, partial
           sequence
          Length = 454

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246596.1| Shorea trapezifolia chloroplast trnL DNA, intron region, partial
           sequence
          Length = 454

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246595.1| Shorea disticha chloroplast trnL DNA, intron region, partial
           sequence
          Length = 454

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246594.1| Shorea megistophylla chloroplast trnL DNA, intron region, partial
           sequence
          Length = 454

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246593.1| Shorea congestiflora chloroplast trnL DNA, intron region, partial
           sequence
          Length = 454

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246592.1| Shorea cordifolia chloroplast trnL DNA, intron region, partial
           sequence
          Length = 454

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246591.1| Hopea wightiana chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246587.1| Hopea helferi chloroplast trnL DNA, intron region, partial sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246586.1| Hopea latifolia chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246584.1| Shorea stipularis chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246583.1| Shorea assamica chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246582.1| Shorea xanthophylla chloroplast trnL DNA, intron region, partial
           sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>dbj|AB246581.1| Shorea multiflora chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246580.1| Shorea seminis chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246578.1| Shorea pallescens chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246577.1| Shorea lissophylla chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246576.1| Shorea dyeri chloroplast trnL DNA, intron region, partial sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246575.1| Shorea pinanga chloroplast trnL DNA, intron region, partial
           sequence
          Length = 481

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 284 agcaaaaagaattatatgaaaaat 307



to top

>dbj|AB246574.1| Shorea elliptica chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246573.1| Shorea splendens chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246572.1| Shorea richetia chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246571.1| Shorea macrophylla chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246570.1| Shorea acuminata chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246569.1| Shorea leprosula chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246568.1| Shorea macroptera chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246567.1| Shorea parvifolia chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246566.1| Shorea quadrinervis chloroplast trnL DNA, intron region, partial
           sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>dbj|AB246565.1| Shorea bullata chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246564.1| Shorea fallax chloroplast trnL DNA, intron region, partial sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246563.1| Shorea curtisii chloroplast trnL DNA, intron region, partial
           sequence
          Length = 481

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 284 agcaaaaagaattatatgaaaaat 307



to top

>dbj|AB246562.1| Vateriopsis seychellarum chloroplast trnL DNA, intron region,
           partial sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246561.1| Vateria copallifera chloroplast trnL DNA, intron region, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246551.1| Vatica affinis chloroplast trnL DNA, intron region, partial
           sequence
          Length = 475

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 278 agcaaaaagaattatatgaaaaat 301



to top

>dbj|AB246550.1| Vatica chinensis chloroplast trnL DNA, intron region, partial
           sequence
          Length = 474

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 277 agcaaaaagaattatatgaaaaat 300



to top

>dbj|AB246549.1| Vatica micrantha chloroplast trnL DNA, intron region, partial
           sequence
          Length = 474

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 277 agcaaaaagaattatatgaaaaat 300



to top

>dbj|AB246548.1| Vatica coriacea chloroplast trnL DNA, intron region, partial
           sequence
          Length = 474

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 277 agcaaaaagaattatatgaaaaat 300



to top

>dbj|AB246547.1| Vatica pauciflora chloroplast trnL DNA, intron region, partial
           sequence
          Length = 474

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 277 agcaaaaagaattatatgaaaaat 300



to top

>dbj|AB246546.1| Vatica bella chloroplast trnL DNA, intron region, partial sequence
          Length = 474

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 277 agcaaaaagaattatatgaaaaat 300



to top

>dbj|AB246545.1| Cotylelobium scabriusculum chloroplast trnL DNA, intron region,
           partial sequence
          Length = 471

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB246544.1| Cotylelobium malayanum chloroplast trnL DNA, intron region, partial
           sequence
          Length = 472

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 284 agcaaaaagaattatatgaaaaat 307



to top

>dbj|AB246608.1| Monotes madagascariensis chloroplast trnL DNA, intron region,
           partial sequence
          Length = 488

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 284 agcaaaaagaattatatgaaaaat 307



to top

>dbj|AB246601.1| Shorea affinis chloroplast trnL DNA, intron region, partial
           sequence
          Length = 454

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>emb|AL935335.5| Zebrafish DNA sequence from clone CH211-244M22, complete sequence
          Length = 197549

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    aaaaacaattatatgaaaaa 35
             ||||||||||||||||||||
Sbjct: 96140 aaaaacaattatatgaaaaa 96121



to top

>emb|AL935136.4| Zebrafish DNA sequence from clone CH211-180B2, complete sequence
          Length = 146712

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 9      agtaagcaaaaacaattatatgaa 32
              |||||| |||||||||||||||||
Sbjct: 123207 agtaagtaaaaacaattatatgaa 123230



to top

>dbj|AB006402.1| Hopea odorata chloroplast DNA, intron of trnL, partial sequence
          Length = 482

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 285 agcaaaaagaattatatgaaaaat 308



to top

>dbj|AB006401.1| Hopea nervosa chloroplast DNA, intron of trnL, partial sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>dbj|AB006400.1| Neobalanocarpus heimii chloroplast DNA, intron of trnL, partial
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB006399.1| Parashorea lucida chloroplast DNA, intron of trnL, partial sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>dbj|AB006397.1| Shorea ovalis chloroplast DNA, intron of trnL, partial sequence
          Length = 481

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 284 agcaaaaagaattatatgaaaaat 307



to top

>dbj|AB006396.1| Shorea macroptera chloroplast DNA, intron of trnL, partial sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB006395.1| Dryobalanops oblongifolia chloroplast DNA, intron of trnL, partial
           sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 283 agcaaaaagaattatatgaaaaat 306



to top

>dbj|AB006394.1| Dryobalanops aromatica chloroplast DNA, intron of trnL, partial
           sequence
          Length = 478

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 282 agcaaaaagaattatatgaaaaat 305



to top

>dbj|AB006390.1| Vatica odorata chloroplast DNA, intron of trnL, partial sequence
          Length = 474

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 279 agcaaaaagaattatatgaaaaat 302



to top

>dbj|AB006389.1| Cotylelobium malayanum chloroplast DNA, intron of trnL, partial
           sequence
          Length = 472

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 284 agcaaaaagaattatatgaaaaat 261



to top

>dbj|AB006388.1| Anisoptera oblonga chloroplast DNA, intron of trnL, partial
           sequence
          Length = 481

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 284 agcaaaaagaattatatgaaaaat 307



to top

>dbj|AB006387.1| Anisoptera laevis chloroplast DNA, intron of trnL, partial sequence
          Length = 482

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 13  agcaaaaacaattatatgaaaaat 36
           |||||||| |||||||||||||||
Sbjct: 285 agcaaaaagaattatatgaaaaat 308



to top

>dbj|AP002015.3| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:2013O23, complete
             sequence
          Length = 88065

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 416   tttttacctcaacaaagtca 435
             ||||||||||||||||||||
Sbjct: 38388 tttttacctcaacaaagtca 38407


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,732,282
Number of Sequences: 3902068
Number of extensions: 5732282
Number of successful extensions: 102763
Number of sequences better than 10.0: 153
Number of HSP's better than 10.0 without gapping: 152
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 102382
Number of HSP's gapped (non-prelim): 375
length of query: 705
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 682
effective length of database: 17,143,297,704
effective search space: 11691729034128
effective search space used: 11691729034128
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top