ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags10i19 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK106824.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-116-E09, full insert sequence Length = 1563 Score = 329 bits (166), Expect = 6e-87 Identities = 304/350 (86%) Strand = Plus / Minus Query: 257 agcgttgacaagagccatgtgcccgatcagatccaggacacggttgctgtagccccactc 316 ||||||||| ||||||||||||||||||| ||||| ||| |||||||||||||||||||| Sbjct: 1379 agcgttgacgagagccatgtgcccgatcaaatccaagacccggttgctgtagccccactc 1320 Query: 317 gttgtcataccaggagacgagcttcatgaaagatgaacttagacccataccagcattggc 376 |||||| ||||| |||||||||||||||||||| ||||||| || || ||||| ||||| Sbjct: 1319 gttgtcgtaccaagagacgagcttcatgaaagaagaacttaagccaattccagccttggc 1260 Query: 377 atcaaagatgcttgaccttgtgtcaccaacaaaatcgtttgaaacaacatcctcgtctgt 436 |||||| ||||| ||||| |||||||||| ||||| || ||||| || ||||| ||||| Sbjct: 1259 atcaaatatgctagacctggtgtcaccaatgaaatcattcgaaacgacgtcctcatctgt 1200 Query: 437 gtagcctaaaatacccttaagcggaccttctgatgcttccttgatagctgctttcacatc 496 ||||||||||||||| || | | ||||||||| |||||||||||||||||||||||||| Sbjct: 1199 gtagcctaaaatacctttcaaagaaccttctgaggcttccttgatagctgctttcacatc 1140 Query: 497 ttcatacgatgcgtttttctcaagccggcaggtcagatcaacaacggatacgttaggtgt 556 ||||| || || |||||||||| ||||| |||| ||||| || || ||||||||||| Sbjct: 1139 ctcataagaagcacttttctcaagacggcatgtcaagtcaactacagagacgttaggtgt 1080 Query: 557 aggaacccggaaggccatgccagtgagctttccatttaaagctggaagga 606 |||||| ||||||||||| |||||||| || || ||||| |||||||||| Sbjct: 1079 aggaactcggaaggccataccagtgagtttcccgtttaatgctggaagga 1030
>gb|BT024171.1| Zea mays clone EL01N0423A09 mRNA sequence Length = 1752 Score = 307 bits (155), Expect = 2e-80 Identities = 281/323 (86%) Strand = Plus / Minus Query: 270 gccatgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccag 329 |||||||| ||||||||||||| || |||||||||||||||||||||||||||||||| Sbjct: 1369 gccatgtgggcgatcagatccagaacccggttgctgtagccccactcgttgtcataccaa 1310 Query: 330 gagacgagcttcatgaaagatgaacttagacccataccagcattggcatcaaagatgctt 389 || ||||||||||||||||| || || || || |||||||| |||||||||||||||||| Sbjct: 1309 gacacgagcttcatgaaagaagagctcagtccgataccagccttggcatcaaagatgctt 1250 Query: 390 gaccttgtgtcaccaacaaaatcgtttgaaacaacatcctcgtctgtgtagcctaaaata 449 ||||| | |||||||||||||| || |||||||| ||||||||||||||||| | |||| Sbjct: 1249 gacctagaatcaccaacaaaatcattggaaacaacgtcctcgtctgtgtagccaagaata 1190 Query: 450 cccttaagcggaccttctgatgcttccttgatagctgctttcacatcttcatacgatgcg 509 || || || | ||| |||||||| ||||||| |||||||||||||| ||||| || ||| Sbjct: 1189 cctttgagtgcaccctctgatgccgccttgatggctgctttcacatcatcataggaggcg 1130 Query: 510 tttttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaag 569 |||||||||| |||||| |||| || ||||| || || || ||||| ||||| |||||| Sbjct: 1129 tttttctcaatccggcatgtcaagtccacaacagagacatttggtgttggaactcggaag 1070 Query: 570 gccatgccagtgagctttccatt 592 ||||||||||||||||||||||| Sbjct: 1069 gccatgccagtgagctttccatt 1047 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 171 aatggccatcaaaattgcagcctt 194 ||||||| |||||||||||||||| Sbjct: 1457 aatggccgtcaaaattgcagcctt 1434
>gb|BT016463.1| Zea mays clone Contig296 mRNA sequence Length = 1588 Score = 303 bits (153), Expect = 4e-79 Identities = 285/329 (86%) Strand = Plus / Plus Query: 264 acaagagccatgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtca 323 |||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||| Sbjct: 257 acaagagccatgtgagcgatcagatccagaacccggttgctgtagccccactcgttgtca 316 Query: 324 taccaggagacgagcttcatgaaagatgaacttagacccataccagcattggcatcaaag 383 ||||| || |||||||||||||| || || || || || |||||||| |||||||||||| Sbjct: 317 taccaagacacgagcttcatgaaggaagagctcagtccaataccagccttggcatcaaag 376 Query: 384 atgcttgaccttgtgtcaccaacaaaatcgtttgaaacaacatcctcgtctgtgtagcct 443 ||||||||||||| |||||||||||||| || |||||||||||||||||||||||||| Sbjct: 377 atgcttgaccttgaatcaccaacaaaatcattggaaacaacatcctcgtctgtgtagcca 436 Query: 444 aaaatacccttaagcggaccttctgatgcttccttgatagctgctttcacatcttcatac 503 | |||||| || || | ||| |||||||| |||||| |||||||||||||| ||||| Sbjct: 437 agaatacctttgagtgcaccctctgatgccgtcttgatggctgctttcacatcatcatag 496 Query: 504 gatgcgtttttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacc 563 || ||| ||||||||| |||||| |||| ||| ||||| || || || ||||| ||||| Sbjct: 497 gaggcgcttttctcaatccggcatgtcaaatccacaacagagacatttggtgttggaact 556 Query: 564 cggaaggccatgccagtgagctttccatt 592 ||||||||||| |||||||| |||||||| Sbjct: 557 cggaaggccataccagtgagttttccatt 585
>gb|AY103691.1| Zea mays PCO070235 mRNA sequence Length = 1716 Score = 303 bits (153), Expect = 4e-79 Identities = 285/329 (86%) Strand = Plus / Minus Query: 264 acaagagccatgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtca 323 |||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||| Sbjct: 1454 acaagagccatgtgagcgatcagatccagaacccggttgctgtagccccactcgttgtca 1395 Query: 324 taccaggagacgagcttcatgaaagatgaacttagacccataccagcattggcatcaaag 383 ||||| || |||||||||||||| || || || || || |||||||| |||||||||||| Sbjct: 1394 taccaagacacgagcttcatgaaggaagagctcagtccaataccagccttggcatcaaag 1335 Query: 384 atgcttgaccttgtgtcaccaacaaaatcgtttgaaacaacatcctcgtctgtgtagcct 443 ||||||||||||| |||||||||||||| || |||||||||||||||||||||||||| Sbjct: 1334 atgcttgaccttgaatcaccaacaaaatcattggaaacaacatcctcgtctgtgtagcca 1275 Query: 444 aaaatacccttaagcggaccttctgatgcttccttgatagctgctttcacatcttcatac 503 | |||||| || || | ||| |||||||| |||||| |||||||||||||| ||||| Sbjct: 1274 agaatacctttgagtgcaccctctgatgccgtcttgatggctgctttcacatcatcatag 1215 Query: 504 gatgcgtttttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacc 563 || ||| ||||||||| |||||| |||| ||| ||||| || || || ||||| ||||| Sbjct: 1214 gaggcgcttttctcaatccggcatgtcaaatccacaacagagacatttggtgttggaact 1155 Query: 564 cggaaggccatgccagtgagctttccatt 592 ||||||||||| |||||||| |||||||| Sbjct: 1154 cggaaggccataccagtgagttttccatt 1126
>ref|XM_464291.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1673 Score = 287 bits (145), Expect = 2e-74 Identities = 289/337 (85%) Strand = Plus / Minus Query: 258 gcgttgacaagagccatgtgcccgatcagatccaggacacggttgctgtagccccactcg 317 |||||||||||||||||||| | |||||||||| |||||||||||||||||||||||| Sbjct: 1349 gcgttgacaagagccatgtgggcaatcagatccaacacacggttgctgtagccccactcg 1290 Query: 318 ttgtcataccaggagacgagcttcatgaaagatgaacttagacccataccagcattggca 377 ||||||||||| || || ||||||||||| || || || || || |||||||| |||||| Sbjct: 1289 ttgtcataccatgacacaagcttcatgaaggaagagctcagtccaataccagccttggca 1230 Query: 378 tcaaagatgcttgaccttgtgtcaccaacaaaatcgtttgaaacaacatcctcgtctgtg 437 ||||||||||||||||||| |||||||| || || || ||||| |||||||| |||||| Sbjct: 1229 tcaaagatgcttgaccttgcatcaccaacgaagtcattggaaaccacatcctcatctgtg 1170 Query: 438 tagcctaaaatacccttaagcggaccttctgatgcttccttgatagctgctttcacatct 497 || |||| |||||| || || | ||| ||||||||| ||||||| |||||||||||||| Sbjct: 1169 taacctagaatacctttcagtgcaccctctgatgctgccttgatggctgctttcacatcg 1110 Query: 498 tcatacgatgcgtttttctcaagccggcaggtcagatcaacaacggatacgttaggtgta 557 ||||| ||||| |||| |||| ||||||||||| || ||||| || || || ||||| Sbjct: 1109 tcataggatgcacttttttcaatccggcaggtcaagtcgacaacagacacatttggtgtt 1050 Query: 558 ggaacccggaaggccatgccagtgagctttccattta 594 ||||| ||||||||||| ||||||||||||||||||| Sbjct: 1049 ggaactcggaaggccataccagtgagctttccattta 1013
>dbj|AK070032.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036H06, full insert sequence Length = 1672 Score = 287 bits (145), Expect = 2e-74 Identities = 289/337 (85%) Strand = Plus / Minus Query: 258 gcgttgacaagagccatgtgcccgatcagatccaggacacggttgctgtagccccactcg 317 |||||||||||||||||||| | |||||||||| |||||||||||||||||||||||| Sbjct: 1348 gcgttgacaagagccatgtgggcaatcagatccaacacacggttgctgtagccccactcg 1289 Query: 318 ttgtcataccaggagacgagcttcatgaaagatgaacttagacccataccagcattggca 377 ||||||||||| || || ||||||||||| || || || || || |||||||| |||||| Sbjct: 1288 ttgtcataccatgacacaagcttcatgaaggaagagctcagtccaataccagccttggca 1229 Query: 378 tcaaagatgcttgaccttgtgtcaccaacaaaatcgtttgaaacaacatcctcgtctgtg 437 ||||||||||||||||||| |||||||| || || || ||||| |||||||| |||||| Sbjct: 1228 tcaaagatgcttgaccttgcatcaccaacgaagtcattggaaaccacatcctcatctgtg 1169 Query: 438 tagcctaaaatacccttaagcggaccttctgatgcttccttgatagctgctttcacatct 497 || |||| |||||| || || | ||| ||||||||| ||||||| |||||||||||||| Sbjct: 1168 taacctagaatacctttcagtgcaccctctgatgctgccttgatggctgctttcacatcg 1109 Query: 498 tcatacgatgcgtttttctcaagccggcaggtcagatcaacaacggatacgttaggtgta 557 ||||| ||||| |||| |||| ||||||||||| || ||||| || || || ||||| Sbjct: 1108 tcataggatgcacttttttcaatccggcaggtcaagtcgacaacagacacatttggtgtt 1049 Query: 558 ggaacccggaaggccatgccagtgagctttccattta 594 ||||| ||||||||||| ||||||||||||||||||| Sbjct: 1048 ggaactcggaaggccataccagtgagctttccattta 1012
>dbj|AK059005.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-020-H04, full insert sequence Length = 681 Score = 287 bits (145), Expect = 2e-74 Identities = 289/337 (85%) Strand = Plus / Minus Query: 258 gcgttgacaagagccatgtgcccgatcagatccaggacacggttgctgtagccccactcg 317 |||||||||||||||||||| | |||||||||| |||||||||||||||||||||||| Sbjct: 438 gcgttgacaagagccatgtgggcaatcagatccaacacacggttgctgtagccccactcg 379 Query: 318 ttgtcataccaggagacgagcttcatgaaagatgaacttagacccataccagcattggca 377 ||||||||||| || || ||||||||||| || || || || || |||||||| |||||| Sbjct: 378 ttgtcataccatgacacaagcttcatgaaggaagagctcagtccaataccagccttggca 319 Query: 378 tcaaagatgcttgaccttgtgtcaccaacaaaatcgtttgaaacaacatcctcgtctgtg 437 ||||||||||||||||||| |||||||| || || || ||||| |||||||| |||||| Sbjct: 318 tcaaagatgcttgaccttgcatcaccaacgaagtcattggaaaccacatcctcatctgtg 259 Query: 438 tagcctaaaatacccttaagcggaccttctgatgcttccttgatagctgctttcacatct 497 || |||| |||||| || || | ||| ||||||||| ||||||| |||||||||||||| Sbjct: 258 taacctagaatacctttcagtgcaccctctgatgctgccttgatggctgctttcacatcg 199 Query: 498 tcatacgatgcgtttttctcaagccggcaggtcagatcaacaacggatacgttaggtgta 557 ||||| ||||| |||| |||| ||||||||||| || ||||| || || || ||||| Sbjct: 198 tcataggatgcacttttttcaatccggcaggtcaagtcgacaacagacacatttggtgtt 139 Query: 558 ggaacccggaaggccatgccagtgagctttccattta 594 ||||| ||||||||||| ||||||||||||||||||| Sbjct: 138 ggaactcggaaggccataccagtgagctttccattta 102
>emb|AJ246013.1|CAN246013 Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subunit GapCp Length = 1663 Score = 167 bits (84), Expect = 5e-38 Identities = 240/292 (82%) Strand = Plus / Minus Query: 301 tgctgtagccccactcgttgtcataccaggagacgagcttcatgaaagatgaacttagac 360 ||||||| |||||||||||||| ||||||||||||||||||||||| ||| || || | Sbjct: 1359 tgctgtaaccccactcgttgtcgtaccaggagacgagcttcatgaatgatttgctcaggc 1300 Query: 361 ccataccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaaatcgtttgaaa 420 | |||||||| || |||||||| ||||| ||||| | || ||||||||||| ||||| | Sbjct: 1299 ctataccagctttagcatcaaatatgctcgacctggaatccccaacaaaatcatttgaca 1240 Query: 421 caacatcctcgtctgtgtagcctaaaatacccttaagcggaccttctgatgcttccttga 480 |||||||||||| ||||| || ||||| || ||||| ||||| |||||||| | ||| | Sbjct: 1239 caacatcctcgttggtgtaacccaaaatgcctttaagtggaccctctgatgcatacttta 1180 Query: 481 tagctgctttcacatcttcatacgatgcgtttttctcaagccggcaggtcagatcaacaa 540 | |||||||||||||| ||||| || || |||| | |||||||| |||| || |||| Sbjct: 1179 tcgctgctttcacatcatcataagaagcacttttatttagccggcaagtcaagtccacaa 1120 Query: 541 cggatacgttaggtgtaggaacccggaaggccatgccagtgagctttccatt 592 | || || |||||||| || || ||||| ||||| ||||||||||| ||||| Sbjct: 1119 cagagacattaggtgttgggacacggaatgccattccagtgagcttcccatt 1068
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 117 bits (59), Expect = 4e-23 Identities = 113/131 (86%) Strand = Plus / Plus Query: 476 cttgatagctgctttcacatcttcatacgatgcgtttttctcaagccggcaggtcagatc 535 ||||||||||||||||||||| ||||| || || |||||||||| ||||| |||| || Sbjct: 27218525 cttgatagctgctttcacatcctcataagaagcacttttctcaagacggcatgtcaagtc 27218584 Query: 536 aacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctttccatttaa 595 ||| || || ||||||||||||||||| ||||||||||| |||||||| || || ||||| Sbjct: 27218585 aactacagagacgttaggtgtaggaactcggaaggccataccagtgagtttcccgtttaa 27218644 Query: 596 agctggaagga 606 |||||||||| Sbjct: 27218645 tgctggaagga 27218655 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Plus Query: 303 ctgtagccccactcgttgtcataccaggagacgagcttcatgaaagatgaacttagaccc 362 |||||||||||||||||||| ||||| |||||||||||||||||||| ||||||| || Sbjct: 27218025 ctgtagccccactcgttgtcgtaccaagagacgagcttcatgaaagaagaacttaagcca 27218084 Query: 363 ataccagcattggcatcaaagatgcttgacct 394 || ||||| ||||||||||| ||||| ||||| Sbjct: 27218085 attccagccttggcatcaaatatgctagacct 27218116 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Plus Query: 257 agcgttgacaagagccatgtgcccgatcagatccaggacacggttgctg 305 ||||||||| ||||||||||||||||||| ||||| ||| ||||||||| Sbjct: 27217801 agcgttgacgagagccatgtgcccgatcaaatccaagacccggttgctg 27217849 Score = 60.0 bits (30), Expect = 9e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 391 accttgtgtcaccaacaaaatcgtttgaaacaacatcctcgtctgtgtagcctaaaatac 450 |||| |||||||||| ||||| || ||||| || ||||| ||||||||||||||||||| Sbjct: 27218189 acctggtgtcaccaatgaaatcattcgaaacgacgtcctcatctgtgtagcctaaaatac 27218248 Query: 451 ccttaagcggaccttctgatgcttcc 476 | || | | ||||||||| |||||| Sbjct: 27218249 ctttcaaagaaccttctgaggcttcc 27218274
>dbj|AP003633.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0637D03 Length = 180159 Score = 117 bits (59), Expect = 4e-23 Identities = 113/131 (86%) Strand = Plus / Plus Query: 476 cttgatagctgctttcacatcttcatacgatgcgtttttctcaagccggcaggtcagatc 535 ||||||||||||||||||||| ||||| || || |||||||||| ||||| |||| || Sbjct: 75541 cttgatagctgctttcacatcctcataagaagcacttttctcaagacggcatgtcaagtc 75600 Query: 536 aacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctttccatttaa 595 ||| || || ||||||||||||||||| ||||||||||| |||||||| || || ||||| Sbjct: 75601 aactacagagacgttaggtgtaggaactcggaaggccataccagtgagtttcccgtttaa 75660 Query: 596 agctggaagga 606 |||||||||| Sbjct: 75661 tgctggaagga 75671 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Plus Query: 303 ctgtagccccactcgttgtcataccaggagacgagcttcatgaaagatgaacttagaccc 362 |||||||||||||||||||| ||||| |||||||||||||||||||| ||||||| || Sbjct: 75041 ctgtagccccactcgttgtcgtaccaagagacgagcttcatgaaagaagaacttaagcca 75100 Query: 363 ataccagcattggcatcaaagatgcttgacct 394 || ||||| ||||||||||| ||||| ||||| Sbjct: 75101 attccagccttggcatcaaatatgctagacct 75132 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Plus Query: 257 agcgttgacaagagccatgtgcccgatcagatccaggacacggttgctg 305 ||||||||| ||||||||||||||||||| ||||| ||| ||||||||| Sbjct: 74817 agcgttgacgagagccatgtgcccgatcaaatccaagacccggttgctg 74865 Score = 60.0 bits (30), Expect = 9e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 391 accttgtgtcaccaacaaaatcgtttgaaacaacatcctcgtctgtgtagcctaaaatac 450 |||| |||||||||| ||||| || ||||| || ||||| ||||||||||||||||||| Sbjct: 75205 acctggtgtcaccaatgaaatcattcgaaacgacgtcctcatctgtgtagcctaaaatac 75264 Query: 451 ccttaagcggaccttctgatgcttcc 476 | || | | ||||||||| |||||| Sbjct: 75265 ctttcaaagaaccttctgaggcttcc 75290
>gb|BT021096.1| Arabidopsis thaliana At1g16300 gene, complete cds Length = 1379 Score = 117 bits (59), Expect = 4e-23 Identities = 248/311 (79%) Strand = Plus / Minus Query: 282 atcagatccaggacacggttgctgtagccccactcgttgtcataccaggagacgagcttc 341 ||||| || ||||| ||||||||||| ||||| |||||||||||||||||||| || ||| Sbjct: 1285 atcaggtcaaggactcggttgctgtaaccccattcgttgtcataccaggagacaagtttc 1226 Query: 342 atgaaagatgaacttagacccataccagcattggcatcaaagatgcttgaccttgtgtca 401 ||||| || |||| || || |||||||| ||||||||||| |||||||||| || Sbjct: 1225 atgaaggacttgcttaatccaatcccagcattagcatcaaagatacttgaccttgaatct 1166 Query: 402 ccaacaaaatcgtttgaaacaacatcctcgtctgtgtagcctaaaatacccttaagcgga 461 |||| |||||| || || || ||||| || ||||| || || | ||| ||| |||| || Sbjct: 1165 ccaagaaaatcattagagacgacatcttcttctgtatatccaagaatgcccctaagtggt 1106 Query: 462 ccttctgatgcttccttgatagctgctttcacatcttcatacgatgcgtttttctcaagc 521 ||||||||||| ||| || ||||| || || |||||||||||||| | |||||||| Sbjct: 1105 ccttctgatgcaaactttatggctgccttgacgtcttcatacgatgcatccttctcaagt 1046 Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 || || || | ||| |||||||| || || ||||| || || ||||||||||| || || Sbjct: 1045 cgacaagttaaatccacaacggagacatttggtgttgggacacggaaggccattcctgtt 986 Query: 582 agctttccatt 592 || |||||||| Sbjct: 985 agttttccatt 975
>emb|AJ003783.1|MQNAD Marsilea quadrifolia mRNA for NAD+-dependent glyceraldehyde-3-phosphate dehydrogenase Length = 1214 Score = 115 bits (58), Expect = 2e-22 Identities = 187/230 (81%) Strand = Plus / Minus Query: 363 ataccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaaatcgtttgaaaca 422 |||||||| ||||||||||||||||| ||||||| || ||||||||||| | || ||| Sbjct: 985 ataccagccttggcatcaaagatgctagaccttgaatctccaacaaaatctgtagacaca 926 Query: 423 acatcctcgtctgtgtagcctaaaatacccttaagcggaccttctgatgcttccttgata 482 ||||| || || ||||| || | ||| ||||| | | |||||| ||||| |||| | | Sbjct: 925 acatcatcctcagtgtacccaagaattcccttcattgaaccttcagatgcagccttaaca 866 Query: 483 gctgctttcacatcttcatacgatgcgtttttctcaagccggcaggtcagatcaacaacg 542 |||||||| ||||| ||||||||||| ||||||||| ||||| ||||| || ||||| Sbjct: 865 gctgctttgacatcatcatacgatgcacctttctcaaggcggcatgtcaggtcgacaact 806 Query: 543 gatacgttaggtgtaggaacccggaaggccatgccagtgagctttccatt 592 || ||||||||||| ||||||| || ||||| ||||| | ||||||||| Sbjct: 805 gagacgttaggtgtgggaaccctaaatgccataccagtcaactttccatt 756 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Minus Query: 282 atcagatccaggacacggttgctgtagccccactcgttgtcatacca 328 |||||||| | ||||||||||||||| ||||| || ||||| ||||| Sbjct: 1066 atcagatcaacgacacggttgctgtatccccattcattgtcgtacca 1020
>ref|NM_101496.2| Arabidopsis thaliana NAD binding / glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)/ glyceraldehyde-3-phosphate dehydrogenase AT1G16300 mRNA, complete cds Length = 1602 Score = 109 bits (55), Expect = 1e-20 Identities = 247/311 (79%) Strand = Plus / Minus Query: 282 atcagatccaggacacggttgctgtagccccactcgttgtcataccaggagacgagcttc 341 ||||| || ||||| ||||||||||| ||||| |||||||||||||||||||| || ||| Sbjct: 1352 atcaggtcaaggactcggttgctgtaaccccattcgttgtcataccaggagacaagtttc 1293 Query: 342 atgaaagatgaacttagacccataccagcattggcatcaaagatgcttgaccttgtgtca 401 ||||| || |||| || || |||||||| ||||||||||| |||||||||| || Sbjct: 1292 atgaaggacttgcttaatccaatcccagcattagcatcaaagatacttgaccttgaatct 1233 Query: 402 ccaacaaaatcgtttgaaacaacatcctcgtctgtgtagcctaaaatacccttaagcgga 461 |||| |||||| || || || ||||| || ||||| || || | ||| ||| |||| || Sbjct: 1232 ccaagaaaatcattagagacgacatcttcttctgtatatccaagaatgcccctaagtggt 1173 Query: 462 ccttctgatgcttccttgatagctgctttcacatcttcatacgatgcgtttttctcaagc 521 ||||||||||| ||| || ||||| || || |||||||||||||| | |||||||| Sbjct: 1172 ccttctgatgcaaactttatggctgccttgacgtcttcatacgatgcatccttctcaagt 1113 Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 || || || | ||| ||||| || || || ||||| || || ||||||||||| || || Sbjct: 1112 cgacaagttaaatccacaacagagacatttggtgttgggacacggaaggccattcctgtt 1053 Query: 582 agctttccatt 592 || |||||||| Sbjct: 1052 agttttccatt 1042
>gb|BT002867.1| Arabidopsis thaliana clone RAFL14-95-D18 (R20331) putative glyceraldehyde-3-phosphate dehydrogenase (At1g16300) mRNA, complete cds Length = 1618 Score = 109 bits (55), Expect = 1e-20 Identities = 247/311 (79%) Strand = Plus / Minus Query: 282 atcagatccaggacacggttgctgtagccccactcgttgtcataccaggagacgagcttc 341 ||||| || ||||| ||||||||||| ||||| |||||||||||||||||||| || ||| Sbjct: 1352 atcaggtcaaggactcggttgctgtaaccccattcgttgtcataccaggagacaagtttc 1293 Query: 342 atgaaagatgaacttagacccataccagcattggcatcaaagatgcttgaccttgtgtca 401 ||||| || |||| || || |||||||| ||||||||||| |||||||||| || Sbjct: 1292 atgaaggacttgcttaatccaatcccagcattagcatcaaagatacttgaccttgaatct 1233 Query: 402 ccaacaaaatcgtttgaaacaacatcctcgtctgtgtagcctaaaatacccttaagcgga 461 |||| |||||| || || || ||||| || ||||| || || | ||| ||| |||| || Sbjct: 1232 ccaagaaaatcattagagacgacatcttcttctgtatatccaagaatgcccctaagtggt 1173 Query: 462 ccttctgatgcttccttgatagctgctttcacatcttcatacgatgcgtttttctcaagc 521 ||||||||||| ||| || ||||| || || |||||||||||||| | |||||||| Sbjct: 1172 ccttctgatgcaaactttatggctgccttgacgtcttcatacgatgcatccttctcaagt 1113 Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 || || || | ||| ||||| || || || ||||| || || ||||||||||| || || Sbjct: 1112 cgacaagttaaatccacaacagagacatttggtgttgggacacggaaggccattcctgtt 1053 Query: 582 agctttccatt 592 || |||||||| Sbjct: 1052 agttttccatt 1042
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 303 ctgtagccccactcgttgtcataccaggagacgagcttcatgaaagatgaacttagaccc 362 |||||||||||||||||||||||||| || || ||||||||||| || || || || || Sbjct: 3872478 ctgtagccccactcgttgtcataccatgacacaagcttcatgaaggaagagctcagtcca 3872419 Query: 363 ataccagcattggcatcaaagatgcttgacct 394 |||||||| ||||||||||||||||||||||| Sbjct: 3872418 ataccagccttggcatcaaagatgcttgacct 3872387 Score = 101 bits (51), Expect = 3e-18 Identities = 102/119 (85%) Strand = Plus / Minus Query: 476 cttgatagctgctttcacatcttcatacgatgcgtttttctcaagccggcaggtcagatc 535 |||||| |||||||||||||| ||||| ||||| |||| |||| ||||||||||| || Sbjct: 3871929 cttgatggctgctttcacatcgtcataggatgcacttttttcaatccggcaggtcaagtc 3871870 Query: 536 aacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctttccattta 594 ||||| || || || ||||| ||||| ||||||||||| ||||||||||||||||||| Sbjct: 3871869 gacaacagacacatttggtgttggaactcggaaggccataccagtgagctttccattta 3871811 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 258 gcgttgacaagagccatgtgcccgatcagatccaggacacggttgctg 305 |||||||||||||||||||| | |||||||||| |||||||||||| Sbjct: 3872618 gcgttgacaagagccatgtgggcaatcagatccaacacacggttgctg 3872571 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgacct 394 ||||| ||||||||||||||||| ||||| Sbjct: 23549449 ccagccttggcatcaaagatgctggacct 23549421 Score = 42.1 bits (21), Expect = 2.1 Identities = 54/65 (83%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 ||||||||||||||||| || | ||| ||||| ||||| ||||| ||||| |||||| Sbjct: 23549034 gtcagatcaacaacggaaacatcgactgtgggaacacggaaagccattccagtcagcttt 23548975 Query: 588 ccatt 592 ||||| Sbjct: 23548974 ccatt 23548970
>dbj|AP004113.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1116_A06 Length = 176062 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 303 ctgtagccccactcgttgtcataccaggagacgagcttcatgaaagatgaacttagaccc 362 |||||||||||||||||||||||||| || || ||||||||||| || || || || || Sbjct: 128810 ctgtagccccactcgttgtcataccatgacacaagcttcatgaaggaagagctcagtcca 128751 Query: 363 ataccagcattggcatcaaagatgcttgacct 394 |||||||| ||||||||||||||||||||||| Sbjct: 128750 ataccagccttggcatcaaagatgcttgacct 128719 Score = 101 bits (51), Expect = 3e-18 Identities = 102/119 (85%) Strand = Plus / Minus Query: 476 cttgatagctgctttcacatcttcatacgatgcgtttttctcaagccggcaggtcagatc 535 |||||| |||||||||||||| ||||| ||||| |||| |||| ||||||||||| || Sbjct: 128261 cttgatggctgctttcacatcgtcataggatgcacttttttcaatccggcaggtcaagtc 128202 Query: 536 aacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctttccattta 594 ||||| || || || ||||| ||||| ||||||||||| ||||||||||||||||||| Sbjct: 128201 gacaacagacacatttggtgttggaactcggaaggccataccagtgagctttccattta 128143 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 258 gcgttgacaagagccatgtgcccgatcagatccaggacacggttgctg 305 |||||||||||||||||||| | |||||||||| |||||||||||| Sbjct: 128950 gcgttgacaagagccatgtgggcaatcagatccaacacacggttgctg 128903
>dbj|AP004836.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0030G02 Length = 187265 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 303 ctgtagccccactcgttgtcataccaggagacgagcttcatgaaagatgaacttagaccc 362 |||||||||||||||||||||||||| || || ||||||||||| || || || || || Sbjct: 70949 ctgtagccccactcgttgtcataccatgacacaagcttcatgaaggaagagctcagtcca 70890 Query: 363 ataccagcattggcatcaaagatgcttgacct 394 |||||||| ||||||||||||||||||||||| Sbjct: 70889 ataccagccttggcatcaaagatgcttgacct 70858 Score = 101 bits (51), Expect = 3e-18 Identities = 102/119 (85%) Strand = Plus / Minus Query: 476 cttgatagctgctttcacatcttcatacgatgcgtttttctcaagccggcaggtcagatc 535 |||||| |||||||||||||| ||||| ||||| |||| |||| ||||||||||| || Sbjct: 70400 cttgatggctgctttcacatcgtcataggatgcacttttttcaatccggcaggtcaagtc 70341 Query: 536 aacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctttccattta 594 ||||| || || || ||||| ||||| ||||||||||| ||||||||||||||||||| Sbjct: 70340 gacaacagacacatttggtgttggaactcggaaggccataccagtgagctttccattta 70282 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 258 gcgttgacaagagccatgtgcccgatcagatccaggacacggttgctg 305 |||||||||||||||||||| | |||||||||| |||||||||||| Sbjct: 71089 gcgttgacaagagccatgtgggcaatcagatccaacacacggttgctg 71042
>gb|AY088762.1| Arabidopsis thaliana clone 94597 mRNA, complete sequence Length = 1551 Score = 101 bits (51), Expect = 3e-18 Identities = 246/311 (79%) Strand = Plus / Minus Query: 282 atcagatccaggacacggttgctgtagccccactcgttgtcataccaggagacgagcttc 341 ||||| || ||||| ||||||||||| ||||| |||||||||||||||||||| || ||| Sbjct: 1354 atcaggtcaaggactcggttgctgtaaccccattcgttgtcataccaggagacaagtttc 1295 Query: 342 atgaaagatgaacttagacccataccagcattggcatcaaagatgcttgaccttgtgtca 401 ||||| || |||| || || |||||||| ||||||||||| |||||||||| || Sbjct: 1294 atgaaggacttgcttaatccaatcccagcattagcatcaaagatacttgaccttgaatct 1235 Query: 402 ccaacaaaatcgtttgaaacaacatcctcgtctgtgtagcctaaaatacccttaagcgga 461 |||| |||||| || || || ||||| || ||||| || || | ||| ||| |||| || Sbjct: 1234 ccaagaaaatcattagagacgacatcttcttctgtatatccaagaatgcccctaagtggt 1175 Query: 462 ccttctgatgcttccttgatagctgctttcacatcttcatacgatgcgtttttctcaagc 521 ||||||||||| ||| || ||||| || || |||||||||| ||| | |||||||| Sbjct: 1174 ccttctgatgcaaactttatggctgccttgacgtcttcatacgttgcatccttctcaagt 1115 Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 || || || | ||| ||||| || || || ||||| || || ||||||||||| || || Sbjct: 1114 cgacaagttaaatccacaacagaaacatttggtgttgggacacggaaggccattcctgtt 1055 Query: 582 agctttccatt 592 || |||||||| Sbjct: 1054 agttttccatt 1044
>gb|BC059110.1| Rattus norvegicus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:72650 IMAGE:6919611), complete cds Length = 1307 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 823 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 764 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 763 catgccagtgagctt 749 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 1036 gttgctgtagccatattcattgtcataccaggaaatgagcttca 993
>emb|X02231.1|RNGADPHR Rattus norvegicus mRNA for glyceraldehyde 3-phosphate-dehydrogenase (gapdh gene) Length = 1272 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 818 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 759 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 758 catgccagtgagctt 744 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 1031 gttgctgtagccatattcattgtcataccaggaaatgagcttca 988
>ref|NM_017008.2| Rattus norvegicus glyceraldehyde-3-phosphate dehydrogenase (Gapdh), mRNA Length = 2039 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 1596 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 1537 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 1536 catgccagtgagctt 1522 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 1809 gttgctgtagccatattcattgtcataccaggaaatgagcttca 1766
>gb|AF106860.2|AF106860 Rattus norvegicus glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, complete cds Length = 2039 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 1596 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 1537 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 1536 catgccagtgagctt 1522 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 1809 gttgctgtagccatattcattgtcataccaggaaatgagcttca 1766
>ref|XM_573896.1| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC498618), mRNA Length = 1081 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 754 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 695 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 694 catgccagtgagctt 680 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 967 gttgctgtagccatattcattgtcataccaggaaatgagcttca 924
>ref|XM_573304.1| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC498099), mRNA Length = 1283 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 820 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 761 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 760 catgccagtgagctt 746 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 1033 gttgctgtagccatattcattgtcataccaggaaatgagcttca 990
>ref|XM_576394.1| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC500983), mRNA Length = 1197 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 755 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 696 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 695 catgccagtgagctt 681 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 968 gttgctgtagccatattcattgtcataccaggaaatgagcttca 925
>ref|XM_575868.1| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC500506), mRNA Length = 1197 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 758 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 699 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 698 catgccagtgagctt 684 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 971 gttgctgtagccatattcattgtcataccaggaaatgagcttca 928
>ref|XM_579386.1| PREDICTED: Rattus norvegicus glyceraldehyde-3-phosphate dehydrogenase (Gapd), mRNA Length = 1232 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 789 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 730 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 729 catgccagtgagctt 715 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 1002 gttgctgtagccatattcattgtcataccaggaaatgagcttca 959
>gb|BC087743.1| Rattus norvegicus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:105280 IMAGE:7321006), complete cds Length = 1273 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 791 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 732 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 731 catgccagtgagctt 717 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 1004 gttgctgtagccatattcattgtcataccaggaaatgagcttca 961
>gb|M17701.1|RATGAPDHA Rat glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) mRNA, complete cds Length = 1233 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 777 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 718 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 717 catgccagtgagctt 703 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 990 gttgctgtagccatattcattgtcataccaggaaatgagcttca 947
>dbj|AB017801.1| Rattus norvegicus mRNA for glyceraldehyde-3-phosphate dehydrogenase, complete cds Length = 1242 Score = 85.7 bits (43), Expect = 2e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 788 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 729 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 728 catgccagtgagctt 714 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||||||||| | || |||||||||||||| | |||||||| Sbjct: 1001 gttgctgtagccatattcattgtcataccaggaaatgagcttca 958
>ref|XM_993692.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC629557), mRNA Length = 1466 Score = 81.8 bits (41), Expect = 2e-12 Identities = 71/81 (87%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || | |||||||| |||||||| Sbjct: 998 tttctccaggcggcatgtcagatccacaacggatacattgagggtaggaacacggaaggc 939 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 938 catgccagtgagcttcccatt 918
>ref|XM_894456.2| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC629557), mRNA Length = 1466 Score = 81.8 bits (41), Expect = 2e-12 Identities = 71/81 (87%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || | |||||||| |||||||| Sbjct: 998 tttctccaggcggcatgtcagatccacaacggatacattgagggtaggaacacggaaggc 939 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 938 catgccagtgagcttcccatt 918
>ref|XM_001002772.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC629557), mRNA Length = 1434 Score = 81.8 bits (41), Expect = 2e-12 Identities = 71/81 (87%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || | |||||||| |||||||| Sbjct: 966 tttctccaggcggcatgtcagatccacaacggatacattgagggtaggaacacggaaggc 907 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 906 catgccagtgagcttcccatt 886
>dbj|AK132984.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930542N24 product:Glyceraldehyde 3-phosphate dehydrogenase (EC 1.2.1.12) (GAPDH) homolog [Mus musculus], full insert sequence Length = 1467 Score = 81.8 bits (41), Expect = 2e-12 Identities = 71/81 (87%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || | |||||||| |||||||| Sbjct: 999 tttctccaggcggcatgtcagatccacaacggatacattgagggtaggaacacggaaggc 940 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 939 catgccagtgagcttcccatt 919
>gb|AC159881.2| Mus musculus BAC clone RP24-493B12 from chromosome 9, complete sequence Length = 126762 Score = 81.8 bits (41), Expect = 2e-12 Identities = 71/81 (87%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || | |||||||| |||||||| Sbjct: 80420 tttctccaggcggcatgtcagatccacaacggatacattgagggtaggaacacggaaggc 80361 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 80360 catgccagtgagcttcccatt 80340
>ref|XM_214287.3| PREDICTED: Rattus norvegicus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC290634), mRNA Length = 1523 Score = 81.8 bits (41), Expect = 2e-12 Identities = 71/81 (87%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| |||| |||||| || || |||||||| |||||||| Sbjct: 1266 tttctccaggcggcatgtcagatccacaatggatacattgggggtaggaacacggaaggc 1207 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 1206 catgccagtgagcttcccatt 1186
>ref|XM_575243.1| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC499897), mRNA Length = 924 Score = 79.8 bits (40), Expect = 1e-11 Identities = 58/64 (90%) Strand = Plus / Minus Query: 523 ggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtga 582 |||| |||||||| ||||||||||| || || |||||||| ||||||||||||||||||| Sbjct: 658 ggcatgtcagatccacaacggatacattgggggtaggaacacggaaggccatgccagtga 599 Query: 583 gctt 586 |||| Sbjct: 598 gctt 595
>emb|AJ272043.1|CAN272043 Capsicum annuum partial gapCp gene for chloroplast glyceraldehyde-3-phosphate dehydrogenase, exons 13-14 Length = 549 Score = 79.8 bits (40), Expect = 1e-11 Identities = 79/92 (85%) Strand = Plus / Minus Query: 303 ctgtagccccactcgttgtcataccaggagacgagcttcatgaaagatgaacttagaccc 362 ||||| |||||||||||||| ||||||||||||||||||||||| ||| || || || Sbjct: 254 ctgtaaccccactcgttgtcgtaccaggagacgagcttcatgaatgatttgctcaggcct 195 Query: 363 ataccagcattggcatcaaagatgcttgacct 394 |||||||| || |||||||| ||||| ||||| Sbjct: 194 ataccagctttagcatcaaatatgctcgacct 163
>gb|BT016387.1| Zea mays clone Contig220 mRNA sequence Length = 1571 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 272 catgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccagga 331 |||||| | |||||| || | ||| |||||||||||||||||||||||||| ||||| || Sbjct: 1225 catgtggcggatcaggtcgacgacgcggttgctgtagccccactcgttgtcgtaccaaga 1166 Query: 332 gacgagcttcatgaa 346 ||||||||| ||||| Sbjct: 1165 gacgagcttgatgaa 1151 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 558 ggaacccggaaggccatgccagtgagctttccatt 592 ||||||||||||| ||||||||||||||| ||||| Sbjct: 939 ggaacccggaaggacatgccagtgagcttgccatt 905
>gb|AF030943.1| Ovis aries glyceraldehyde 3-phosphate dehydrogenase mRNA, partial cds Length = 836 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| |||||||| ||||| || || || || |||||||| Sbjct: 617 tttctccaggcggcaggtcagatccacaacggacacgttgggggtggggacgcggaaggc 558 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 557 catgccagtgagctt 543
>emb|X73151.1|ZMGAPC2 Z.mays GapC2 gene Length = 6166 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 272 catgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccagga 331 |||||| | |||||| || | ||| |||||||||||||||||||||||||| ||||| || Sbjct: 5797 catgtggcggatcaggtcgacgacgcggttgctgtagccccactcgttgtcgtaccaaga 5738 Query: 332 gacgagcttcatgaa 346 ||||||||| ||||| Sbjct: 5737 gacgagcttgatgaa 5723 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 558 ggaacccggaaggccatgccagtgagctttccatt 592 ||||||||||||| ||||||||||||||| ||||| Sbjct: 5128 ggaacccggaaggacatgccagtgagcttgccatt 5094
>emb|AL607064.16| Mouse DNA sequence from clone RP23-314K19 on chromosome 11 Contains a glyceraldehyde-3-phosphate dehydrogenase (Gapd) pseudogene, complete sequence Length = 57166 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| |||||||| || || || |||||||| |||||||| Sbjct: 29525 tttctccaggcggcacgtcagatccacaacggacacattgggggtaggaacacggaaggc 29584 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 29585 catgccagtgagctt 29599
>emb|BX571885.7| Mouse DNA sequence from clone RP23-17O21 on chromosome 4 Contains a glyceraldehyde-3-phosphate dehydrogenase (Gapd) pseudogene, a novel gene and the 3' end of a novel gene, complete sequence Length = 218922 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || ||||| |||||||| |||||||| Sbjct: 27735 tttctccaggcggcacgtcagatccacgacggacacattaggggtaggaacacggaaggc 27676 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 27675 catgccagtgagctt 27661
>gb|L13432.1|MZEGAPDB Zea mays GAPC2 glyceraldehyde-3-phosphate dehydrogenase mRNA, partial cds Length = 971 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 272 catgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccagga 331 |||||| | |||||| || | ||| |||||||||||||||||||||||||| ||||| || Sbjct: 730 catgtggcggatcaggtcgacgacgcggttgctgtagccccactcgttgtcgtaccaaga 671 Query: 332 gacgagcttcatgaa 346 ||||||||| ||||| Sbjct: 670 gacgagcttgatgaa 656 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 558 ggaacccggaaggccatgccagtgagctttccatt 592 ||||||||||||| ||||||||||||||| ||||| Sbjct: 444 ggaacccggaaggacatgccagtgagcttgccatt 410
>gb|AC157651.3| Mus musculus BAC clone RP24-363O21 from chromosome 6, complete sequence Length = 171141 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| |||||||| || || || |||||||| |||||||| Sbjct: 37373 tttctccaggcggcacgtcagatccacaacggacacattgggggtaggaacacggaaggc 37314 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 37313 catgccagtgagctt 37299
>ref|XM_577511.1| PREDICTED: Rattus norvegicus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC502077), mRNA Length = 855 Score = 77.8 bits (39), Expect = 4e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 530 cagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctttcc 589 |||||| |||| ||||||||| || ||||||||| |||||||||||||||||||||| || Sbjct: 594 cagatccacaatggatacgttgggggtaggaacctggaaggccatgccagtgagcttccc 535 Query: 590 att 592 ||| Sbjct: 534 att 532
>gb|AY109359.1| Zea mays CL2022_2 mRNA sequence Length = 3495 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 272 catgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccagga 331 |||||| | |||||| || | ||| |||||||||||||||||||||||||| ||||| || Sbjct: 3105 catgtggcggatcaggtcgacgacgcggttgctgtagccccactcgttgtcgtaccacga 3046 Query: 332 gacgagcttcatgaa 346 ||||||||| ||||| Sbjct: 3045 gacgagcttgatgaa 3031 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 558 ggaacccggaaggccatgccagtgagctttccatt 592 ||||||||||||| ||||||||||||||| ||||| Sbjct: 2819 ggaacccggaaggacatgccagtgagcttgccatt 2785
>gb|U94889.1|OAU94889 Ovis aries glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, partial cds Length = 556 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| |||||||| ||||| || || || || |||||||| Sbjct: 301 tttctccaggcggcaggtcagatccacaacggacacgttgggggtggggacgcggaaggc 242 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 241 catgccagtgagctt 227
>gb|U45858.1|ZMU45858 Zea mays glyceraldehyde-3-phosphate dehydrogenase (gpc2) gene, complete cds Length = 4590 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 272 catgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccagga 331 |||||| | |||||| || | ||| |||||||||||||||||||||||||| ||||| || Sbjct: 4456 catgtggcggatcaggtcgacgacgcggttgctgtagccccactcgttgtcgtaccaaga 4397 Query: 332 gacgagcttcatgaa 346 ||||||||| ||||| Sbjct: 4396 gacgagcttgatgaa 4382 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 558 ggaacccggaaggccatgccagtgagctttccatt 592 ||||||||||||| ||||||||||||||| ||||| Sbjct: 3482 ggaacccggaaggacatgccagtgagcttgccatt 3448 Score = 50.1 bits (25), Expect = 0.009 Identities = 41/45 (91%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 303 ctgtagccccactcgttgtcata-ccaggagacgagcttcatgaa 346 |||||||||||||||||||| || ||| ||||||||||| ||||| Sbjct: 4128 ctgtagccccactcgttgtcgtacccaagagacgagcttgatgaa 4084
>gb|U45855.1|ZMU45855 Zea mays glyceraldehyde-3-phosphate dehydrogenase GAPC2 (gpc2) mRNA, complete cds Length = 1307 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 272 catgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccagga 331 |||||| | |||||| || | ||| |||||||||||||||||||||||||| ||||| || Sbjct: 1065 catgtggcggatcaggtcgacgacgcggttgctgtagccccactcgttgtcgtaccaaga 1006 Query: 332 gacgagcttcatgaa 346 ||||||||| ||||| Sbjct: 1005 gacgagcttgatgaa 991 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 558 ggaacccggaaggccatgccagtgagctttccatt 592 ||||||||||||| ||||||||||||||| ||||| Sbjct: 779 ggaacccggaaggacatgccagtgagcttgccatt 745
>gb|U39091.1|OAU39091 Ovis aries glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene, partial cds Length = 317 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| |||||||| ||||| || || || || |||||||| Sbjct: 77 tttctccaggcggcaggtcagatccacaacggacacgttgggggtggggacgcggaaggc 18 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 17 catgccagtgagctt 3
>gb|AF363637.2| Capreolus capreolus glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, partial cds Length = 305 Score = 75.8 bits (38), Expect = 1e-10 Identities = 65/74 (87%) Strand = Plus / Minus Query: 513 ttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggcc 572 ||||| || |||||||||||||| |||||||| ||||| || || || || ||||||||| Sbjct: 284 ttctccaggcggcaggtcagatccacaacggacacgttgggggtgggcacgcggaaggcc 225 Query: 573 atgccagtgagctt 586 |||||||||||||| Sbjct: 224 atgccagtgagctt 211
>ref|XM_573666.1| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC364200), mRNA Length = 1026 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 ||||| |||||||| ||||||||||| ||||| |||||| | |||||||||||||||||| Sbjct: 744 cggcatgtcagatccacaacggatacattaggggtaggaccacggaaggccatgccagtg 685 Query: 582 ag 583 || Sbjct: 684 ag 683
>ref|XM_578673.1| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (EC 1.2.1.12) - mouse (LOC366918), mRNA Length = 1197 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 |||||||| |||| |||||| || || |||||||| ||||||||||||||||||||||| Sbjct: 953 gtcagatccacaatggatacattgggggtaggaacacggaaggccatgccagtgagcttc 894 Query: 588 ccattt 593 |||||| Sbjct: 893 ccattt 888
>gb|BT016419.1| Zea mays clone Contig252 mRNA sequence Length = 1442 Score = 73.8 bits (37), Expect = 6e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 272 catgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccagga 331 |||||| | |||||| || | ||| |||||||||||||||||||||||||| ||||| || Sbjct: 1065 catgtggcggatcaggtcgacgacgcggttgctgtagccccactcgttgtcgtaccacga 1006 Query: 332 gacgagctt 340 ||||||||| Sbjct: 1005 gacgagctt 997 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 555 gtaggaacccggaaggccatgccagtgagctttccatt 592 |||||||| ||||||| ||| ||||||||||| ||||| Sbjct: 782 gtaggaacacggaaggacataccagtgagcttgccatt 745
>gb|AY650282.1| Cervus elaphus glyceraldehyde-3-phosphate dehydrogenase mRNA, partial cds Length = 589 Score = 73.8 bits (37), Expect = 6e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 |||||||||||||| ||||| || ||||| || ||||| || |||||||||||||||||| Sbjct: 587 cggcaggtcagatccacaacagacacgttgggggtaggcacacggaaggccatgccagtg 528 Query: 582 agctt 586 ||||| Sbjct: 527 agctt 523
>ref|XR_002955.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC670400), mRNA Length = 1077 Score = 73.8 bits (37), Expect = 6e-10 Identities = 70/81 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| |||| |||||| || || |||||||| |||||||| Sbjct: 821 tttctccaggcggcatgtcagatccacaatggatacattgggggtaggaacacggaaggc 762 Query: 572 catgccagtgagctttccatt 592 |||||||| |||||| ||||| Sbjct: 761 catgccagagagcttcccatt 741
>ref|XR_002189.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC629359), mRNA Length = 1076 Score = 73.8 bits (37), Expect = 6e-10 Identities = 70/81 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| |||| |||||| || || |||||||| |||||||| Sbjct: 821 tttctccaggcggcatgtcagatccacaatggatacattgggggtaggaacacggaaggc 762 Query: 572 catgccagtgagctttccatt 592 |||||||| |||||| ||||| Sbjct: 761 catgccagagagcttcccatt 741
>gb|AY594330.1| Mus musculus cytochrome P450 17-alpha hydroxylase/17,20 lyase (Cyp17) gene, complete cds Length = 16649 Score = 73.8 bits (37), Expect = 6e-10 Identities = 70/81 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| |||| |||||| || || |||||||| |||||||| Sbjct: 2795 tttctccaggcggcatgtcagatccacaatggatacattgggggtaggaacacggaaggc 2736 Query: 572 catgccagtgagctttccatt 592 |||||||| |||||| ||||| Sbjct: 2735 catgccagagagcttcccatt 2715
>emb|X07156.1|ZMCGAPDH Maize mRNA for cytosolic GAPDH (GapC) glyceraldehyde-3-phosphate dehydrogenase Length = 1305 Score = 73.8 bits (37), Expect = 6e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 272 catgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccagga 331 |||||| | |||||| || | ||| |||||||||||||||||||||||||| ||||| || Sbjct: 1073 catgtggcggatcaggtcgacgacgcggttgctgtagccccactcgttgtcgtaccacga 1014 Query: 332 gacgagctt 340 ||||||||| Sbjct: 1013 gacgagctt 1005 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 555 gtaggaacccggaaggccatgccagtgagctttccatt 592 |||||||| ||||||| ||| ||||||||||| ||||| Sbjct: 790 gtaggaacacggaaggacataccagtgagcttgccatt 753
>emb|BX571867.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment 9/17 Length = 336609 Score = 73.8 bits (37), Expect = 6e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 ||||| |||||||| ||||||||||| |||||||| ||||| ||||||||||| ||||| Sbjct: 214903 gtcaggtcaacaaccgatacgttaggcgtaggaacgcggaaagccatgccagtcagctta 214844 Query: 588 ccatt 592 ||||| Sbjct: 214843 ccatt 214839
>gb|AF157626.1|AF157626 Equus caballus glyceraldehyde-3-phosphate dehydrogenase mRNA, partial cds Length = 828 Score = 73.8 bits (37), Expect = 6e-10 Identities = 70/81 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| || || || |||||||| || || || |||||||| Sbjct: 622 tttctccaggcggcaggtcagatccacgactgacacgttaggggtggggacacggaaggc 563 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 562 catgccagtgagcttcccatt 542
>ref|XM_576287.1| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (EC 1.2.1.12) - mouse (LOC362929), mRNA Length = 929 Score = 73.8 bits (37), Expect = 6e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||||||||||| || || |||||||| |||||||| Sbjct: 658 tttctccaggcggcatgtcagatccacaacggatacattgggggtaggaacacggaaggc 599 Query: 572 catgccagt 580 ||||||||| Sbjct: 598 catgccagt 590
>ref|XM_234037.3| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (EC 1.2.1.12) - mouse (LOC313970), mRNA Length = 1080 Score = 73.8 bits (37), Expect = 6e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 |||||||| ||||| ||||| || || |||||||| ||||||||||||||||||||||| Sbjct: 735 gtcagatccacaacagatacattgggggtaggaacacggaaggccatgccagtgagcttc 676 Query: 588 ccatt 592 ||||| Sbjct: 675 ccatt 671
>gb|AF083897.1|AF083897 Equus caballus glyceraldehyde-3-phosphate dehydrogenase (G3PDH) mRNA, partial cds Length = 412 Score = 73.8 bits (37), Expect = 6e-10 Identities = 70/81 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| || || || |||||||| || || || |||||||| Sbjct: 208 tttctccaggcggcaggtcagatccacgactgacacgttaggggtggggacacggaaggc 149 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 148 catgccagtgagcttcccatt 128
>gb|AC161865.4| Mus musculus chromosome 19, clone RP23-218F7, complete sequence Length = 206019 Score = 73.8 bits (37), Expect = 6e-10 Identities = 70/81 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| |||| |||||| || || |||||||| |||||||| Sbjct: 176635 tttctccaggcggcatgtcagatccacaatggatacattgggggtaggaacacggaaggc 176576 Query: 572 catgccagtgagctttccatt 592 |||||||| |||||| ||||| Sbjct: 176575 catgccagagagcttcccatt 176555
>gb|AC114678.20| Mus musculus chromosome 10, clone RP24-213L12, complete sequence Length = 180079 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Plus Query: 523 ggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtga 582 |||| |||||||| ||||||||||| || || |||||||| |||||||||||||||||| Sbjct: 143568 ggcatgtcagatccacaacggatacattgggggtaggaacatggaaggccatgccagtga 143627 Query: 583 gctt 586 |||| Sbjct: 143628 gctt 143631
>ref|XR_003618.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC671913), mRNA Length = 1001 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 523 ggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtga 582 |||| |||||||| ||||||||||| || || |||||||| |||||||||||||||||| Sbjct: 734 ggcatgtcagatccacaacggatacattgggggtaggaacatggaaggccatgccagtga 675 Query: 583 gctt 586 |||| Sbjct: 674 gctt 671
>gb|AC092531.16| Rattus norvegicus clone rp32-475b19, complete sequence Length = 160215 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 529 tcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctttc 588 ||||||| ||||||||||| || || |||||||| | ||||||||||||||||||||| | Sbjct: 146830 tcagatccacaacggatacattgggggtaggaacgcagaaggccatgccagtgagcttcc 146771 Query: 589 catt 592 |||| Sbjct: 146770 catt 146767
>gb|AC092530.35| Rattus norvegicus clone rp32-28p17, complete sequence Length = 221618 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Plus Query: 529 tcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctttc 588 ||||||| ||||||||||| || || |||||||| | ||||||||||||||||||||| | Sbjct: 126274 tcagatccacaacggatacattgggggtaggaacgcagaaggccatgccagtgagcttcc 126333 Query: 589 catt 592 |||| Sbjct: 126334 catt 126337
>ref|XM_578803.1| PREDICTED: Rattus norvegicus similar to UDP glycosyltransferase 1 family polypeptide A11 (LOC503268), mRNA Length = 1365 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Plus Query: 529 tcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctttc 588 ||||||| ||||||||||| || || |||||||| | ||||||||||||||||||||| | Sbjct: 1281 tcagatccacaacggatacattgggggtaggaacgcagaaggccatgccagtgagcttcc 1340 Query: 589 catt 592 |||| Sbjct: 1341 catt 1344
>ref|XM_575242.1| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC499896), mRNA Length = 1289 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 523 ggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtga 582 |||| |||||||| ||||||||||| || || |||||||| | ||||||||||||||||| Sbjct: 809 ggcatgtcagatccacaacggatacattgggggtaggaacacagaaggccatgccagtga 750 Query: 583 gctt 586 |||| Sbjct: 749 gctt 746
>gb|AC116758.11| Mus musculus chromosome 8, clone RP23-383A10, complete sequence Length = 190294 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 120377 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 120436 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 120437 catgccagtgagctt 120451
>gb|AC115877.13| Mus musculus chromosome 15, clone RP24-358H21, complete sequence Length = 169136 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 151935 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 151994 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 151995 catgccagtgagctt 152009
>gb|AC166162.6| Mus musculus BAC clone RP23-436K10 from chromosome 6, complete sequence Length = 181038 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 135802 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 135861 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 135862 catgccagtgagctt 135876
>ref|XM_479895.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1356 Score = 69.9 bits (35), Expect = 9e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 270 gccatgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccag 329 |||||||| | |||||| || | ||||||||||||||| |||||||||||||| |||||| Sbjct: 1045 gccatgtggcggatcaggtcgatgacacggttgctgtaaccccactcgttgtcgtaccag 986 Query: 330 gagacgagctt 340 | ||| ||||| Sbjct: 985 gcgacaagctt 975 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaa 409 ||||| ||||| || |||||||| ||||| ||||||||||||| Sbjct: 949 ccagccttggcgtcgaagatgctcgacctgctgtcaccaacaaa 906
>ref|XM_507107.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1163_G08.15 mRNA Length = 1518 Score = 69.9 bits (35), Expect = 9e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 270 gccatgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccag 329 |||||||| | |||||| || | ||||||||||||||| |||||||||||||| |||||| Sbjct: 1078 gccatgtggcggatcaggtcgatgacacggttgctgtaaccccactcgttgtcgtaccag 1019 Query: 330 gagacgagctt 340 | ||| ||||| Sbjct: 1018 gcgacaagctt 1008 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaa 409 ||||| ||||| || |||||||| ||||| ||||||||||||| Sbjct: 982 ccagccttggcgtcgaagatgctcgacctgctgtcaccaacaaa 939
>gb|BC085275.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:103193 IMAGE:30444086), complete cds Length = 1264 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 814 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 755 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 754 catgccagtgagctt 740
>gb|BC085274.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:103192 IMAGE:6530979), complete cds Length = 1257 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 805 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 746 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 745 catgccagtgagctt 731
>gb|BC085315.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:102545 IMAGE:30440429), complete cds Length = 1249 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 799 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 740 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 739 catgccagtgagctt 725
>gb|BC083080.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:103191 IMAGE:6494145), complete cds Length = 1252 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 804 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 745 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 744 catgccagtgagctt 730
>gb|BC083149.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:102546 IMAGE:30459585), complete cds Length = 1271 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 783 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 724 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 723 catgccagtgagctt 709
>gb|BC083079.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:102544 IMAGE:6493407), complete cds Length = 1249 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 802 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 743 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 742 catgccagtgagctt 728
>gb|BC083065.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:103190 IMAGE:5371133), complete cds Length = 1292 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 796 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 737 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 736 catgccagtgagctt 722
>gb|AC111116.13| Mus musculus chromosome 16, clone RP23-214I13, complete sequence Length = 173839 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 |||||||| ||||||||||| || | |||||||| ||||||||||||||||||||||| Sbjct: 71405 gtcagatctacaacggatacattgcgggtaggaacacggaaggccatgccagtgagctt 71347
>gb|AC166075.2| Mus musculus BAC clone RP23-143L15 from chromosome 1, complete sequence Length = 212447 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 139409 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 139468 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 139469 catgccagtgagctt 139483
>gb|AC163335.6| Mus musculus chromosome 7, clone RP24-149G13, complete sequence Length = 164660 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 39208 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 39267 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 39268 catgccagtgagctt 39282
>gb|BC082592.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:105239 IMAGE:30634381), complete cds Length = 1254 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 797 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 738 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 737 catgccagtgagctt 723
>gb|AC102196.7| Mus musculus chromosome 3, clone RP24-445M20, complete sequence Length = 166532 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 136034 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 135975 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 135974 catgccagtgagctt 135960
>ref|NG_005470.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene (LOC654475) on chromosome 4 Length = 1433 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 897 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 838 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 837 catgccagtgagctt 823
>ref|NG_005467.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene (LOC433845) on chromosome 5 Length = 1406 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 875 tttctccaggcggcacgtcagatccacgacggacacattgggagtaggaacacggaaggc 816 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 815 catgccagtgagctt 801
>ref|NG_005469.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene (LOC654474) on chromosome X Length = 1434 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 897 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 838 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 837 catgccagtgagctt 823
>ref|NG_005233.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene (LOC433921) on chromosome 5 Length = 1441 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 908 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 849 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 848 catgccagtgagctt 834
>gb|AC124377.4| Mus musculus BAC clone RP24-396N12 from chromosome 5, complete sequence Length = 170401 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 102340 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 102281 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 102280 catgccagtgagctt 102266
>ref|NM_008084.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC14433), mRNA Length = 1228 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 793 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 734 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 733 catgccagtgagctt 719
>gb|AC124113.9| Mus musculus chromosome 5, clone RP24-354P12, complete sequence Length = 156826 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 102770 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 102711 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 102710 catgccagtgagctt 102696
>gb|AC151834.7| Mus musculus BAC clone RP23-382M10 from chromosome 8, complete sequence Length = 208404 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 21651 tttctctaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 21710 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 21711 catgccagtgagctt 21725
>gb|AC121279.7| Mus musculus chromosome 3, clone RP23-4F17, complete sequence Length = 207763 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 131611 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 131552 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 131551 catgccagtgagctt 131537
>ref|XR_003802.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC672308), mRNA Length = 1079 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 |||||||| |||||||| || || || |||||||| ||||||||||||||||||||||| Sbjct: 739 gtcagatccacaacggacacattgggggtaggaacacggaaggccatgccagtgagctt 681
>ref|XM_484732.3| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC433184), mRNA Length = 1008 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 |||||||| |||||||| || || || |||||||| ||||||||||||||||||||||| Sbjct: 737 gtcagatccacaacggacacattgggggtaggaacacggaaggccatgccagtgagctt 679
>ref|XM_973383.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC630967), mRNA Length = 1002 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 747 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 688 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 687 catgccagtgagctt 673
>ref|XM_484436.4| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC432919), mRNA Length = 1002 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 747 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 688 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 687 catgccagtgagctt 673
>ref|XM_904634.2| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC630967), mRNA Length = 1002 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 747 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 688 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 687 catgccagtgagctt 673
>ref|XM_848225.1| PREDICTED: Canis familiaris similar to glyceraldehyde-3-phosphate dehydrogenase (LOC610683), mRNA Length = 1221 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| ||||||||||||||||| ||||| ||||| || || || || | |||||||| Sbjct: 747 tttctccagccggcaggtcagatccacaactgatacattgggggtggggtcacggaaggc 688 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 687 catgccagtgagctt 673
>gb|AC147142.2| Mus musculus BAC clone RP24-391G7 from chromosome Y, complete sequence Length = 162132 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 42843 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 42784 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 42783 catgccagtgagctt 42769
>gb|AC146611.2| Mus musculus BAC clone RP23-57A17 from chromosome 5, complete sequence Length = 194487 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 175029 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 175088 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 175089 catgccagtgagctt 175103
>gb|AC115124.6| Mus musculus BAC clone RP24-349M22 from chromosome 18, complete sequence Length = 137371 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 |||||||| |||||||| || || || |||||||| ||||||||||||||||||||||| Sbjct: 44549 gtcagatccacaacggacacattgggggtaggaacacggaaggccatgccagtgagctt 44607
>gb|AC130841.4| Mus musculus BAC clone RP24-445L16 from chromosome 8, complete sequence Length = 174384 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 20138 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 20197 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 20198 catgccagtgagctt 20212
>gb|AC121839.3| Mus musculus BAC clone RP24-76E2 from chromosome 13, complete sequence Length = 182835 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 124154 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 124213 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 124214 catgccagtgagctt 124228
>gb|AC124773.4| Mus musculus BAC clone RP23-49B23 from 3, complete sequence Length = 216860 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 195435 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 195494 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 195495 catgccagtgagctt 195509
>gb|BC098095.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene, mRNA (cDNA clone MGC:106682 IMAGE:30551357), complete cds Length = 1742 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 1166 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 1107 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 1106 catgccagtgagctt 1092
>gb|AY290728.1| Triticum aestivum glyceraldehyde 3-phosphate dehydrogenase-like mRNA, partial sequence Length = 496 Score = 69.9 bits (35), Expect = 9e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 270 gccatgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccag 329 |||||||| | ||||||||| | || ||||||||||| |||||||||||||| ||||| Sbjct: 272 gccatgtggcggatcagatcgacaacgcggttgctgtaaccccactcgttgtcgtaccac 213 Query: 330 gagacgagctt 340 ||||||||||| Sbjct: 212 gagacgagctt 202 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaa 409 ||||| ||||||||||||||||| ||||| ||||||| ||||| Sbjct: 176 ccagccttggcatcaaagatgctcgacctgctgtcaccgacaaa 133
>emb|X60343.1|HVGADPH H.vulgare GADPH mRNA for glycolytic glyceraldehyde-3-phosphate dehydrogenase Length = 1365 Score = 69.9 bits (35), Expect = 9e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 294 acacggttgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||||| |||||||||||||||||||| ||||| ||||| Sbjct: 1021 acacggttgctgtaaccccactcgttgtcataccacgagacaagctt 975 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaac 406 ||||| || |||||||||||||| ||||| |||||||||| Sbjct: 949 ccagccttagcatcaaagatgctggacctgctgtcaccaac 909
>emb|X52123.1|CCGAPDH Cricetus cricetus mRNA for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12) Length = 1266 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 |||||||| |||||||| ||||| || |||||||| ||||||||||||||||| ||||| Sbjct: 804 gtcagatccacaacggacacgttgggggtaggaacacggaaggccatgccagtcagctt 746
>emb|AJ000039.1|BTGAPDH Bos taurus mRNA for glyceraldehyde 3-phosphate dehydrogenase, partial Length = 806 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || ||||| || || || || |||||||| Sbjct: 717 tttctccaggcggcaggtcagatccacaacagacacgttgggagtggggacgcggaaggc 658 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 657 catgccagtgagctt 643
>emb|AL935328.14| Mouse DNA sequence from clone RP23-227C11 on chromosome 11 Contains a peptidylprolyl isomerase A (Ppia) pseudogene, a glyceraldehyde-3-phosphate dehydrogenase (Gapd) pseudogene, a ribosomal protein L17 (Rpl17) pseudogene and an uridine monophosphate synthetase (Umps) pseudogene, complete sequence Length = 182970 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 94828 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 94769 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 94768 catgccagtgagctt 94754
>emb|AL662926.19| Mouse DNA sequence from clone RP23-403O15 on chromosome 11 Contains the 5' end of the Rab1 gene for RAB1, member RAS oncogene family, a ribosomal protein L12 (Rpl12), the Slc1a4 gene for solute carrier family 1 (glutamate/neutral amino acid transporter) member 4, the gene for a novel protein similar to glyceraldehyde-3-phosphate dehydrogenase Gapd and two Cpg islands, complete sequence Length = 125596 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 86929 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 86988 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 86989 catgccagtgagctt 87003
>gb|BC095932.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:106377 IMAGE:30733532), complete cds Length = 1258 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 808 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 749 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 748 catgccagtgagctt 734
>gb|AC158345.8| Mus musculus chromosome 7, clone RP23-271M19, complete sequence Length = 188354 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 39213 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 39154 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 39153 catgccagtgagctt 39139
>gb|BC092252.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:102542 IMAGE:5044783), complete cds Length = 1255 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 806 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 747 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 746 catgccagtgagctt 732
>dbj|AK140794.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130021D09 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 1253 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 820 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 761 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 760 catgccagtgagctt 746
>dbj|AK146435.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched library, clone:I730090K19 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 1253 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 820 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 761 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 760 catgccagtgagctt 746
>ref|NM_001001303.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase (Gapdh), mRNA Length = 1243 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 805 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 746 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 745 catgccagtgagctt 731
>dbj|AK147969.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library, clone:G270120O18 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 2176 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 816 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 757 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 756 catgccagtgagctt 742
>dbj|AK147891.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library, clone:G270083H09 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 1196 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 820 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 761 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 760 catgccagtgagctt 746
>dbj|AK160399.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500001O05 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 1253 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 820 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 761 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 760 catgccagtgagctt 746
>dbj|AK147738.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library, clone:G270015C01 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 1221 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 820 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 761 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 760 catgccagtgagctt 746
>dbj|AK144690.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730023I18 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 1274 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 841 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 782 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 781 catgccagtgagctt 767
>dbj|AK164415.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN full-length enriched library, clone:D230015A01 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 1206 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 818 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 759 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 758 catgccagtgagctt 744
>dbj|AK160753.1| Mus musculus 13 days embryo head cDNA, RIKEN full-length enriched library, clone:3110013E10 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 1248 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 817 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 758 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 757 catgccagtgagctt 743
>dbj|AK169742.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430016M08 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 3290 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 2524 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 2465 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 2464 catgccagtgagctt 2450
>gb|AC117588.11| Mus musculus chromosome 15, clone RP23-177B8, complete sequence Length = 211177 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 26422 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 26481 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 26482 catgccagtgagctt 26496
>dbj|AK160495.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched library, clone:2300001M16 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 615 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 180 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 121 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 120 catgccagtgagctt 106
>dbj|AK168217.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730067N10 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 1253 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 820 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 761 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 760 catgccagtgagctt 746
>gb|U82261.1|SSU82261 Sus scrofa glyceraldehyde-3-phosphate dehydrogenase mRNA, partial cds Length = 452 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || ||||| || || || || |||||||| Sbjct: 228 tttctccaggcggcaggtcagatccacaaccgacacgttgggggtggggacacggaaggc 169 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 168 catgccagtgagctt 154
>gb|BC093508.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:103189 IMAGE:4975394), complete cds Length = 1319 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 777 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 718 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 717 catgccagtgagctt 703
>dbj|AK081405.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130014J06 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 1253 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 820 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 761 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 760 catgccagtgagctt 746
>ref|NM_001034034.1| Bos taurus glyceraldehyde-3-phosphate dehydrogenase (GAPD), mRNA Length = 1280 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || ||||| || || || || |||||||| Sbjct: 819 tttctccaggcggcaggtcagatccacaacagacacgttgggagtggggacgcggaaggc 760 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 759 catgccagtgagctt 745
>gb|BC102589.1| Bos taurus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:127711 IMAGE:7956315), complete cds Length = 1280 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || ||||| || || || || |||||||| Sbjct: 819 tttctccaggcggcaggtcagatccacaacagacacgttgggagtggggacgcggaaggc 760 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 759 catgccagtgagctt 745
>dbj|AK002273.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610007C02 product:glyceraldehyde-3-phosphate dehydrogenase, full insert sequence Length = 1252 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 820 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 761 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 760 catgccagtgagctt 746
>gb|BC096440.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:106375 IMAGE:2649847), complete cds Length = 1279 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 808 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 749 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 748 catgccagtgagctt 734
>gb|BC094037.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:102541 IMAGE:5009636), complete cds Length = 1232 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 784 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 725 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 724 catgccagtgagctt 710
>gb|AC156283.6| Mus musculus 6 BAC RP24-327I4 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 172188 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 71596 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 71537 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 71536 catgccagtgagctt 71522
>gb|AC150660.4| Mus musculus BAC clone RP23-41F9 from chromosome 15, complete sequence Length = 229655 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 161477 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 161418 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 161417 catgccagtgagctt 161403
>gb|BC092294.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:102543 IMAGE:5068049), complete cds Length = 1280 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 797 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 738 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 737 catgccagtgagctt 723
>gb|BC092264.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:102651 IMAGE:2655526), complete cds Length = 1258 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 808 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 749 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 748 catgccagtgagctt 734
>gb|BC092267.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:102540 IMAGE:4010884), complete cds Length = 1279 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 794 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 735 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 734 catgccagtgagctt 720
>ref|NM_001003142.1| Canis familiaris glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA Length = 1002 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| ||||| || || || || || |||||||| Sbjct: 747 tttctccaggcggcaggtcagatccacaactgatacattgggggtggggacacggaaggc 688 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 687 catgccagtgagctt 673 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 297 cggttgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||||| | || |||||||||||||| | |||||| Sbjct: 962 cggttgctgtagccaaattcattgtcataccaggaaatgagctt 919
>ref|NR_002890.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene (LOC654472) on chromosome 11 Length = 1742 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 1166 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 1107 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 1106 catgccagtgagctt 1092
>ref|XM_574756.1| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC499433), mRNA Length = 1306 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| ||| ||||||| || || |||||||| | |||||| Sbjct: 820 tttctccaggcggcatgtcagatccacagcggatacattgggggtaggaacacagaaggc 761 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 760 catgccagtgagctt 746 Score = 44.1 bits (22), Expect = 0.53 Identities = 37/42 (88%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagctt 340 ||||||||||||| | || |||||||||||||| | |||||| Sbjct: 1033 gttgctgtagccctattcattgtcataccaggaaatgagctt 992
>ref|XM_224464.3| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC306115), mRNA Length = 1030 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| |||| |||||| || || |||||||| |||||| | Sbjct: 717 tttctccaggcggcatgtcagatccacaatggatacattgggggtaggaacacggaagcc 658 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 657 catgccagtgagctt 643
>emb|AL805956.22| Mouse DNA sequence from clone RP23-239F1 on chromosome 4, complete sequence Length = 167440 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 165254 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 165313 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 165314 catgccagtgagctt 165328
>emb|BX679665.3| Mouse DNA sequence from clone RP23-247J17 on chromosome 2, complete sequence Length = 34061 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 33922 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 33981 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 33982 catgccagtgagctt 33996
>gb|BC091768.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:103188 IMAGE:4159824), complete cds Length = 1237 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 783 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 724 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 723 catgccagtgagctt 709
>gb|BC091736.1| Mus musculus cDNA clone IMAGE:4019846 Length = 794 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 342 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 283 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 282 catgccagtgagctt 268
>dbj|AK105038.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-C12, full insert sequence Length = 455 Score = 69.9 bits (35), Expect = 9e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 270 gccatgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccag 329 |||||||| | |||||| || | ||||||||||||||| |||||||||||||| |||||| Sbjct: 222 gccatgtggcggatcaggtcgatgacacggttgctgtaaccccactcgttgtcgtaccag 163 Query: 330 gagacgagctt 340 | ||| ||||| Sbjct: 162 gcgacaagctt 152 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaa 409 ||||| ||||| || |||||||| ||||| ||||||||||||| Sbjct: 126 ccagccttggcgtcgaagatgctcgacctgctgtcaccaacaaa 83
>dbj|AK103777.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033144F10, full insert sequence Length = 1356 Score = 69.9 bits (35), Expect = 9e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 270 gccatgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccag 329 |||||||| | |||||| || | ||||||||||||||| |||||||||||||| |||||| Sbjct: 1045 gccatgtggcggatcaggtcgatgacacggttgctgtaaccccactcgttgtcgtaccag 986 Query: 330 gagacgagctt 340 | ||| ||||| Sbjct: 985 gcgacaagctt 975 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaa 409 ||||| ||||| || |||||||| ||||| ||||||||||||| Sbjct: 949 ccagccttggcgtcgaagatgctcgacctgctgtcaccaacaaa 906
>dbj|AK100159.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023020L08, full insert sequence Length = 1783 Score = 69.9 bits (35), Expect = 9e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 270 gccatgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccag 329 |||||||| | |||||| || | ||||||||||||||| |||||||||||||| |||||| Sbjct: 1516 gccatgtggcggatcaggtcgatgacacggttgctgtaaccccactcgttgtcgtaccag 1457 Query: 330 gagacgagctt 340 | ||| ||||| Sbjct: 1456 gcgacaagctt 1446 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaa 409 ||||| ||||| || |||||||| ||||| ||||||||||||| Sbjct: 1420 ccagccttggcgtcgaagatgctcgacctgctgtcaccaacaaa 1377
>gb|AC154416.2| Mus musculus BAC clone RP24-232F23 from 17, complete sequence Length = 167542 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 99384 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 99443 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 99444 catgccagtgagctt 99458
>ref|NG_005468.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene (LOC654473) on chromosome 7 Length = 1434 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 897 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 838 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 837 catgccagtgagctt 823
>dbj|AK071097.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023080G06, full insert sequence Length = 1518 Score = 69.9 bits (35), Expect = 9e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 270 gccatgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccag 329 |||||||| | |||||| || | ||||||||||||||| |||||||||||||| |||||| Sbjct: 1078 gccatgtggcggatcaggtcgatgacacggttgctgtaaccccactcgttgtcgtaccag 1019 Query: 330 gagacgagctt 340 | ||| ||||| Sbjct: 1018 gcgacaagctt 1008 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaa 409 ||||| ||||| || |||||||| ||||| ||||||||||||| Sbjct: 982 ccagccttggcgtcgaagatgctcgacctgctgtcaccaacaaa 939
>gb|AC130536.4| Mus musculus BAC clone RP23-369M17 from 13, complete sequence Length = 188021 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 185181 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 185122 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 185121 catgccagtgagctt 185107
>gb|AF069649.1|AF069649 Sus scrofa glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, partial cds Length = 333 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || ||||| || || || || |||||||| Sbjct: 222 tttctccaggcggcaggtcagatccacaaccgacacgttgggggtggggacacggaaggc 163 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 162 catgccagtgagctt 148
>gb|AC105327.13| Mus musculus chromosome 8, clone RP24-323I19, complete sequence Length = 215363 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 107571 tttctctaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 107630 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 107631 catgccagtgagctt 107645
>gb|BC110311.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:118090 IMAGE:5340298), complete cds Length = 1257 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 809 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 750 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 749 catgccagtgagctt 735
>emb|CT009534.18| Mouse DNA sequence from clone RP23-106A16 on chromosome 17, complete sequence Length = 195558 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 133583 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 133642 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 133643 catgccagtgagctt 133657
>gb|AF077815.1|AF077815 Bos taurus glyceraldehyde 3-phosphate dehydrogenase (G3PDH) mRNA, partial cds Length = 294 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || ||||| || || || || |||||||| Sbjct: 77 tttctccaggcggcaggtcagatccacaacagacacgttgggagtggggacgcggaaggc 18 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 17 catgccagtgagctt 3
>gb|AC148327.3| Mus musculus BAC clone RP24-322E6 from 5, complete sequence Length = 186474 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 28789 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 28848 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 28849 catgccagtgagctt 28863
>gb|BC020407.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone IMAGE:3709344) Length = 1256 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 808 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 749 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 748 catgccagtgagctt 734
>gb|BC023196.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone IMAGE:5138518) Length = 1266 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 818 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 759 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 758 catgccagtgagctt 744
>ref|NM_001001978.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC380687), mRNA Length = 1253 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 820 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 761 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 760 catgccagtgagctt 746
>gb|BC096590.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA clone MGC:106376 IMAGE:6486174), complete cds Length = 1266 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 808 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 749 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 748 catgccagtgagctt 734
>gb|AC148983.2| Mus musculus BAC clone RP23-189G7 from 18, complete sequence Length = 212564 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 |||||||| |||||||| || || || |||||||| ||||||||||||||||||||||| Sbjct: 209051 gtcagatccacaacggacacattgggggtaggaacacggaaggccatgccagtgagctt 209109
>gb|AC134337.3| Mus musculus BAC clone RP23-252I24 from 8, complete sequence Length = 169201 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 43990 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 43931 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 43930 catgccagtgagctt 43916
>gb|AC137555.4| Mus musculus BAC clone RP23-445B17 from 1, complete sequence Length = 174607 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 9890 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 9949 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 9950 catgccagtgagctt 9964
>emb|AL929179.6| Mouse DNA sequence from clone RP23-428M4 on chromosome 2, complete sequence Length = 117995 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 1861 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 1920 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 1921 catgccagtgagctt 1935 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 ||||| |||| ||| ||||||||||| || || |||||||| ||||||||||||||| | Sbjct: 13542 cggcatgtcaaatccacaacggatacattgggggtaggaacatggaaggccatgccagcg 13483 Query: 582 agctt 586 ||||| Sbjct: 13482 agctt 13478
>gb|U85042.1|BTU85042 Bos taurus glyceraldehyde-phosphate-dehydrogenase (GAPDH) mRNA, partial cds Length = 934 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || ||||| || || || || |||||||| Sbjct: 717 tttctccaggcggcaggtcagatccacaacagacacgttgggagtggggacgcggaaggc 658 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 657 catgccagtgagctt 643
>gb|AC109165.11| Mus musculus chromosome 5, clone RP23-30B3, complete sequence Length = 202377 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 87497 tttctccaggcggcacgtcagatccacgacggacacattgggagtaggaacacggaaggc 87556 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 87557 catgccagtgagctt 87571
>gb|U76740.1|OAU76740 Ovis aries glyceraldehyde 3-phosphate dehydrogenase mRNA, partial cds Length = 248 Score = 69.9 bits (35), Expect = 9e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 524 gcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgag 583 |||||||||||| |||||||| ||||| || || || || |||||||||||||||||||| Sbjct: 190 gcaggtcagatccacaacggacacgttgggggtggggacgcggaaggccatgccagtgag 131 Query: 584 ctt 586 ||| Sbjct: 130 ctt 128
>gb|AC164643.4| Mus musculus BAC clone RP23-254F23 from chromosome 7, complete sequence Length = 232098 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 210545 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 210604 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 210605 catgccagtgagctt 210619
>gb|U48832.1|SSU48832 Sus scrofa glyceraldehyde-3-phosphate dehydrogenase mRNA, partial cds Length = 865 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || ||||| || || || || |||||||| Sbjct: 707 tttctccaggcggcaggtcagatccacaaccgacacgttgggggtggggacacggaaggc 648 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 647 catgccagtgagctt 633
>gb|U31676.1|OSU31676 Oryza sativa clone glyceraldehyde-3-phosphate dehydrogenase (Gpc) mRNA, complete cds Length = 1326 Score = 69.9 bits (35), Expect = 9e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 270 gccatgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccag 329 |||||||| | |||||| || | ||||||||||||||| |||||||||||||| |||||| Sbjct: 1029 gccatgtggcggatcaggtcgatgacacggttgctgtaaccccactcgttgtcgtaccag 970 Query: 330 gagacgagctt 340 | ||| ||||| Sbjct: 969 gcgacaagctt 959 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaa 409 ||||| ||||| || |||||||| ||||| ||||||||||||| Sbjct: 933 ccagccttggcgtcgaagatgctcgacctgctgtcaccaacaaa 890
>emb|AL772328.13| Mouse DNA sequence from clone RP23-270A19 on chromosome 4, complete sequence Length = 219095 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 71318 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 71377 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 71378 catgccagtgagctt 71392
>emb|AL808132.5| Mouse DNA sequence from clone RP23-125A12 on chromosome X, complete sequence Length = 201114 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 198417 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 198476 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 198477 catgccagtgagctt 198491
>emb|AL732526.8| Mouse DNA sequence from clone RP23-338O4 on chromosome 2, complete sequence Length = 165825 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 162127 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 162186 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 162187 catgccagtgagctt 162201
>gb|M32599.1|MUSGAPDH Mouse glyceraldehyde-3-phosphate dehydrogenase mRNA, complete cds Length = 1228 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || ||||| || || || |||||||| |||||||| Sbjct: 793 tttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggc 734 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 733 catgccagtgagctt 719
>gb|J05223.1|CIPNADGAPD M.crystallinum glyceraldehyde-3-phosphate dehydrogenase (NAD-GAPDH) mRNA, complete cds Length = 1354 Score = 69.9 bits (35), Expect = 9e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 372 ttggcatcaaagatgcttgaccttgtgtcaccaacaaaatcgtttgaaacaacatcctcg 431 ||||||||||||||||||||||| ||||||||| ||| ||| | ||||||| ||| || Sbjct: 953 ttggcatcaaagatgcttgacctgttgtcaccaataaagtcggtggaaacaagatcatcc 894 Query: 432 tctgtgtagcctaaaataccctt 454 || ||||| || ||||||||||| Sbjct: 893 tcggtgtatcccaaaataccctt 871
>gb|M29956.1|CIPGPDNAD Common ice plant (M.crystallinum) NAD-glyceraldehyde-3-phosphate dehydrogenase mRNA, complete cds Length = 1354 Score = 69.9 bits (35), Expect = 9e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 372 ttggcatcaaagatgcttgaccttgtgtcaccaacaaaatcgtttgaaacaacatcctcg 431 ||||||||||||||||||||||| ||||||||| ||| ||| | ||||||| ||| || Sbjct: 953 ttggcatcaaagatgcttgacctgttgtcaccaataaagtcggtggaaacaagatcatcc 894 Query: 432 tctgtgtagcctaaaataccctt 454 || ||||| || ||||||||||| Sbjct: 893 tcggtgtatcccaaaataccctt 871
>dbj|AB038240.1| Canis familiaris GAPDH mRNA for glyceraldehyde-3-phosphate dehydrogenase, complete cds Length = 1002 Score = 69.9 bits (35), Expect = 9e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| ||||| || || || || || |||||||| Sbjct: 747 tttctccaggcggcaggtcagatccacaactgatacattgggggtggggacacggaaggc 688 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 687 catgccagtgagctt 673 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 297 cggttgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||||| | || |||||||||||||| | |||||| Sbjct: 962 cggttgctgtagccaaattcattgtcataccaggaaatgagctt 919
>gb|AC148009.3| Mus musculus BAC clone RP23-227B20 from chromosome 19, complete sequence Length = 201209 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 529 tcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 ||||||| || ||||| ||||| || |||||||| ||||||||||||||||||||||| Sbjct: 68025 tcagatccacgacggacacgttgggggtaggaacacggaaggccatgccagtgagctt 68082
>gb|DQ185431.1| Rosa roxburghii clone a24 defense-related mRNA, partial sequence Length = 499 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaaatcgtttgaaacaaca 425 ||||| ||||||||||||||||||||||| ||||||||| || ||| |||| |||||| Sbjct: 195 ccagccttggcatcaaagatgcttgacctgttgtcaccaatgaagtcggttgacacaaca 136 Query: 426 tcctcgtctgtgta 439 ||||| || ||||| Sbjct: 135 tcctcatcggtgta 122
>gb|AF421144.1| Fragaria x ananassa glyceraldehyde 3-phosphate dehydrogenase (GAPDH1) mRNA, partial cds Length = 399 Score = 67.9 bits (34), Expect = 4e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaaatcgtttgaaacaaca 425 ||||| ||||||||||| ||||| ||||||| ||||||||||||||| || ||||| ||| Sbjct: 362 ccagccttggcatcaaatatgctggaccttgagtcaccaacaaaatcattggaaaccaca 303 Query: 426 tc 427 || Sbjct: 302 tc 301 Score = 42.1 bits (21), Expect = 2.1 Identities = 45/53 (84%) Strand = Plus / Minus Query: 537 acaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctttcc 589 ||||| ||||| ||||| || || || ||||||||||| ||||| |||||||| Sbjct: 191 acaacagatacattaggagttgggacacggaaggccataccagtcagctttcc 139
>gb|AC165293.2| Mus musculus BAC clone RP23-268A5 from chromosome 12, complete sequence Length = 179330 Score = 67.9 bits (34), Expect = 4e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 523 ggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtga 582 |||| |||||||| |||| ||| || || || |||||||| ||||||||||||||||||| Sbjct: 59113 ggcacgtcagatccacaatggacacattgggggtaggaacacggaaggccatgccagtga 59054 Query: 583 gctttccatt 592 |||| ||||| Sbjct: 59053 gcttcccatt 59044
>ref|XR_003765.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC672238), mRNA Length = 1022 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 529 tcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 ||||||| || ||||| ||||| || |||||||| ||||||||||||||||||||||| Sbjct: 726 tcagatccacgacggacacgttgggggtaggaacacggaaggccatgccagtgagctt 669
>ref|XR_002082.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC667806), mRNA Length = 998 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 529 tcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 ||||||| || ||||| ||||| || |||||||| ||||||||||||||||||||||| Sbjct: 726 tcagatccacgacggacacgttgggggtaggaacacggaaggccatgccagtgagctt 669
>ref|XM_980907.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC638833), mRNA Length = 1032 Score = 67.9 bits (34), Expect = 4e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 |||||||| || ||||| || || || |||||||| |||||||||||||||||||||||| Sbjct: 761 gtcagatccacgacggacacattgggggtaggaacacggaaggccatgccagtgagcttt 702 Query: 588 cc 589 || Sbjct: 701 cc 700
>ref|XM_982955.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC670723), mRNA Length = 1002 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 513 ttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggcc 572 ||||| || ||||| |||||||| || ||||| || || || |||||||| ||||||||| Sbjct: 746 ttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggcc 687 Query: 573 atgccagtgagctt 586 |||||||||||||| Sbjct: 686 atgccagtgagctt 673
>ref|XM_987944.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC667048), mRNA Length = 1002 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 513 ttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggcc 572 ||||| || ||||| |||||||| || ||||| || || || |||||||| ||||||||| Sbjct: 746 ttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggcc 687 Query: 573 atgccagtgagctt 586 |||||||||||||| Sbjct: 686 atgccagtgagctt 673
>ref|XM_990888.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC638833), mRNA Length = 1032 Score = 67.9 bits (34), Expect = 4e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 |||||||| || ||||| || || || |||||||| |||||||||||||||||||||||| Sbjct: 761 gtcagatccacgacggacacattgggggtaggaacacggaaggccatgccagtgagcttt 702 Query: 588 cc 589 || Sbjct: 701 cc 700
>ref|XM_914987.2| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC638833), mRNA Length = 1032 Score = 67.9 bits (34), Expect = 4e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 |||||||| || ||||| || || || |||||||| |||||||||||||||||||||||| Sbjct: 761 gtcagatccacgacggacacattgggggtaggaacacggaaggccatgccagtgagcttt 702 Query: 588 cc 589 || Sbjct: 701 cc 700
>ref|XR_003702.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC435292), mRNA Length = 1008 Score = 67.9 bits (34), Expect = 4e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 523 ggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtga 582 |||| |||||||| |||| ||| || || || |||||||| ||||||||||||||||||| Sbjct: 742 ggcacgtcagatccacaatggacacattgggggtaggaacacggaaggccatgccagtga 683 Query: 583 gctttccatt 592 |||| ||||| Sbjct: 682 gcttcccatt 673
>gb|AY363102.1|AY363102S1 Mus musculus diadenosine triphosphate hydrolase (Fhit) gene, exons 1 and 2 Length = 309506 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 513 ttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggcc 572 ||||| || ||||| |||||||| || ||||| || || || |||||||| ||||||||| Sbjct: 24699 ttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggcc 24640 Query: 573 atgccagtgagctt 586 |||||||||||||| Sbjct: 24639 atgccagtgagctt 24626
>gb|AC124540.4| Mus musculus BAC clone RP23-361G19 from chromosome 19, complete sequence Length = 199168 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 529 tcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 ||||||| || ||||| ||||| || |||||||| ||||||||||||||||||||||| Sbjct: 172484 tcagatccacgacggacacgttgggggtaggaacacggaaggccatgccagtgagctt 172541
>gb|AC091683.53| Mus musculus strain C57BL/6J clone rp23-155l11 map 13, complete sequence Length = 236314 Score = 67.9 bits (34), Expect = 4e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 |||||||| || ||||| || || || |||||||| |||||||||||||||||||||||| Sbjct: 200605 gtcagatccacgacggacacattgggggtaggaacacggaaggccatgccagtgagcttt 200546 Query: 588 cc 589 || Sbjct: 200545 cc 200544
>gb|BC092063.1| Mus musculus cDNA clone IMAGE:4195104 Length = 1714 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 513 ttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggcc 572 ||||| || ||||| |||||||| || ||||| || || || |||||||| ||||||||| Sbjct: 1261 ttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggcc 1202 Query: 573 atgccagtgagctt 586 |||||||||||||| Sbjct: 1201 atgccagtgagctt 1188
>gb|L32561.1|PING3PDB Pinus sylvestris NAD+-dependent glyceraldehyde-3-phosphate dehydrogenase mRNA, chloroplast gene encoding chloroplast protein, complete cds Length = 1606 Score = 67.9 bits (34), Expect = 4e-08 Identities = 241/310 (77%) Strand = Plus / Minus Query: 297 cggttgctgtagccccactcgttgtcataccaggagacgagcttcatgaaagatgaactt 356 ||||||||||| |||||||| ||||||||||| || || || |||| || | ||||| Sbjct: 1301 cggttgctgtatccccactcattgtcataccaagaaacaagtttcacaaatgtagaactc 1242 Query: 357 agacccataccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaaatcgttt 416 | | |||||||| || ||||||||||| || ||||||| || || |||||||| || Sbjct: 1241 aaggctataccagccttagcatcaaagatactcgaccttgcatcgcctacaaaatcattc 1182 Query: 417 gaaacaacatcctcgtctgtgtagcctaaaatacccttaagcggaccttctgatgcttcc 476 ||||||||||| || || ||||| || | || || || || | ||||| ||||| || Sbjct: 1181 gaaacaacatcttcatcagtgtatccaaggatgccttttagtgacccttcagatgcggcc 1122 Query: 477 ttgatagctgctttcacatcttcatacgatgcgtttttctcaagccggcaggtcagatca 536 || || |||||||| | ||| || || ||||| ||||||||| || || |||||||| Sbjct: 1121 ttcattgctgcttttatatcatcgtaagatgctggtttctcaaggcgacatgtcagatcc 1062 Query: 537 acaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctttccatttaaa 596 ||||| || || || ||||| || || ||||| ||||| ||||| ||||||||||| || Sbjct: 1061 acaactgagacattgggtgttggtacacggaaagccattccagttagctttccattcaac 1002 Query: 597 gctggaagga 606 ||||||||| Sbjct: 1001 tctggaagga 992
>gb|AC158396.2| Mus musculus BAC clone RP23-255D19 from chromosome 14, complete sequence Length = 188538 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/74 (86%) Strand = Plus / Plus Query: 513 ttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggcc 572 ||||| || ||||| |||||||| || ||||| || || || |||||||| ||||||||| Sbjct: 77167 ttctccaggcggcacgtcagatccacgacggacacattgggggtaggaacacggaaggcc 77226 Query: 573 atgccagtgagctt 586 |||||||||||||| Sbjct: 77227 atgccagtgagctt 77240
>gb|AC125070.4| Mus musculus BAC clone RP23-443A7 from 13, complete sequence Length = 208344 Score = 67.9 bits (34), Expect = 4e-08 Identities = 55/62 (88%) Strand = Plus / Plus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 |||||||| || ||||| || || || |||||||| |||||||||||||||||||||||| Sbjct: 156043 gtcagatccacgacggacacattgggggtaggaacacggaaggccatgccagtgagcttt 156102 Query: 588 cc 589 || Sbjct: 156103 cc 156104
>gb|AC115508.5| Rattus norvegicus 2 BAC CH230-355B17 (Children's Hospital Oakland Research Institute) complete sequence Length = 209019 Score = 65.9 bits (33), Expect = 1e-07 Identities = 54/61 (88%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 |||||||| ||||||||||| || || |||||||| | ||||||||||||||||||||| Sbjct: 1039 gtcagatccacaacggatacattgggggtaggaacatgaaaggccatgccagtgagcttt 980 Query: 588 c 588 | Sbjct: 979 c 979
>gb|AY066007.1| Meriones unguiculatus glyceraldehyde-3-phosphate dehydrogenase mRNA, complete cds Length = 1265 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 ||||| |||||||| || || || ||||| || |||||||| |||||||||||||||||| Sbjct: 808 cggcatgtcagatccacgacagacacgttgggggtaggaactcggaaggccatgccagtg 749 Query: 582 agctt 586 ||||| Sbjct: 748 agctt 744 Score = 44.1 bits (22), Expect = 0.53 Identities = 37/42 (88%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||| |||| |||||||||||||| | |||||| Sbjct: 1031 gttgctgtagccgaactcattgtcataccaggaaatgagctt 990
>gb|AF421145.1| Fragaria x ananassa glyceraldehyde 3-phosphate dehydrogenase (GAPDH2) mRNA, partial cds Length = 399 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 366 ccagcattggcatcaaagatgcttgaccttgtgtcaccaacaaaatcgtttgaaacaaca 425 ||||| ||||||||||||||||||||||| ||||||||| || ||| |||| |||||| Sbjct: 362 ccagccttggcatcaaagatgcttgacctgttgtcaccaatgaagtcggttgacacaaca 303 Query: 426 tcctcgtctgtgtagcctaaaataccctt 454 || || || ||||| || || |||||||| Sbjct: 302 tcatcttcggtgtaacccaagataccctt 274
>ref|XM_843655.1| PREDICTED: Canis familiaris similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC607078), mRNA Length = 522 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||||||||||| ||||| || ||||| || || || || |||||||| Sbjct: 267 tttctccaggcggcaggtcagattcacaactgacacgttgggggtggggacacggaaggc 208 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 207 catgccagtgagcttcccatt 187
>ref|XM_848990.1| PREDICTED: Canis familiaris similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC611333), mRNA Length = 586 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || || ||||||||||| ||||| || || ||||| || || || |||||||| Sbjct: 231 tttctccaggcgacaggtcagatccacaactgacacattaggggtggggacacggaaggc 172 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 171 catgccagtgagcttcccatt 151
>ref|XR_003740.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC672182), mRNA Length = 1011 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| |||| |||||| ||||| |||||||| ||||||| Sbjct: 756 tttctccaggcggcatgtcagatccacaatggatacattaggggtaggaacatggaaggc 697 Query: 572 catgccagtgagctttccatt 592 ||||||||||||| ||||| Sbjct: 696 tgtgccagtgagcttcccatt 676
>emb|AJ938036.1| Lupinus albus mRNA for glyceraldehyde-3-phosphate-dehydrogenase (gapdh gene) Length = 1233 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 294 acacggttgctgtagccccactcgttgtcataccaggagacgagcttca 342 |||||| |||||||||||||||||||||||||||| || || ||||||| Sbjct: 891 acacgggtgctgtagccccactcgttgtcataccatgacacaagcttca 843 Score = 44.1 bits (22), Expect = 0.53 Identities = 31/34 (91%) Strand = Plus / Minus Query: 372 ttggcatcaaagatgcttgaccttgtgtcaccaa 405 ||||||||||| ||||||||||| ||||||||| Sbjct: 813 ttggcatcaaaaatgcttgacctgttgtcaccaa 780
>emb|X15596.1|ZMGPC1 Maize Gpc1 gene for glyceraldehyde-3-phosphate dehydrogenase (GADPH) subunit C Length = 5955 Score = 65.9 bits (33), Expect = 1e-07 Identities = 60/69 (86%) Strand = Plus / Minus Query: 272 catgtgcccgatcagatccaggacacggttgctgtagccccactcgttgtcataccagga 331 |||||| | |||||| || | ||| |||||||||||||||||||||||||| ||||| || Sbjct: 5477 catgtggcggatcaggtcgacgacgcggttgctgtagccccactcgttgtcgtaccacga 5418 Query: 332 gacgagctt 340 ||| ||||| Sbjct: 5417 gacaagctt 5409 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 555 gtaggaacccggaaggccatgccagtgagctttccatt 592 |||||||| ||||||| ||| ||||||||||| ||||| Sbjct: 4937 gtaggaacgcggaaggacataccagtgagcttgccatt 4900
>gb|AY654895.1| Spermophilus citellus glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, complete cds Length = 1123 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || || || || || || || |||||||| Sbjct: 755 tttctccaggcggcaggtcagatccacaactgacacattgggagtgggcacacggaaggc 696 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 695 catgccagtgagcttcccatt 675
>dbj|AB070217.1| Meriones unguiculatus GAPD mRNA for Glyceraldehyde-3-phosphate dehydrogenase, complete cds Length = 1278 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 ||||| |||||||| || || || ||||| || |||||||| |||||||||||||||||| Sbjct: 808 cggcatgtcagatccacgacagacacgttgggggtaggaactcggaaggccatgccagtg 749 Query: 582 agctt 586 ||||| Sbjct: 748 agctt 744 Score = 44.1 bits (22), Expect = 0.53 Identities = 37/42 (88%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||| |||| |||||||||||||| | |||||| Sbjct: 1031 gttgctgtagccgaactcattgtcataccaggaaatgagctt 990
>ref|NM_001009307.1| Felis catus glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA Length = 1002 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| || ||||| || || || || || || |||||||| Sbjct: 747 tttctccaggcggcaggtcagatccacgacggacacattgggggtggggacacggaaggc 688 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 687 catgccagtgagcttcccatt 667 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 297 cggttgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||||| | || |||||||||||||| | |||||| Sbjct: 962 cggttgctgtagccaaattcattgtcataccaggaaatgagctt 919
>ref|XM_223044.3| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC289349), mRNA Length = 1682 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 |||||||| |||| |||||| || || |||||||| | ||||||||||||||||||||| Sbjct: 1337 gtcagatccacaatggatacattgggggtaggaacacagaaggccatgccagtgagcttc 1278 Query: 588 ccatt 592 ||||| Sbjct: 1277 ccatt 1273
>ref|XM_213595.3| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC288039), mRNA Length = 1077 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagt 580 |||||||| ||||||||||| || || |||||||| ||||||||||||||||| Sbjct: 732 gtcagatccacaacggatacattgggcgtaggaacacggaaggccatgccagt 680
>ref|XM_575566.1| PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase (LOC500215), mRNA Length = 1356 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 ||||| |||||||| |||| |||||| | || |||||||| |||||||||||||||||| Sbjct: 1091 cggcatgtcagatccacaatggatacactgggagtaggaacacggaaggccatgccagtg 1032 Query: 582 agctt 586 ||||| Sbjct: 1031 agctt 1027
>ref|XM_226683.3| PREDICTED: Rattus norvegicus similar to EGF-like repeats and discordin I-like domains 3 (LOC310000), mRNA Length = 2865 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Plus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagcttt 587 |||||||| ||||||||||| || || |||| ||| |||||||||||||||||||| || Sbjct: 2135 gtcagatccacaacggatacattgggggtagaaacacggaaggccatgccagtgagtttc 2194 Query: 588 ccatt 592 ||||| Sbjct: 2195 ccatt 2199
>gb|U76741.1|CPU76741 Cavia porcellus glyceraldehyde 3-phosphate dehydrogenase mRNA, partial cds Length = 227 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || || |||||||| || || |||||||| Sbjct: 143 tttctccaggcggcaggtcagatccacaaccgacacattaggtgtgggtacacggaaggc 84 Query: 572 catgccagtgagctttccatt 592 ||| || |||||||| ||||| Sbjct: 83 catacctgtgagcttcccatt 63
>gb|AF076283.1|AF076283 Mustela vison 8-CTS2 glyceraldehyde 3-phosphate dehydrogenase mRNA, partial cds Length = 528 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || || || || || || || |||||||| Sbjct: 344 tttctccaggcggcaggtcagatccacaacagacacattgggggtggggacacggaaggc 285 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 284 catgccagtgagcttcccatt 264
>gb|AF141959.1|AF141959 Sus scrofa glyceraldehyde-3-phosphate dehydrogenase GAPDH (GAPDH) mRNA, partial cds Length = 573 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 |||||||||||||| ||||| || ||||| || || || || |||||||||||||||||| Sbjct: 572 cggcaggtcagatccacaaccgacacgttgggggtggggacacggaaggccatgccagtg 513 Query: 582 agctt 586 ||||| Sbjct: 512 agctt 508
>gb|U51572.1|CPU51572 Cavia porcellus glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, partial cds Length = 370 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || || |||||||| || || |||||||| Sbjct: 250 tttctccaggcggcaggtcagatccacaaccgacacattaggtgtgggtacacggaaggc 191 Query: 572 catgccagtgagctttccatt 592 ||| || |||||||| ||||| Sbjct: 190 catacctgtgagcttcccatt 170
>emb|AL929132.9| Mouse DNA sequence from clone RP23-346G8 on chromosome 2, complete sequence Length = 129438 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| |||| |||||| ||||| |||||||| ||||||| Sbjct: 48186 tttctccaggcggcatgtcagatccacaatggatacattaggggtaggaacatggaaggc 48127 Query: 572 catgccagtgagctttccatt 592 ||||||||||||| ||||| Sbjct: 48126 tgtgccagtgagcttcccatt 48106
>dbj|AB060340.1| Cavia porcellus mRNA for glyceraldehyde 3-phosphate dehydrogenase, partial cds Length = 973 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| ||||| || || |||||||| || || |||||||| Sbjct: 737 tttctccaggcggcaggtcagatccacaaccgacacattaggtgtgggtacacggaaggc 678 Query: 572 catgccagtgagctttccatt 592 ||| || |||||||| ||||| Sbjct: 677 catacctgtgagcttcccatt 657 Score = 44.1 bits (22), Expect = 0.53 Identities = 37/42 (88%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||| |||| ||||||||||| || |||||||| Sbjct: 950 gttgctgtagccgaactcattgtcataccaagaaacgagctt 909
>dbj|AB038241.1| Felis catus GAPDH mRNA for glyceraldehyde-3-phosphate dehydrogenase, complete cds Length = 1002 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || |||||||||||||| || ||||| || || || || || || |||||||| Sbjct: 747 tttctccaggcggcaggtcagatccacgacggacacattgggggtggggacacggaaggc 688 Query: 572 catgccagtgagctttccatt 592 ||||||||||||||| ||||| Sbjct: 687 catgccagtgagcttcccatt 667 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 297 cggttgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||||| | || |||||||||||||| | |||||| Sbjct: 962 cggttgctgtagccaaattcattgtcataccaggaaatgagctt 919
>gb|AC166827.2| Mus musculus BAC clone RP23-359M9 from chromosome 12, complete sequence Length = 219729 Score = 63.9 bits (32), Expect = 6e-07 Identities = 68/80 (85%) Strand = Plus / Plus Query: 507 gcgtttttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccgg 566 |||| |||||| || ||||| |||||||| ||||| || || || | |||||||| ||| Sbjct: 148113 gcgtgtttctccaggcggcacgtcagatccacaacagacacatttcgggtaggaacacgg 148172 Query: 567 aaggccatgccagtgagctt 586 |||||||||||||||||||| Sbjct: 148173 aaggccatgccagtgagctt 148192
>ref|XR_002864.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC634139), mRNA Length = 699 Score = 63.9 bits (32), Expect = 6e-07 Identities = 56/64 (87%) Strand = Plus / Minus Query: 523 ggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtga 582 |||| |||||||| ||||| ||||| || || |||||||| | ||||||||||||||||| Sbjct: 433 ggcatgtcagatccacaacagatacattgggggtaggaacaccgaaggccatgccagtga 374 Query: 583 gctt 586 |||| Sbjct: 373 gctt 370
>ref|XM_985296.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC622339), mRNA Length = 1225 Score = 63.9 bits (32), Expect = 6e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 507 gcgtttttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccgg 566 |||| |||||| || ||||| |||||||| ||||| || || || | |||||||| ||| Sbjct: 805 gcgtgtttctccaggcggcacgtcagatccacaacagacacatttcgggtaggaacacgg 746 Query: 567 aaggccatgccagtgagctt 586 |||||||||||||||||||| Sbjct: 745 aaggccatgccagtgagctt 726
>ref|XM_888028.2| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (LOC622339), mRNA Length = 1225 Score = 63.9 bits (32), Expect = 6e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 507 gcgtttttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccgg 566 |||| |||||| || ||||| |||||||| ||||| || || || | |||||||| ||| Sbjct: 805 gcgtgtttctccaggcggcacgtcagatccacaacagacacatttcgggtaggaacacgg 746 Query: 567 aaggccatgccagtgagctt 586 |||||||||||||||||||| Sbjct: 745 aaggccatgccagtgagctt 726
>gb|AC107864.10| Mus musculus chromosome 10, clone RP23-388A14, complete sequence Length = 207955 Score = 63.9 bits (32), Expect = 6e-07 Identities = 56/64 (87%) Strand = Plus / Minus Query: 523 ggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtga 582 |||| |||||||| || ||||| || || || |||||||| ||||||||||||||||||| Sbjct: 37317 ggcacgtcagatccacgacggacacattgggggtaggaacacggaaggccatgccagtga 37258 Query: 583 gctt 586 |||| Sbjct: 37257 gctt 37254
>gb|AY292373.1| Isochrysis galbana glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene, partial cds Length = 963 Score = 63.9 bits (32), Expect = 6e-07 Identities = 35/36 (97%) Strand = Plus / Minus Query: 305 gtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||||||||||||||| ||||||||||| Sbjct: 960 gtagccccactcgttgtcataccacgagacgagctt 925
>emb|X62824.1|PAGPD P.anserina gpd gene for glyceraldehyde-3-phosphate dehydrogenase Length = 3198 Score = 63.9 bits (32), Expect = 6e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 301 tgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||||||||||||| ||||||||||| ||||| Sbjct: 2932 tgctgtagccccactcgttgtcgtaccaggagacaagctt 2893
>gb|AC116574.6| Mus musculus BAC clone RP23-234F20 from chromosome 12, complete sequence Length = 191808 Score = 63.9 bits (32), Expect = 6e-07 Identities = 68/80 (85%) Strand = Plus / Plus Query: 507 gcgtttttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccgg 566 |||| |||||| || ||||| |||||||| ||||| || || || | |||||||| ||| Sbjct: 75553 gcgtgtttctccaggcggcacgtcagatccacaacagacacatttcgggtaggaacacgg 75612 Query: 567 aaggccatgccagtgagctt 586 |||||||||||||||||||| Sbjct: 75613 aaggccatgccagtgagctt 75632
>gb|AC153961.2| Mus musculus 10 BAC RP24-330I16 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 159792 Score = 63.9 bits (32), Expect = 6e-07 Identities = 56/64 (87%) Strand = Plus / Minus Query: 523 ggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtga 582 |||| |||||||| || ||||| || || || |||||||| ||||||||||||||||||| Sbjct: 118248 ggcacgtcagatccacgacggacacattgggggtaggaacacggaaggccatgccagtga 118189 Query: 583 gctt 586 |||| Sbjct: 118188 gctt 118185
>gb|BT024142.1| Zea mays clone EL01N0441H10 mRNA sequence Length = 1302 Score = 63.9 bits (32), Expect = 6e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 293 gacacggttgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||||||||||||||||||| | |||| ||||||||||| Sbjct: 1053 gacacggttgctgtagccccactcgttggcggaccacgagacgagctt 1006 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 555 gtaggaacccggaaggccatgccagtgagctttccatt 592 |||||||| ||||||| ||| ||||||||||| ||||| Sbjct: 791 gtaggaacacggaaggacataccagtgagcttgccatt 754
>gb|AC006341.2|F3O9 Arabidopsis thaliana chromosome 1 BAC F3O9 sequence, complete sequence Length = 114498 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 303 ctgtagccccactcgttgtcataccaggagacgagcttcatgaaagatgaacttagaccc 362 ||||| ||||| |||||||||||||||||||| || |||||||| || |||| || Sbjct: 32267 ctgtaaccccattcgttgtcataccaggagacaagtttcatgaaggacttgcttaatcca 32208 Query: 363 ataccagcattggcatcaaagatgcttgacct 394 || |||||||| ||||||||||| |||||||| Sbjct: 32207 atcccagcattagcatcaaagatacttgacct 32176
>emb|BX284690.3| Mouse DNA sequence from clone RP24-422L8 on chromosome X, complete sequence Length = 87350 Score = 63.9 bits (32), Expect = 6e-07 Identities = 56/64 (87%) Strand = Plus / Plus Query: 523 ggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtga 582 |||| |||||||| ||||| ||||| || || |||||||| | ||||||||||||||||| Sbjct: 76215 ggcatgtcagatccacaacagatacattgggggtaggaacaccgaaggccatgccagtga 76274 Query: 583 gctt 586 |||| Sbjct: 76275 gctt 76278
>gb|U40032.1|CPU40032 Guillardia theta glyceraldehyde-3-phosphate dehydrogenase precursor (GapC1) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1236 Score = 63.9 bits (32), Expect = 6e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 293 gacacggttgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||| ||| |||||||||||||||||||||| ||||||||| Sbjct: 1121 gacacggttggagtatccccactcgttgtcataccaggcgacgagctt 1074 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 564 cggaaggccatgccagtgagctt 586 ||||||||||||||||||||||| Sbjct: 850 cggaaggccatgccagtgagctt 828
>gb|AF043486.1|AF043486 Sus scrofa glycerine aldehyde 3-phosphate dehydrogenase (GAPDH) mRNA, partial cds Length = 399 Score = 63.9 bits (32), Expect = 6e-07 Identities = 65/75 (86%), Gaps = 2/75 (2%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || |||||||| || ||| |||||| |||||||| Sbjct: 302 tttctccaggcggcatgtcagatccaccacggatacattgggt--aggaacacggaaggc 245 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 244 catgccagtgagctt 230
>gb|U10983.1|MAU10983 Mesocricetus auratus glyceraldehyde-3-phosphate dehydrogenase (g3pdh) mRNA, partial cds Length = 936 Score = 63.9 bits (32), Expect = 6e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 531 agatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 ||||| || ||||| ||||| || |||||||| ||||||||||||||||||||||| Sbjct: 698 agatccacgacggacacgttgggggtaggaacacggaaggccatgccagtgagctt 643 Score = 44.1 bits (22), Expect = 0.53 Identities = 37/42 (88%) Strand = Plus / Minus Query: 299 gttgctgtagccccactcgttgtcataccaggagacgagctt 340 |||||||||||| | || |||||||||||||||| |||||| Sbjct: 930 gttgctgtagccgaattcattgtcataccaggagatgagctt 889
>gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, complete sequence Length = 171669 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 522 cggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtg 581 ||||| |||||||| |||| |||||| ||||| ||| |||| ||||||||||||||||| Sbjct: 68649 cggcatgtcagatccacaatggatacattaggggtaagaacatggaaggccatgccagtg 68708 Query: 582 agctttccatt 592 | ||| ||||| Sbjct: 68709 atcttcccatt 68719
>gb|AC165304.8| Mus musculus chromosome 1, clone RP23-138D5, complete sequence Length = 204924 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 |||||||| || ||||| || || || |||||||| ||||||||||||||||||||||| Sbjct: 167186 gtcagatccacgacggacacattgggggtaggaacacggaaggccatgccagtgagctt 167128
>gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, complete sequence Length = 192819 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 |||||||| || ||||| || || || |||||||| ||||||||||||||||||||||| Sbjct: 69333 gtcagatccacgacggacacattgggggtaggaacacggaaggccatgccagtgagctt 69391
>gb|AC170187.2| Mus musculus BAC clone RP23-320B10 from chromosome 19, complete sequence Length = 192550 Score = 61.9 bits (31), Expect = 2e-06 Identities = 64/75 (85%) Strand = Plus / Minus Query: 512 tttctcaagccggcaggtcagatcaacaacggatacgttaggtgtaggaacccggaaggc 571 |||||| || ||||| |||||||| || |||| || || || |||||||| |||||||| Sbjct: 107773 tttctccaggcggcacgtcagatccacggcggacacattgggggtaggaacacggaaggc 107714 Query: 572 catgccagtgagctt 586 ||||||||||||||| Sbjct: 107713 catgccagtgagctt 107699
>gb|AC147251.3| Mus musculus BAC clone RP24-114L16 from chromosome 18, complete sequence Length = 177962 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 528 gtcagatcaacaacggatacgttaggtgtaggaacccggaaggccatgccagtgagctt 586 |||||||| || |||||||| || || |||||||| |||||||||||| |||||||||| Sbjct: 161577 gtcagatctactacggatacattgggggtaggaacacggaaggccatgtcagtgagctt 161519 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,093,807 Number of Sequences: 3902068 Number of extensions: 5093807 Number of successful extensions: 82751 Number of sequences better than 10.0: 1789 Number of HSP's better than 10.0 without gapping: 1779 Number of HSP's successfully gapped in prelim test: 12 Number of HSP's that attempted gapping in prelim test: 78012 Number of HSP's gapped (non-prelim): 4720 length of query: 606 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 583 effective length of database: 17,143,297,704 effective search space: 9994542561432 effective search space used: 9994542561432 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
