ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags10h17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_191752.1| Oryza sativa (japonica cultivar-group), predic... 204 3e-49
2dbj|AK065152.1| Oryza sativa (japonica cultivar-group) cDNA clon... 204 3e-49
3gb|AY107009.1| Zea mays PCO139185 mRNA sequence 174 2e-40
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
5dbj|AP003288.3| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
6dbj|AP003408.3| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
7gb|AY939871.1| Actinidia chinensis plastid alpha-amylase (AMY3) ... 58 4e-05
8gb|AC084243.7| Homo sapiens chromosome 11, clone CTD-3224I3, com... 46 0.14
9gb|AC099304.6| Rattus norvegicus 2 BAC CH230-149H21 (Children's ... 44 0.57
10gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome 42 2.3
11gb|U66061.1| Human germline T-cell receptor beta chain TCRBV17S1... 42 2.3
12gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome 42 2.3
13gb|AC147068.3| Pan troglodytes BAC clone RP43-165E11 from 7, com... 42 2.3
14ref|NG_001333.1| Homo sapiens T cell receptor beta locus (TRB@) ... 42 2.3
15gb|AC146089.2| Pan troglodytes BAC clone RP43-47D18 from 7, comp... 42 2.3
16gb|AC146433.3| Pan troglodytes BAC clone RP43-19C19 from 7, comp... 42 2.3
17gb|AF029308.1|HTCRBCHR9 Homo sapiens chromosome 9 duplication of... 42 2.3
18emb|AL356489.14| Human DNA sequence from clone RP11-384P7 on chr... 42 2.3
19gb|AC091770.5| Homo sapiens BAC clone RP11-655M5 from 7, complet... 42 2.3
20gb|AF491780.1| Homo sapiens neuregulin 1 (NRG1) gene, partial cd... 42 2.3
21emb|AL139008.10| Human DNA sequence from clone RP11-255A11 on ch... 42 2.3
22emb|AL023913.6|HS1068F16 Human DNA sequence from clone RP5-1068F... 42 2.3
23emb|BX324172.22| Zebrafish DNA sequence from clone DKEYP-86D6 in... 42 2.3
24ref|NG_001337.1| Homo sapiens T cell receptor beta variable orph... 42 2.3
25gb|AC022833.5| Homo sapiens chromosome , clone RP11-147C21, comp... 42 2.3
26tpg|BK000383.1| TPA: TPA_exp: Homo sapiens neuregulin 1 isoform ... 42 2.3
27gb|AC009362.8|AC009362 Homo sapiens chromosome 7 clone RP11-256C... 42 2.3
28gb|AC116384.9| Mus musculus chromosome 3, clone RP23-20L19, comp... 40 8.9
29gb|AC150687.3| Bos taurus BAC CH240-243M2 (Children's Hospital ... 40 8.9
30gb|AC149774.2| Bos taurus BAC CH240-10G15 (Children's Hospital ... 40 8.9
31gb|AC158704.3| Microcebus murinus clone CH257-434D18, complete s... 40 8.9
32gb|AC146263.2| Pan troglodytes BAC clone RP43-28O1 from 7, compl... 40 8.9
33gb|AC147343.2| Pan troglodytes BAC clone CH251-14P15 from Y, com... 40 8.9
34gb|AC147117.2| Pan troglodytes BAC clone CH251-532B3 from Y, com... 40 8.9
35gb|AC110563.4| Mus musculus chromosome 3, clone RP23-287O4, comp... 40 8.9
36gb|AC098592.5| Homo sapiens BAC clone RP11-403N12 from 7, comple... 40 8.9
37gb|AC006148.3| Homo sapiens PAC clone RP5-902E20 from 7, complet... 40 8.9
38gb|AC146057.2| Pan troglodytes BAC clone RP43-90E18 from 7, comp... 40 8.9
39emb|Z99129.1|HS425C14 Human DNA sequence from clone RP3-425C14 o... 40 8.9
40emb|AL646087.8| Human DNA sequence from clone RP11-412K4 on chro... 40 8.9
41emb|AL592466.9| Human DNA sequence from clone RP11-428G2 on chro... 40 8.9
42emb|AL592227.4| Human DNA sequence from clone RP11-32D4 on chrom... 40 8.9
43emb|AL450472.14| Human DNA sequence from clone RP11-265D19 on ch... 40 8.9
44emb|AL359979.10| Human DNA sequence from clone RP11-239E10 on ch... 40 8.9
45emb|AL359771.27| Human DNA sequence from clone CTA-520D8 on chro... 40 8.9
46emb|AL355586.27| Human DNA sequence from clone RP11-59I9 on chro... 40 8.9
47emb|AL355303.16| Human DNA sequence from clone RP11-445P17 on ch... 40 8.9
48emb|AL356534.12| Human DNA sequence from clone RP11-629P13 on ch... 40 8.9
49emb|AL355516.12| Human DNA sequence from clone RP11-442J17 on ch... 40 8.9
50emb|AL355607.10| Human DNA sequence from clone RP11-367F23 on ch... 40 8.9
51emb|AL162596.30| Human DNA sequence from clone RP1-13P20 on chro... 40 8.9
52gb|AC105275.3| Homo sapiens chromosome 1 clone RP11-359E8, compl... 40 8.9
53emb|AL158218.11| Human DNA sequence from clone RP5-831K15 on chr... 40 8.9
54emb|AL157828.14| Human DNA sequence from clone RP11-214I20 on ch... 40 8.9
55gb|AC090571.5| Homo sapiens chromosome 8, clone RP11-313J18, com... 40 8.9
56gb|AC105180.8| Homo sapiens chromosome 8, clone RP11-345J1, comp... 40 8.9
57gb|AC068446.22| Homo sapiens chromosome 15, clone RP11-32B5, com... 40 8.9
58emb|AL033530.1|HS629A15 Human DNA sequence from clone RP4-629A15... 40 8.9
59gb|AC021580.9| Homo sapiens chromosome 9, clone RP11-1091N2, com... 40 8.9
60gb|AC118463.2| Homo sapiens chromosome 5 clone RP11-60F22, compl... 40 8.9
61dbj|BS000666.1| Pan troglodytes chromosome Y clone:PTBY-003G06, ... 40 8.9
62gb|AC092924.7| Homo sapiens 3 BAC RP11-788A4 (Roswell Park Cance... 40 8.9
63gb|AC073655.26| Homo sapiens 12 BAC RP11-1105G2 (Roswell Park Ca... 40 8.9
64gb|DQ397866.1| Cenarchaeum symbiosum clone C03F10, complete sequ... 40 8.9
65gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 8.9
66dbj|AK128197.1| Homo sapiens cDNA FLJ46325 fis, clone TESTI4043371 40 8.9
67gb|AC142095.9| Medicago truncatula clone mth2-14c17, complete se... 40 8.9
68gb|AC099785.2| Homo sapiens chromosome 1 clone RP11-435I3, compl... 40 8.9
69gb|AC108116.2| Homo sapiens chromosome 5 clone RP11-318B23, comp... 40 8.9
70gb|AC008400.5| Homo sapiens chromosome 5 clone CTC-264D2, comple... 40 8.9
71gb|AC107877.4| Homo sapiens chromosome 8, clone RP11-74P9, compl... 40 8.9
72gb|AC010242.7| Homo sapiens chromosome 5 clone CTC-359E10, compl... 40 8.9
73gb|AC067854.14| Homo sapiens chromosome 8, clone RP11-513H8, com... 40 8.9
74gb|AC112183.3| Homo sapiens chromosome 5 clone RP11-152F4, compl... 40 8.9
75gb|AC074132.5| Homo sapiens chromosome 5 clone CTD-2266L18, comp... 40 8.9
76gb|AC107992.3| Homo sapiens chromosome 15, clone RP11-150L8, com... 40 8.9
77gb|AC087240.17| Homo sapiens 12p BAC RP11-752F20 (Roswell Park C... 40 8.9
78gb|AC078983.17| Homo sapiens 12q BAC RP11-473M14 (Roswell Park C... 40 8.9
79gb|AC008133.7| Homo sapiens chromosome 17, clone RP11-40A13, com... 40 8.9
80gb|AC091829.2| Homo sapiens chromosome 5 clone CTD-2021O22, comp... 40 8.9
81gb|AF238375.3| Homo sapiens chromosome 21 clone BAC 49B5 map 21q... 40 8.9
82gb|AC090919.6| Homo sapiens chromosome 8, clone RP11-42C24, comp... 40 8.9
83gb|AC011092.4| Homo sapiens, clone RP11-1H15, complete sequence 40 8.9
84gb|AC008703.6| Homo sapiens chromosome 5 clone CTB-76P12, comple... 40 8.9
85gb|AC090200.4| Homo sapiens chromosome 8, clone RP11-628E19, com... 40 8.9
86ref|XM_939565.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 8.9
87ref|XM_937797.1| PREDICTED: Homo sapiens similar to SET domain a... 40 8.9
88ref|XM_928538.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 8.9
89ref|XM_928074.1| PREDICTED: Homo sapiens similar to SET domain a... 40 8.9
90gb|AC025898.10| Homo sapiens chromosome 17, clone RP11-421O15, c... 40 8.9
91gb|AC021914.7| Homo sapiens chromosome 11, clone RP11-68C8, comp... 40 8.9
92gb|DP000004.1| Lemur catta target 1 genomic scaffold 40 8.9
93gb|AC008816.8| Homo sapiens chromosome 5 clone CTD-2122K17, comp... 40 8.9
94gb|AC008571.6| Homo sapiens chromosome 5 clone CTC-550M4, comple... 40 8.9
95gb|AC017093.3|AC017093 Homo sapiens BAC clone RP11-511G7 from 5,... 40 8.9
96gb|AC022740.4|AC022740 Homo sapiens chromosome 15, clone RP11-61... 40 8.9
97gb|AC034215.4|AC034215 Homo sapiens chromosome 5 clone CTD-2001K... 40 8.9
98gb|AC126425.2| Lemur catta, clone -162D1, complete sequence 40 8.9
99gb|AC131599.2| Lemur catta, clone -206F2, complete sequence 40 8.9
100gb|AC080007.26| Homo sapiens 3 BAC RP11-529F4 (Roswell Park Canc... 40 8.9
101gb|AC137875.13| Mus musculus chromosome 15, clone RP23-62B15, co... 40 8.9
102gb|AC093721.3| Homo sapiens BAC clone CTD-2010B10 from 4, comple... 40 8.9
103gb|AC104596.4| Homo sapiens BAC clone RP11-54P19 from 4, complet... 40 8.9
104gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold 40 8.9
105gb|AC010105.12| Homo sapiens BAC clone RP11-563E24 from 2, compl... 40 8.9
106gb|AC020941.5| Homo sapiens chromosome 5 clone CTD-2312I9, compl... 40 8.9
107gb|AC078824.13| Homo sapiens 12 BAC RP11-542B15 (Roswell Park Ca... 40 8.9
108gb|AC136352.10| Homo sapiens chromosome 15, clone RP11-116P24, c... 40 8.9
109gb|AC012414.12| Homo sapiens chromosome 15, clone RP11-403B2, co... 40 8.9
110gb|AC020553.4|AC020553 Homo sapiens BAC clone RP11-462D9 from 8,... 40 8.9
111gb|AC009483.3|AC009483 Homo sapiens BAC clone RP11-303H5 from 2,... 40 8.9
112gb|AC073062.7| Homo sapiens BAC clone RP11-132H1 from 2, complet... 40 8.9
113gb|AC078988.18| Homo sapiens X BAC RP11-169J21 (Roswell Park Can... 40 8.9
114gb|AC004819.2| Homo sapiens PAC clone RP1-15I23 from 22, complet... 40 8.9
115gb|AC104035.6| Homo sapiens chromosome 15, clone RP11-661P17, co... 40 8.9
116gb|AC123971.3| Lemur catta clone LB2-255J23, complete sequence 40 8.9
117gb|AC026355.13| Homo sapiens 3 BAC RP11-114M1 (Roswell Park Canc... 40 8.9
118gb|AC012443.8| Homo sapiens BAC clone RP11-17G11 from 2, complet... 40 8.9
119gb|AC012353.6| Homo sapiens BAC clone RP11-82P18 from 2, complet... 40 8.9
120gb|AC008408.5|AC008408 Homo sapiens chromosome 5 clone CTC-278H1... 40 8.9
121gb|AC011422.2|AC011422 Homo sapiens chromosome 5 clone CTD-2335E... 40 8.9
122gb|AC008967.3|AC008967 Homo sapiens chromosome 5 clone CTD-2367A... 40 8.9
123dbj|BS000222.1| Pan troglodytes chromosome 22 clone:RP43-111J12,... 40 8.9
124dbj|BS000057.1| Pan troglodytes chromosome 22 clone:RP43-020J03,... 40 8.9
125dbj|AK130778.1| Homo sapiens cDNA FLJ27268 fis, clone TMS00396 40 8.9
126gb|AC004993.1|AC004993 Homo sapiens PAC clone RP5-1194E14 from 7... 40 8.9
127emb|AL163246.2|HS21C046 Homo sapiens chromosome 21 segment HS21C046 40 8.9
128gb|AC007198.6|AC007198 Homo sapiens, clone 18_A_13, complete seq... 40 8.9
129emb|AL096821.3|CNS00YVG Human chromosome 14 DNA sequence BAC R-6... 40 8.9
130emb|AL132719.4|CNS01DTH Human chromosome 14 DNA sequence BAC R-1... 40 8.9
131emb|AL357095.4|CNS05TDU Human chromosome 14 DNA sequence BAC R-4... 40 8.9
132dbj|AP001677.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 8.9
133gb|AC003106.1|AC003106 Homo sapiens Xp22 GS-524I1 (Genome System... 40 8.9
134dbj|AP004710.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 8.9
135dbj|AP005364.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 8.9
136gb|AC004677.1|AC004677 Homo Sapiens Chromosome X clone bWXD501, ... 40 8.9
137dbj|AP005242.2| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 8.9
138gb|DP000022.1| Microcebus murinus target 1 genomic scaffold 40 8.9
139emb|AJ006995.1|HSF18108 Homo sapiens chromosome 21 PAC LLNLP704F... 40 8.9
140dbj|AP001256.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 8.9

>ref|NM_191752.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2721

 Score =  204 bits (103), Expect = 3e-49
 Identities = 269/325 (82%)
 Strand = Plus / Minus

                                                                        
Query: 312  cttcccagatcttgtaatcatgtccctctgctgcaacaatccagtttatgggaccgcttg 371
            ||||||||| ||||||||| |||||||| || ||||| | ||||||| |||| |||||||
Sbjct: 2710 cttcccagaccttgtaatcctgtccctcggcagcaactacccagtttgtggggccgcttg 2651

                                                                        
Query: 372  gttcaaaatgtccgctgccgatcttcatcattagattctcattaatctgggcggcataca 431
            | |||||||||||   ||| ||||||||  |||   |||||| |||||  || ||||| |
Sbjct: 2650 gctcaaaatgtcctgcgccaatcttcattgttaccctctcatcaatctctgccgcatata 2591

                                                                        
Query: 432  aattctgttctgccttgattatcttgatcttgctgcggcactgaatctttaggcgctgtc 491
            ||||    ||||| || | ||||||||||||||| ||||| || |||||| |||| | ||
Sbjct: 2590 aatttccctctgctttcagtatcttgatcttgctacggcaatggatcttttggcgatttc 2531

                                                                        
Query: 492  tgatagaaatcaatttggcaatatcttgntgtaagtgtgagaagatgtgatcatagaaga 551
            | |||||||| ||||| ||||| ||| | ||||| || || || || |||||||||||||
Sbjct: 2530 taatagaaattaatttagcaatctctggctgtaaatgcgaaaatatatgatcatagaaga 2471

                                                                        
Query: 552  ctgcaggagtgccaggatgcgtcaagatatagacatagccttgcatctccataccatagg 611
             |||||||||||| || || || ||||| |||||||||||||||| |||||||||| |||
Sbjct: 2470 ttgcaggagtgcctgggtgagttaagatgtagacatagccttgcaactccataccaaagg 2411

                                     
Query: 612  ggaatctccaatgaccctgantaga 636
            |||||||||||||||||||| ||||
Sbjct: 2410 ggaatctccaatgaccctgagtaga 2386



to top

>dbj|AK065152.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002B10, full
            insert sequence
          Length = 4179

 Score =  204 bits (103), Expect = 3e-49
 Identities = 269/325 (82%)
 Strand = Plus / Minus

                                                                        
Query: 312  cttcccagatcttgtaatcatgtccctctgctgcaacaatccagtttatgggaccgcttg 371
            ||||||||| ||||||||| |||||||| || ||||| | ||||||| |||| |||||||
Sbjct: 3789 cttcccagaccttgtaatcctgtccctcggcagcaactacccagtttgtggggccgcttg 3730

                                                                        
Query: 372  gttcaaaatgtccgctgccgatcttcatcattagattctcattaatctgggcggcataca 431
            | |||||||||||   ||| ||||||||  |||   |||||| |||||  || ||||| |
Sbjct: 3729 gctcaaaatgtcctgcgccaatcttcattgttaccctctcatcaatctctgccgcatata 3670

                                                                        
Query: 432  aattctgttctgccttgattatcttgatcttgctgcggcactgaatctttaggcgctgtc 491
            ||||    ||||| || | ||||||||||||||| ||||| || |||||| |||| | ||
Sbjct: 3669 aatttccctctgctttcagtatcttgatcttgctacggcaatggatcttttggcgatttc 3610

                                                                        
Query: 492  tgatagaaatcaatttggcaatatcttgntgtaagtgtgagaagatgtgatcatagaaga 551
            | |||||||| ||||| ||||| ||| | ||||| || || || || |||||||||||||
Sbjct: 3609 taatagaaattaatttagcaatctctggctgtaaatgcgaaaatatatgatcatagaaga 3550

                                                                        
Query: 552  ctgcaggagtgccaggatgcgtcaagatatagacatagccttgcatctccataccatagg 611
             |||||||||||| || || || ||||| |||||||||||||||| |||||||||| |||
Sbjct: 3549 ttgcaggagtgcctgggtgagttaagatgtagacatagccttgcaactccataccaaagg 3490

                                     
Query: 612  ggaatctccaatgaccctgantaga 636
            |||||||||||||||||||| ||||
Sbjct: 3489 ggaatctccaatgaccctgagtaga 3465



to top

>gb|AY107009.1| Zea mays PCO139185 mRNA sequence
          Length = 971

 Score =  174 bits (88), Expect = 2e-40
 Identities = 266/326 (81%)
 Strand = Plus / Minus

                                                                       
Query: 311 gcttcccagatcttgtaatcatgtccctctgctgcaacaatccagtttatgggaccgctt 370
           ||||||||||| |||||||| || ||||| || ||||||||||||||   ||||||||||
Sbjct: 621 gcttcccagattttgtaatcttgaccctcagcagcaacaatccagttctggggaccgctt 562

                                                                       
Query: 371 ggttcaaaatgtccgctgccgatcttcatcattagattctcattaatctgggcggcatac 430
           || ||||||||| |    ||||| |||||  |||  ||||||| ||| |  || ||||| 
Sbjct: 561 ggctcaaaatgttctgatccgattttcattgttaccttctcatcaatttcagccgcatat 502

                                                                       
Query: 431 aaattctgttctgccttgattatcttgatcttgctgcggcactgaatctttaggcgctgt 490
           ||| ||   |||||||| | ||||||||||||||||||||| ||||||||| | || |||
Sbjct: 501 aaactcctctctgcctttagtatcttgatcttgctgcggcaatgaatcttttgacggtgt 442

                                                                       
Query: 491 ctgatagaaatcaatttggcaatatcttgntgtaagtgtgagaagatgtgatcatagaag 550
           |  || ||||| ||||| || || ||| | ||||||||||| || ||||| |||||||||
Sbjct: 441 cgaatggaaataaatttagcgatctctggttgtaagtgtgaaaatatgtggtcatagaag 382

                                                                       
Query: 551 actgcaggagtgccaggatgcgtcaagatatagacatagccttgcatctccataccatag 610
           ||||| ||||||||||| || |||| ||| ||| | || |||||||  ||||||||||||
Sbjct: 381 actgcgggagtgccagggtgtgtcaggatgtaggcgtatccttgcagttccataccatag 322

                                     
Query: 611 gggaatctccaatgaccctgantaga 636
           ||||| |||||||| |||||| ||||
Sbjct: 321 gggaacctccaatggccctgagtaga 296



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  141 bits (71), Expect = 3e-30
 Identities = 145/170 (85%)
 Strand = Plus / Minus

                                                                            
Query: 460      cttgctgcggcactgaatctttaggcgctgtctgatagaaatcaatttggcaatatcttg 519
                |||||| ||||| || |||||| |||| | ||| |||||||| ||||| ||||| ||| |
Sbjct: 29762638 cttgctacggcaatggatcttttggcgatttctaatagaaattaatttagcaatctctgg 29762579

                                                                            
Query: 520      ntgtaagtgtgagaagatgtgatcatagaagactgcaggagtgccaggatgcgtcaagat 579
                 ||||| || || || || ||||||||||||| |||||||||||| || || || |||||
Sbjct: 29762578 ctgtaaatgcgaaaatatatgatcatagaagattgcaggagtgcctgggtgagttaagat 29762519

                                                                  
Query: 580      atagacatagccttgcatctccataccataggggaatctccaatgaccct 629
                 |||||||||||||||| |||||||||| |||||||||||||||||||||
Sbjct: 29762518 gtagacatagccttgcaactccataccaaaggggaatctccaatgaccct 29762469



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                            
Query: 312      cttcccagatcttgtaatcatgtccctctgctgcaacaatccagtttatgggaccgcttg 371
                ||||||||| ||||||||| |||||||| || ||||| | ||||||| |||| |||||||
Sbjct: 29762888 cttcccagaccttgtaatcctgtccctcggcagcaactacccagtttgtggggccgcttg 29762829

                             
Query: 372      gttcaaaatgtcc 384
                | |||||||||||
Sbjct: 29762828 gctcaaaatgtcc 29762816



to top

>dbj|AP003288.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0683B11
          Length = 155955

 Score =  141 bits (71), Expect = 3e-30
 Identities = 145/170 (85%)
 Strand = Plus / Minus

                                                                        
Query: 460  cttgctgcggcactgaatctttaggcgctgtctgatagaaatcaatttggcaatatcttg 519
            |||||| ||||| || |||||| |||| | ||| |||||||| ||||| ||||| ||| |
Sbjct: 6733 cttgctacggcaatggatcttttggcgatttctaatagaaattaatttagcaatctctgg 6674

                                                                        
Query: 520  ntgtaagtgtgagaagatgtgatcatagaagactgcaggagtgccaggatgcgtcaagat 579
             ||||| || || || || ||||||||||||| |||||||||||| || || || |||||
Sbjct: 6673 ctgtaaatgcgaaaatatatgatcatagaagattgcaggagtgcctgggtgagttaagat 6614

                                                              
Query: 580  atagacatagccttgcatctccataccataggggaatctccaatgaccct 629
             |||||||||||||||| |||||||||| |||||||||||||||||||||
Sbjct: 6613 gtagacatagccttgcaactccataccaaaggggaatctccaatgaccct 6564



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 312  cttcccagatcttgtaatcatgtccctctgctgcaacaatccagtttatgggaccgcttg 371
            ||||||||| ||||||||| |||||||| || ||||| | ||||||| |||| |||||||
Sbjct: 6983 cttcccagaccttgtaatcctgtccctcggcagcaactacccagtttgtggggccgcttg 6924

                         
Query: 372  gttcaaaatgtcc 384
            | |||||||||||
Sbjct: 6923 gctcaaaatgtcc 6911



to top

>dbj|AP003408.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1131B07
          Length = 109135

 Score =  141 bits (71), Expect = 3e-30
 Identities = 145/170 (85%)
 Strand = Plus / Minus

                                                                         
Query: 460   cttgctgcggcactgaatctttaggcgctgtctgatagaaatcaatttggcaatatcttg 519
             |||||| ||||| || |||||| |||| | ||| |||||||| ||||| ||||| ||| |
Sbjct: 92369 cttgctacggcaatggatcttttggcgatttctaatagaaattaatttagcaatctctgg 92310

                                                                         
Query: 520   ntgtaagtgtgagaagatgtgatcatagaagactgcaggagtgccaggatgcgtcaagat 579
              ||||| || || || || ||||||||||||| |||||||||||| || || || |||||
Sbjct: 92309 ctgtaaatgcgaaaatatatgatcatagaagattgcaggagtgcctgggtgagttaagat 92250

                                                               
Query: 580   atagacatagccttgcatctccataccataggggaatctccaatgaccct 629
              |||||||||||||||| |||||||||| |||||||||||||||||||||
Sbjct: 92249 gtagacatagccttgcaactccataccaaaggggaatctccaatgaccct 92200



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                         
Query: 312   cttcccagatcttgtaatcatgtccctctgctgcaacaatccagtttatgggaccgcttg 371
             ||||||||| ||||||||| |||||||| || ||||| | ||||||| |||| |||||||
Sbjct: 92619 cttcccagaccttgtaatcctgtccctcggcagcaactacccagtttgtggggccgcttg 92560

                          
Query: 372   gttcaaaatgtcc 384
             | |||||||||||
Sbjct: 92559 gctcaaaatgtcc 92547



to top

>gb|AY939871.1| Actinidia chinensis plastid alpha-amylase (AMY3) mRNA, complete cds;
            nuclear gene for plastid product
          Length = 3334

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 94/115 (81%), Gaps = 1/115 (0%)
 Strand = Plus / Minus

                                                                        
Query: 538  gtgatcatagaagactgcaggagtgccaggatgcgtcaagatatagacatagccttgcat 597
            |||||||||||| ||||| || || || ||||| |||| ||| ||  |||| ||||||||
Sbjct: 2479 gtgatcatagaaaactgctggtgttccgggatgagtcaggatgtatgcatacccttgcat 2420

                                                                   
Query: 598  ctccataccataggggaatctccaatgaccctgantagagcccggngtcatgatt 652
            |||| | |||   || |||||||||||||||||| |||| ||| | |||||||||
Sbjct: 2419 ctcctttccacctggaaatctccaatgaccctgagtaga-cccagtgtcatgatt 2366



to top

>gb|AC084243.7| Homo sapiens chromosome 11, clone CTD-3224I3, complete sequence
          Length = 154201

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 495   tagaaatcaatttggcaatatct 517
             |||||||||||||||||||||||
Sbjct: 71699 tagaaatcaatttggcaatatct 71721



to top

>gb|AC099304.6| Rattus norvegicus 2 BAC CH230-149H21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 220543

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 336   cctctgctgcaacaatccagtt 357
             ||||||||||||||||||||||
Sbjct: 93142 cctctgctgcaacaatccagtt 93163



to top

>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome
          Length = 4222334

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 376    aaaatgtccgctgccgatctt 396
              |||||||||||||||||||||
Sbjct: 354635 aaaatgtccgctgccgatctt 354655



to top

>gb|U66061.1| Human germline T-cell receptor beta chain TCRBV17S1A1T, TCRBV2S1,
             TCRBV10S1P, TCRBV29S1P, TCRBV19S1P, TCRBV15S1,
             TCRBV11S1A1T, HVB relic, TCRBV28S1P, TCRBV34S1, TCRBV14S1,
             TCRBV3S1, TCRBV4S1A1T, TRY4, TRY5, TRY6, TRY7, TRY8,
             TCRBD1, TCRBJ1S1, TCRBJ1S2, TCRBJ1S3, TCRBJ1S4, TCRBJ1S5,
             TCRBJ1S6, TCRBC1, TCRBD2, TCRBJ2S1, TCRBJ2S2, TCRBJ2S3,
             TCRBJ2S4, TCRBJ2S5, TCRBJ2S6, TCRBJ2S7, TCRBC2,
             TCRBV20S1A1N2 genes from bases 452324 to 684973 (section 3
             of 3)
          Length = 232650

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 174   tgcagggaaaatgcttccactgcca 198
             |||||||||||||||||||| ||||
Sbjct: 44971 tgcagggaaaatgcttccacagcca 44995



to top

>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome
          Length = 4222645

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 376    aaaatgtccgctgccgatctt 396
              |||||||||||||||||||||
Sbjct: 354446 aaaatgtccgctgccgatctt 354466



to top

>gb|AC147068.3| Pan troglodytes BAC clone RP43-165E11 from 7, complete sequence
          Length = 177119

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 327   aatcatgtccctctgctgcaacaat 351
             |||||||||||||||| ||||||||
Sbjct: 88489 aatcatgtccctctgcagcaacaat 88465



to top

>ref|NG_001333.1| Homo sapiens T cell receptor beta locus (TRB@) on chromosome 7
          Length = 684973

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 174    tgcagggaaaatgcttccactgcca 198
              |||||||||||||||||||| ||||
Sbjct: 497294 tgcagggaaaatgcttccacagcca 497318



to top

>gb|AC146089.2| Pan troglodytes BAC clone RP43-47D18 from 7, complete sequence
          Length = 178573

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 327    aatcatgtccctctgctgcaacaat 351
              |||||||||||||||| ||||||||
Sbjct: 163246 aatcatgtccctctgcagcaacaat 163270



to top

>gb|AC146433.3| Pan troglodytes BAC clone RP43-19C19 from 7, complete sequence
          Length = 180951

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 174   tgcagggaaaatgcttccactgcca 198
             |||||||||||||||||||| ||||
Sbjct: 44935 tgcagggaaaatgcttccacagcca 44959



to top

>gb|AF029308.1|HTCRBCHR9 Homo sapiens chromosome 9 duplication of the T cell receptor beta locus
             and trypsinogen gene families
          Length = 216293

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 174   tgcagggaaaatgcttccactgcca 198
             |||||||||||||||||||| ||||
Sbjct: 48681 tgcagggaaaatgcttccacagcca 48705



to top

>emb|AL356489.14| Human DNA sequence from clone RP11-384P7 on chromosome 9 Contains
           the TRBV25OR9-2 gene for T cell receptor beta variable
           25/OR9-2, the PTENP1 gene for phosphatase and tensin
           homolog (mutated in multiple advanced cancers 1)
           pseudogene 1 (PTH2, PTEN2, PSIPTEN), a T-cell receptor
           beta chain V region protein pseudogene, two novel genes,
           the 5' end of the PRSS3 gene for serine protease 3
           (mesotrypsin) and two CpG islands, complete sequence
          Length = 130639

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 174 tgcagggaaaatgcttccactgcca 198
           |||||||||||||||||||| ||||
Sbjct: 36  tgcagggaaaatgcttccacagcca 60



to top

>gb|AC091770.5| Homo sapiens BAC clone RP11-655M5 from 7, complete sequence
          Length = 93543

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 174  tgcagggaaaatgcttccactgcca 198
            |||||||||||||||||||| ||||
Sbjct: 4432 tgcagggaaaatgcttccacagcca 4456



to top

>gb|AF491780.1| Homo sapiens neuregulin 1 (NRG1) gene, partial cds, alternatively spliced
          Length = 1285452

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 173    ctgcagggaaaatgcttccac 193
              |||||||||||||||||||||
Sbjct: 463807 ctgcagggaaaatgcttccac 463827



to top

>emb|AL139008.10| Human DNA sequence from clone RP11-255A11 on chromosome 9 Contains four
              novel genes, the gene for a novel protein similar to
              suppressor of G2 allele of SKP1 homolog, the gene for a
              novel protein similar to KIAA1074, a melanoma antigen
              pseudogene, a sorting nexin 18 (SNX18) pseudogene, a
              trypsin domain pseudogene, two genes for novel
              immunoglobulin domain containing proteins, the gene for a
              novel protein similar to annexin A2 (ANXA2), the gene for a
              novel protein similar to T-cell receptor beta chain V
              region proteins, a T-cell receptor beta chain V region
              protein LB2 pseudogene and two CpG islands, complete
              sequence
          Length = 159974

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 174    tgcagggaaaatgcttccactgcca 198
              |||||||||||||||||||| ||||
Sbjct: 159910 tgcagggaaaatgcttccacagcca 159934



to top

>emb|AL023913.6|HS1068F16 Human DNA sequence from clone RP5-1068F16 on chromosome 20p12 Contains
              the 3' end of the SNAP25 gene for 25kDa
              synaptosomal-associated protein, the RPL23AP6 gene for
              ribosomal protein L23a pseudogene 6, part of a novel gene
              and a hypoxia induced gene 1 (HIG1) pseudogene, complete
              sequence
          Length = 140306

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 174    tgcagggaaaatgcttccact 194
              |||||||||||||||||||||
Sbjct: 137937 tgcagggaaaatgcttccact 137957



to top

>emb|BX324172.22| Zebrafish DNA sequence from clone DKEYP-86D6 in linkage group 13,
             complete sequence
          Length = 184555

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 218   gcaccagcagtggctaagtta 238
             |||||||||||||||||||||
Sbjct: 71644 gcaccagcagtggctaagtta 71624



to top

>ref|NG_001337.1| Homo sapiens T cell receptor beta variable orphans on chromosome 9
             (TRBVOR9@) on chromosome 9
          Length = 194564

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 174   tgcagggaaaatgcttccactgcca 198
             |||||||||||||||||||| ||||
Sbjct: 48636 tgcagggaaaatgcttccacagcca 48660



to top

>gb|AC022833.5| Homo sapiens chromosome , clone RP11-147C21, complete sequence
          Length = 177019

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 173    ctgcagggaaaatgcttccac 193
              |||||||||||||||||||||
Sbjct: 157363 ctgcagggaaaatgcttccac 157343



to top

>tpg|BK000383.1| TPA: TPA_exp: Homo sapiens neuregulin 1 isoform (NRG1) gene,
              alternatively spliced, complete cds
          Length = 1421559

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 173    ctgcagggaaaatgcttccac 193
              |||||||||||||||||||||
Sbjct: 463807 ctgcagggaaaatgcttccac 463827



to top

>gb|AC009362.8|AC009362 Homo sapiens chromosome 7 clone RP11-256C6, complete sequence
          Length = 160156

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 327    aatcatgtccctctgctgcaacaat 351
              |||||||||||||||| ||||||||
Sbjct: 131792 aatcatgtccctctgcagcaacaat 131768



to top

>gb|AC116384.9| Mus musculus chromosome 3, clone RP23-20L19, complete sequence
          Length = 203580

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 545    tagaagactgcaggagtgccagga 568
              |||||||||| |||||||||||||
Sbjct: 180546 tagaagactggaggagtgccagga 180523



to top

>gb|AC150687.3| Bos taurus  BAC CH240-243M2 (Children's Hospital Oakland Research
            Institute Bovine BAC Library (male)) complete sequence
          Length = 144223

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 174  tgcagggaaaatgcttccac 193
            ||||||||||||||||||||
Sbjct: 1391 tgcagggaaaatgcttccac 1372



to top

>gb|AC149774.2| Bos taurus  BAC CH240-10G15 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 186916

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 15944 tgcagggaaaatgcttccac 15963



to top

>gb|AC158704.3| Microcebus murinus clone CH257-434D18, complete sequence
          Length = 257333

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 28851 tgcagggaaaatgcttccac 28870



to top

>gb|AC146263.2| Pan troglodytes BAC clone RP43-28O1 from 7, complete sequence
          Length = 141252

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 91865 tgcagggaaaatgcttccac 91884



to top

>gb|AC147343.2| Pan troglodytes BAC clone CH251-14P15 from Y, complete sequence
          Length = 277007

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 116249 tgcagggaaaatgcttccac 116230



to top

>gb|AC147117.2| Pan troglodytes BAC clone CH251-532B3 from Y, complete sequence
          Length = 207020

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 64490 tgcagggaaaatgcttccac 64509



to top

>gb|AC110563.4| Mus musculus chromosome 3, clone RP23-287O4, complete sequence
          Length = 237878

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 545    tagaagactgcaggagtgccagga 568
              |||||||||| |||||||||||||
Sbjct: 215217 tagaagactggaggagtgccagga 215240



to top

>gb|AC098592.5| Homo sapiens BAC clone RP11-403N12 from 7, complete sequence
          Length = 190672

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 98358 tgcagggaaaatgcttccac 98377



to top

>gb|AC006148.3| Homo sapiens PAC clone RP5-902E20 from 7, complete sequence
          Length = 121110

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 107808 tgcagggaaaatgcttccac 107789



to top

>gb|AC146057.2| Pan troglodytes BAC clone RP43-90E18 from 7, complete sequence
          Length = 210447

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 108581 tgcagggaaaatgcttccac 108562



to top

>emb|Z99129.1|HS425C14 Human DNA sequence from clone RP3-425C14 on chromosome 6q22 Contains the
              3' end of the HSF2 gene for  Heat Shock Transcription
              Factor 2 and the 3' end of a novel gene for KIAA1253
              protein (similar to tumor differentially expressed TDE1),
              complete sequence
          Length = 160203

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 118130 tgcagggaaaatgcttccac 118111



to top

>emb|AL646087.8| Human DNA sequence from clone RP11-412K4 on chromosome 13 Contians
            the 3' end of the gene for osteoblast specific factor 2
            (fasciclin I-like) (OSF-2), complete sequence
          Length = 42319

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 174  tgcagggaaaatgcttccac 193
            ||||||||||||||||||||
Sbjct: 3858 tgcagggaaaatgcttccac 3839



to top

>emb|AL592466.9| Human DNA sequence from clone RP11-428G2 on chromosome 10 Contains a
             novel gene, complete sequence
          Length = 113271

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 82182 tgcagggaaaatgcttccac 82163



to top

>emb|AL592227.4| Human DNA sequence from clone RP11-32D4 on chromosome 9 Contains a CpG
             island, complete sequence
          Length = 55535

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 14928 tgcagggaaaatgcttccac 14909



to top

>emb|AL450472.14| Human DNA sequence from clone RP11-265D19 on chromosome X Contains the 5'
              end of the ZNF75 gene for zinc finger protein 75 (D8C6),
              gene FLJ23614, two novel genes, the 5' end of a novel gene,
              a novel pseudogene and four CpG islands, complete sequence
          Length = 177877

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 140166 tgcagggaaaatgcttccac 140147



to top

>emb|AL359979.10| Human DNA sequence from clone RP11-239E10 on chromosome 1 Contains the
             5' end of the TLR5 gene for toll-like receptor 5, two
             novel genes, the gene for a novel protein (FLJ10052) and a
             CpG island, complete sequence
          Length = 181466

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 70905 tgcagggaaaatgcttccac 70886



to top

>emb|AL359771.27| Human DNA sequence from clone CTA-520D8 on chromosome 1 Contains the 3'
             end of the gene for lung type-I cell membrane-associated
             glycoprotein (T1A-2), a novel gene, the 5' end of the
             PRDM2 gene for PR domain containing 2 with ZNF domain and
             a CpG island, complete sequence
          Length = 111182

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 38345 tgcagggaaaatgcttccac 38326



to top

>emb|AL355586.27| Human DNA sequence from clone RP11-59I9 on chromosome 6q16.3-21
             Contains two novel genes, the 3' end of the C6orf210 gene
             for chromosome 6 open reading frame 210 and three CpG
             islands, complete sequence
          Length = 185311

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 21766 tgcagggaaaatgcttccac 21785



to top

>emb|AL355303.16| Human DNA sequence from clone RP11-445P17 on chromosome 10 Contains the
             5' end of the gene for a novel protein similar to
             aldo-keto reductase, the AKR1C4 gene for aldo-keto
             reductase family 1 member C4, a novel gene, an aldo-keto
             reductase pseudogene, a ribosomal protein L26 (RPL26)
             pseudogene, an ADP-ribosylation factor-like 4 (ARL4)
             pseudogene,. a novel gene and a CpG island, complete
             sequence
          Length = 145692

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 81035 tgcagggaaaatgcttccac 81054



to top

>emb|AL356534.12| Human DNA sequence from clone RP11-629P13 on chromosome 6, complete
              sequence
          Length = 175757

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 156700 tgcagggaaaatgcttccac 156681



to top

>emb|AL355516.12| Human DNA sequence from clone RP11-442J17 on chromosome 13 Contains a
            KIAA0254 gene product pseudogene, two novel genes, a PHD
            finger protein 2 (PHF2) (GRC5) pseudogene and a CpG
            island, complete sequence
          Length = 93925

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 174  tgcagggaaaatgcttccac 193
            ||||||||||||||||||||
Sbjct: 1558 tgcagggaaaatgcttccac 1577



to top

>emb|AL355607.10| Human DNA sequence from clone RP11-367F23 on chromosome 9 Contains a
             novel gene, complete sequence
          Length = 113308

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 11584 tgcagggaaaatgcttccac 11565



to top

>emb|AL162596.30| Human DNA sequence from clone RP1-13P20 on chromosome 1q21.1-21.3
             Contains the SPRL2A gene for small proline rich-like
             (epidermal differentiation complex) 2A, the LEP1 gene for
             late envelope protein 1, a novel gene, the MCSP gene for
             mitochondrial capsule selenoprotein and the IVL gene for
             involucrin, complete sequence
          Length = 116067

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 88382 tgcagggaaaatgcttccac 88363



to top

>gb|AC105275.3| Homo sapiens chromosome 1 clone RP11-359E8, complete sequence
          Length = 164736

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 94321 tgcagggaaaatgcttccac 94340



to top

>emb|AL158218.11| Human DNA sequence from clone RP5-831K15 on chromosome 1p31.1-31.3
             Contains a ribosomal protein L7 (RPL7) pseudogene,
             complete sequence
          Length = 103186

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 33182 tgcagggaaaatgcttccac 33163



to top

>emb|AL157828.14| Human DNA sequence from clone RP11-214I20 on chromosome 9p22.3-24
             Contains the 5' end of a novel gene and the 3' end of a
             novel gene (FLJ38505 FLJ90271), complete sequence
          Length = 100927

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 46281 tgcagggaaaatgcttccac 46262



to top

>gb|AC090571.5| Homo sapiens chromosome 8, clone RP11-313J18, complete sequence
          Length = 218627

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 154971 tgcagggaaaatgcttccac 154990



to top

>gb|AC105180.8| Homo sapiens chromosome 8, clone RP11-345J1, complete sequence
          Length = 174617

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 171195 tgcagggaaaatgcttccac 171214



to top

>gb|AC068446.22| Homo sapiens chromosome 15, clone RP11-32B5, complete sequence
          Length = 158465

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 88567 tgcagggaaaatgcttccac 88548



to top

>emb|AL033530.1|HS629A15 Human DNA sequence from clone RP4-629A15 on chromosome 1p31.1-31.3
             Contains EST, complete sequence
          Length = 93643

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 11217 tgcagggaaaatgcttccac 11236



to top

>gb|AC021580.9| Homo sapiens chromosome 9, clone RP11-1091N2, complete sequence
          Length = 210557

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 63338 tgcagggaaaatgcttccac 63319



to top

>gb|AC118463.2| Homo sapiens chromosome 5 clone RP11-60F22, complete sequence
          Length = 98082

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 239   gccactccattctgatgcca 258
             ||||||||||||||||||||
Sbjct: 23217 gccactccattctgatgcca 23198



to top

>dbj|BS000666.1| Pan troglodytes chromosome Y clone:PTBY-003G06, complete sequences
          Length = 102559

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 51643 tgcagggaaaatgcttccac 51662



to top

>gb|AC092924.7| Homo sapiens 3 BAC RP11-788A4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 155417

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 58241 tgcagggaaaatgcttccac 58260



to top

>gb|AC073655.26| Homo sapiens 12 BAC RP11-1105G2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 188105

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 107906 tgcagggaaaatgcttccac 107925



to top

>gb|DQ397866.1| Cenarchaeum symbiosum clone C03F10, complete sequence
          Length = 41278

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 291   gcgacaaagtctagggcgtt 310
             ||||||||||||||||||||
Sbjct: 29425 gcgacaaagtctagggcgtt 29406



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 185268 tgcagggaaaatgcttccac 185249



to top

>dbj|AK128197.1| Homo sapiens cDNA FLJ46325 fis, clone TESTI4043371
          Length = 4250

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 174  tgcagggaaaatgcttccac 193
            ||||||||||||||||||||
Sbjct: 2498 tgcagggaaaatgcttccac 2479



to top

>gb|AC142095.9| Medicago truncatula clone mth2-14c17, complete sequence
          Length = 110037

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 428   tacaaattctgttctgcctt 447
             ||||||||||||||||||||
Sbjct: 87375 tacaaattctgttctgcctt 87394



to top

>gb|AC099785.2| Homo sapiens chromosome 1 clone RP11-435I3, complete sequence
          Length = 186160

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 495   tagaaatcaatttggcaatatctt 518
             |||||| |||||||||||||||||
Sbjct: 88263 tagaaagcaatttggcaatatctt 88240



to top

>gb|AC108116.2| Homo sapiens chromosome 5 clone RP11-318B23, complete sequence
          Length = 203171

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 72615 tgcagggaaaatgcttccac 72634



to top

>gb|AC008400.5| Homo sapiens chromosome 5 clone CTC-264D2, complete sequence
          Length = 117409

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 59071 tgcagggaaaatgcttccac 59052



to top

>gb|AC107877.4| Homo sapiens chromosome 8, clone RP11-74P9, complete sequence
          Length = 181925

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 128002 tgcagggaaaatgcttccac 127983



to top

>gb|AC010242.7| Homo sapiens chromosome 5 clone CTC-359E10, complete sequence
          Length = 174293

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 107145 tgcagggaaaatgcttccac 107164



to top

>gb|AC067854.14| Homo sapiens chromosome 8, clone RP11-513H8, complete sequence
          Length = 203982

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 53897 tgcagggaaaatgcttccac 53916



to top

>gb|AC112183.3| Homo sapiens chromosome 5 clone RP11-152F4, complete sequence
          Length = 163612

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 115424 tgcagggaaaatgcttccac 115443



to top

>gb|AC074132.5| Homo sapiens chromosome 5 clone CTD-2266L18, complete sequence
          Length = 118131

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 30980 tgcagggaaaatgcttccac 30961



to top

>gb|AC107992.3| Homo sapiens chromosome 15, clone RP11-150L8, complete sequence
          Length = 149015

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 174  tgcagggaaaatgcttccac 193
            ||||||||||||||||||||
Sbjct: 8398 tgcagggaaaatgcttccac 8379



to top

>gb|AC087240.17| Homo sapiens 12p BAC RP11-752F20 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 198068

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 23148 tgcagggaaaatgcttccac 23129



to top

>gb|AC078983.17| Homo sapiens 12q BAC RP11-473M14 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 163613

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 36621 tgcagggaaaatgcttccac 36602



to top

>gb|AC008133.7| Homo sapiens chromosome 17, clone RP11-40A13, complete sequence
          Length = 179744

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 119924 tgcagggaaaatgcttccac 119943



to top

>gb|AC091829.2| Homo sapiens chromosome 5 clone CTD-2021O22, complete sequence
          Length = 92702

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 81424 tgcagggaaaatgcttccac 81443



to top

>gb|AF238375.3| Homo sapiens chromosome 21 clone BAC 49B5 map 21q21, complete sequence
          Length = 166124

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 148785 tgcagggaaaatgcttccac 148804



to top

>gb|AC090919.6| Homo sapiens chromosome 8, clone RP11-42C24, complete sequence
          Length = 184897

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 111893 tgcagggaaaatgcttccac 111874



to top

>gb|AC011092.4| Homo sapiens, clone RP11-1H15, complete sequence
          Length = 192318

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 128427 tgcagggaaaatgcttccac 128408



to top

>gb|AC008703.6| Homo sapiens chromosome 5 clone CTB-76P12, complete sequence
          Length = 214187

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 203044 tgcagggaaaatgcttccac 203025



to top

>gb|AC090200.4| Homo sapiens chromosome 8, clone RP11-628E19, complete sequence
          Length = 149955

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 76926 tgcagggaaaatgcttccac 76945



to top

>ref|XM_939565.1| PREDICTED: Homo sapiens hypothetical protein LOC648469 (LOC648469),
           mRNA
          Length = 2415

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 174 tgcagggaaaatgcttccac 193
           ||||||||||||||||||||
Sbjct: 186 tgcagggaaaatgcttccac 167



to top

>ref|XM_937797.1| PREDICTED: Homo sapiens similar to SET domain and mariner
           transposase fusion gene (LOC648711), mRNA
          Length = 1014

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 174 tgcagggaaaatgcttccac 193
           ||||||||||||||||||||
Sbjct: 422 tgcagggaaaatgcttccac 441



to top

>ref|XM_928538.1| PREDICTED: Homo sapiens hypothetical protein LOC643608 (LOC643608),
           mRNA
          Length = 2415

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 174 tgcagggaaaatgcttccac 193
           ||||||||||||||||||||
Sbjct: 186 tgcagggaaaatgcttccac 167



to top

>ref|XM_928074.1| PREDICTED: Homo sapiens similar to SET domain and mariner
           transposase fusion gene (LOC645012), mRNA
          Length = 1014

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 174 tgcagggaaaatgcttccac 193
           ||||||||||||||||||||
Sbjct: 422 tgcagggaaaatgcttccac 441



to top

>gb|AC025898.10| Homo sapiens chromosome 17, clone RP11-421O15, complete sequence
          Length = 184875

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 21142 tgcagggaaaatgcttccac 21161



to top

>gb|AC021914.7| Homo sapiens chromosome 11, clone RP11-68C8, complete sequence
          Length = 156507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   tacatataatttgacttcag 161
             ||||||||||||||||||||
Sbjct: 17979 tacatataatttgacttcag 17998



to top

>gb|DP000004.1| Lemur catta target 1 genomic scaffold
          Length = 1399362

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 174     tgcagggaaaatgcttccac 193
               ||||||||||||||||||||
Sbjct: 1254121 tgcagggaaaatgcttccac 1254140



to top

>gb|AC008816.8| Homo sapiens chromosome 5 clone CTD-2122K17, complete sequence
          Length = 174293

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 107145 tgcagggaaaatgcttccac 107164



to top

>gb|AC008571.6| Homo sapiens chromosome 5 clone CTC-550M4, complete sequence
          Length = 214267

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 209242 tgcagggaaaatgcttccac 209223



to top

>gb|AC017093.3|AC017093 Homo sapiens BAC clone RP11-511G7 from 5, complete sequence
          Length = 203043

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 169482 tgcagggaaaatgcttccac 169501



to top

>gb|AC022740.4|AC022740 Homo sapiens chromosome 15, clone RP11-617D22, complete sequence
          Length = 162482

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 46642 tgcagggaaaatgcttccac 46623



to top

>gb|AC034215.4|AC034215 Homo sapiens chromosome 5 clone CTD-2001K4, complete sequence
          Length = 142116

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 174  tgcagggaaaatgcttccac 193
            ||||||||||||||||||||
Sbjct: 3607 tgcagggaaaatgcttccac 3626



to top

>gb|AC126425.2| Lemur catta, clone -162D1, complete sequence
          Length = 154718

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 114482 tgcagggaaaatgcttccac 114501



to top

>gb|AC131599.2| Lemur catta, clone -206F2, complete sequence
          Length = 155606

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 174  tgcagggaaaatgcttccac 193
            ||||||||||||||||||||
Sbjct: 3255 tgcagggaaaatgcttccac 3236



to top

>gb|AC080007.26| Homo sapiens 3 BAC RP11-529F4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 168551

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 58052 tgcagggaaaatgcttccac 58071



to top

>gb|AC137875.13| Mus musculus chromosome 15, clone RP23-62B15, complete sequence
          Length = 195956

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 111   tttgcagtagatacaaaaat 130
             ||||||||||||||||||||
Sbjct: 20478 tttgcagtagatacaaaaat 20459



to top

>gb|AC093721.3| Homo sapiens BAC clone CTD-2010B10 from 4, complete sequence
          Length = 128148

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 37908 tgcagggaaaatgcttccac 37927



to top

>gb|AC104596.4| Homo sapiens BAC clone RP11-54P19 from 4, complete sequence
          Length = 168591

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 25586 tgcagggaaaatgcttccac 25567



to top

>gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold
          Length = 1570569

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 174     tgcagggaaaatgcttccac 193
               ||||||||||||||||||||
Sbjct: 1323682 tgcagggaaaatgcttccac 1323701



to top

>gb|AC010105.12| Homo sapiens BAC clone RP11-563E24 from 2, complete sequence
          Length = 193320

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 107584 tgcagggaaaatgcttccac 107603



to top

>gb|AC020941.5| Homo sapiens chromosome 5 clone CTD-2312I9, complete sequence
          Length = 171317

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 120213 tgcagggaaaatgcttccac 120194



to top

>gb|AC078824.13| Homo sapiens 12 BAC RP11-542B15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 173697

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 148751 tgcagggaaaatgcttccac 148732



to top

>gb|AC136352.10| Homo sapiens chromosome 15, clone RP11-116P24, complete sequence
          Length = 177255

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 138137 tgcagggaaaatgcttccac 138118



to top

>gb|AC012414.12| Homo sapiens chromosome 15, clone RP11-403B2, complete sequence
          Length = 162400

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 149208 tgcagggaaaatgcttccac 149189



to top

>gb|AC020553.4|AC020553 Homo sapiens BAC clone RP11-462D9 from 8, complete sequence
          Length = 160811

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 73004 tgcagggaaaatgcttccac 73023



to top

>gb|AC009483.3|AC009483 Homo sapiens BAC clone RP11-303H5 from 2, complete sequence
          Length = 206589

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 174  tgcagggaaaatgcttccac 193
            ||||||||||||||||||||
Sbjct: 5353 tgcagggaaaatgcttccac 5372



to top

>gb|AC073062.7| Homo sapiens BAC clone RP11-132H1 from 2, complete sequence
          Length = 135822

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 37884 tgcagggaaaatgcttccac 37865



to top

>gb|AC078988.18| Homo sapiens X BAC RP11-169J21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 169849

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 95358 tgcagggaaaatgcttccac 95377



to top

>gb|AC004819.2| Homo sapiens PAC clone RP1-15I23 from 22, complete sequence
          Length = 59113

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 34773 tgcagggaaaatgcttccac 34754



to top

>gb|AC104035.6| Homo sapiens chromosome 15, clone RP11-661P17, complete sequence
          Length = 200370

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 159246 tgcagggaaaatgcttccac 159227



to top

>gb|AC123971.3| Lemur catta clone LB2-255J23, complete sequence
          Length = 222919

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 77678 tgcagggaaaatgcttccac 77697



to top

>gb|AC026355.13| Homo sapiens 3 BAC RP11-114M1 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 157439

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 143760 tgcagggaaaatgcttccac 143741



to top

>gb|AC012443.8| Homo sapiens BAC clone RP11-17G11 from 2, complete sequence
          Length = 153610

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 109280 tgcagggaaaatgcttccac 109261



to top

>gb|AC012353.6| Homo sapiens BAC clone RP11-82P18 from 2, complete sequence
          Length = 203755

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 346    aacaatccagtttatgggac 365
              ||||||||||||||||||||
Sbjct: 173925 aacaatccagtttatgggac 173906



to top

>gb|AC008408.5|AC008408 Homo sapiens chromosome 5 clone CTC-278H1, complete sequence
          Length = 78877

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 174  tgcagggaaaatgcttccac 193
            ||||||||||||||||||||
Sbjct: 5798 tgcagggaaaatgcttccac 5817



to top

>gb|AC011422.2|AC011422 Homo sapiens chromosome 5 clone CTD-2335E17, complete sequence
          Length = 119668

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 174 tgcagggaaaatgcttccac 193
           ||||||||||||||||||||
Sbjct: 326 tgcagggaaaatgcttccac 345



to top

>gb|AC008967.3|AC008967 Homo sapiens chromosome 5 clone CTD-2367A17, complete sequence
          Length = 88958

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 29431 tgcagggaaaatgcttccac 29412



to top

>dbj|BS000222.1| Pan troglodytes chromosome 22 clone:RP43-111J12, map 22, complete
              sequences
          Length = 189474

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 172749 tgcagggaaaatgcttccac 172730



to top

>dbj|BS000057.1| Pan troglodytes chromosome 22 clone:RP43-020J03, map 22, complete
              sequences
          Length = 185342

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 144268 tgcagggaaaatgcttccac 144287



to top

>dbj|AK130778.1| Homo sapiens cDNA FLJ27268 fis, clone TMS00396
          Length = 2199

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 174 tgcagggaaaatgcttccac 193
           ||||||||||||||||||||
Sbjct: 191 tgcagggaaaatgcttccac 172



to top

>gb|AC004993.1|AC004993 Homo sapiens PAC clone RP5-1194E14 from 7p21, complete sequence
          Length = 161453

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 70266 tgcagggaaaatgcttccac 70247



to top

>emb|AL163246.2|HS21C046 Homo sapiens chromosome 21 segment HS21C046
          Length = 340000

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 26399 tgcagggaaaatgcttccac 26380



to top

>gb|AC007198.6|AC007198 Homo sapiens, clone 18_A_13, complete sequence
          Length = 166977

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 81535 tgcagggaaaatgcttccac 81554



to top

>emb|AL096821.3|CNS00YVG Human chromosome 14 DNA sequence BAC R-677J5 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 209111

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 14070 tgcagggaaaatgcttccac 14051



to top

>emb|AL132719.4|CNS01DTH Human chromosome 14 DNA sequence BAC R-1082A3 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 171505

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 165627 tgcagggaaaatgcttccac 165608



to top

>emb|AL357095.4|CNS05TDU Human chromosome 14 DNA sequence BAC R-48D2 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181805

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 96785 tgcagggaaaatgcttccac 96766



to top

>dbj|AP001677.1| Homo sapiens genomic DNA, chromosome 21q, section 21/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 336355 tgcagggaaaatgcttccac 336374



to top

>gb|AC003106.1|AC003106 Homo sapiens Xp22 GS-524I1 (Genome Systems Human BAC library), complete
             sequence
          Length = 128888

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 36111 tgcagggaaaatgcttccac 36092



to top

>dbj|AP004710.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1429D6, complete
            sequence
          Length = 179115

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 174  tgcagggaaaatgcttccac 193
            ||||||||||||||||||||
Sbjct: 1381 tgcagggaaaatgcttccac 1362



to top

>dbj|AP005364.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1970D8, complete
              sequence
          Length = 168850

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 149608 tgcagggaaaatgcttccac 149589



to top

>gb|AC004677.1|AC004677 Homo Sapiens Chromosome X clone bWXD501, complete sequence
          Length = 128559

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    tgcagggaaaatgcttccac 193
              ||||||||||||||||||||
Sbjct: 123287 tgcagggaaaatgcttccac 123268



to top

>dbj|AP005242.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-805F19, complete
             sequence
          Length = 196360

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 97843 tgcagggaaaatgcttccac 97862



to top

>gb|DP000022.1| Microcebus murinus target 1 genomic scaffold
          Length = 1595145

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 174     tgcagggaaaatgcttccac 193
               ||||||||||||||||||||
Sbjct: 1342303 tgcagggaaaatgcttccac 1342322



to top

>emb|AJ006995.1|HSF18108 Homo sapiens chromosome 21 PAC LLNLP704F18108Q13, complete sequence
          Length = 152383

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 23439 tgcagggaaaatgcttccac 23420



to top

>dbj|AP001256.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:B732H1,
             LL56-APP region, complete sequence
          Length = 204699

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   tgcagggaaaatgcttccac 193
             ||||||||||||||||||||
Sbjct: 80775 tgcagggaaaatgcttccac 80794


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,121,980
Number of Sequences: 3902068
Number of extensions: 5121980
Number of successful extensions: 93216
Number of sequences better than 10.0: 141
Number of HSP's better than 10.0 without gapping: 141
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92793
Number of HSP's gapped (non-prelim): 422
length of query: 652
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 629
effective length of database: 17,143,297,704
effective search space: 10783134255816
effective search space used: 10783134255816
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top