ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags10g20 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC007374.6|AC007374 Homo sapiens chromosome 14 clone RP11-325L17 map 14q31, complete sequence Length = 190565 Score = 42.1 bits (21), Expect = 0.28 Identities = 23/24 (95%) Strand = Plus / Minus Query: 13 cattccttgacccancccaaaact 36 |||||||||||||| ||||||||| Sbjct: 133361 cattccttgacccaccccaaaact 133338
>emb|AL121784.5|CNS01DSH Human chromosome 14 DNA sequence BAC R-305I3 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 180523 Score = 42.1 bits (21), Expect = 0.28 Identities = 23/24 (95%) Strand = Plus / Minus Query: 13 cattccttgacccancccaaaact 36 |||||||||||||| ||||||||| Sbjct: 110880 cattccttgacccaccccaaaact 110857
>gb|AY153760.1| Agrostis stolonifera var. palustris chloroplast low molecular weight heat shock protein HSP26.8 gene, complete cds; nuclear gene for chloroplast product Length = 3098 Score = 40.1 bits (20), Expect = 1.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 44 caaaattggctaccgcaattttgg 67 |||||||||||||| ||||||||| Sbjct: 2815 caaaattggctacctcaattttgg 2838
>gb|AY153759.1| Agrostis stolonifera var. palustris chloroplast low molecular weight heat shock protein HSP26.2m gene, complete cds; nuclear gene for chloroplast product Length = 2922 Score = 40.1 bits (20), Expect = 1.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 44 caaaattggctaccgcaattttgg 67 |||||||||||||| ||||||||| Sbjct: 2787 caaaattggctacctcaattttgg 2810
>gb|AY153758.1| Agrostis stolonifera var. palustris chloroplast low molecular weight heat shock protein HSP26.2 gene, complete cds; nuclear gene for chloroplast product Length = 3064 Score = 40.1 bits (20), Expect = 1.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 44 caaaattggctaccgcaattttgg 67 |||||||||||||| ||||||||| Sbjct: 2784 caaaattggctacctcaattttgg 2807
>gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, complete sequence Length = 170236 Score = 38.2 bits (19), Expect = 4.3 Identities = 24/26 (92%) Strand = Plus / Minus Query: 11 atcattccttgacccancccaaaact 36 |||| ||||||||||| ||||||||| Sbjct: 111352 atcaatccttgacccaccccaaaact 111327 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 305,134 Number of Sequences: 3902068 Number of extensions: 305134 Number of successful extensions: 13615 Number of sequences better than 10.0: 6 Number of HSP's better than 10.0 without gapping: 6 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 13607 Number of HSP's gapped (non-prelim): 8 length of query: 98 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 77 effective length of database: 17,151,101,840 effective search space: 1320634841680 effective search space used: 1320634841680 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
