ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags10f21 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_470417.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1725 Score = 172 bits (87), Expect = 9e-40 Identities = 252/307 (82%) Strand = Plus / Minus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatcttagc 396 ||||||| |||||||||||||| || ||||| ||||||||||||||||||||||| | Sbjct: 1412 actttggaaacaactccggcaccaactgtcctccctccttccctcagcgcaaatctctgg 1353 Query: 397 cctggttcgagtggaacaggcaacatcaactcaaagattgcggttacgttgtcaccaggc 456 ||||| || || |||||||| | ||||||||||| ||| ||||| || ||||||||| Sbjct: 1352 cctggctcaaggggaacaggtgatatcaactcaaatcctgcagttacattatcaccaggc 1293 Query: 457 ataaccatcttcacatccggaggcaactcgattttcccacagatatcagctgtcctgaag 516 |||||||| | ||| | ||| ||| | | ||| ||| || ||| || ||||| ||| Sbjct: 1292 ataaccatttccacgccatcaggtaacacaacttttccagtgacatcggcagtcctaaag 1233 Query: 517 tagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtctttggtg 576 |||||||| || |||||||| || |||||||| ||||||||||||||||| || || || Sbjct: 1232 tagaactgtggactgtaatttgacaagaaggctgtgtggcgaccaccttcatcctttgta 1173 Query: 577 aggacataaatttcagcctcaaacttcttgtaggtctttacggtgccgggtttgcacacc 636 ||||| |||||||| ||||||||||| | ||| ||||| ||||| || |||||||||||| Sbjct: 1172 aggacgtaaatttccgcctcaaacttttggtacgtcttaacggtaccaggtttgcacacc 1113 Query: 637 acctggc 643 ||||||| Sbjct: 1112 acctggc 1106
>gb|AF303468.1| Oryza sativa elongation factor Tu (tufM) mRNA, complete cds; nuclear gene for mitochondrial product Length = 1713 Score = 172 bits (87), Expect = 9e-40 Identities = 252/307 (82%) Strand = Plus / Minus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatcttagc 396 ||||||| |||||||||||||| || ||||| ||||||||||||||||||||||| | Sbjct: 1412 actttggaaacaactccggcaccaactgtcctccctccttccctcagcgcaaatctctgg 1353 Query: 397 cctggttcgagtggaacaggcaacatcaactcaaagattgcggttacgttgtcaccaggc 456 ||||| || || |||||||| | ||||||||||| ||| ||||| || ||||||||| Sbjct: 1352 cctggctcaaggggaacaggtgatatcaactcaaatcctgcagttacattatcaccaggc 1293 Query: 457 ataaccatcttcacatccggaggcaactcgattttcccacagatatcagctgtcctgaag 516 |||||||| | ||| | ||| ||| | | ||| ||| || ||| || ||||| ||| Sbjct: 1292 ataaccatttccacgccatcaggtaacacaacttttccagtgacatcggcagtcctaaag 1233 Query: 517 tagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtctttggtg 576 |||||||| || |||||||| || |||||||| ||||||||||||||||| || || || Sbjct: 1232 tagaactgtggactgtaatttgacaagaaggctgtgtggcgaccaccttcatcctttgta 1173 Query: 577 aggacataaatttcagcctcaaacttcttgtaggtctttacggtgccgggtttgcacacc 636 ||||| |||||||| ||||||||||| | ||| ||||| ||||| || |||||||||||| Sbjct: 1172 aggacgtaaatttccgcctcaaacttttggtacgtcttaacggtaccaggtttgcacacc 1113 Query: 637 acctggc 643 ||||||| Sbjct: 1112 acctggc 1106
>dbj|AK102069.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033082G06, full insert sequence Length = 1756 Score = 172 bits (87), Expect = 9e-40 Identities = 252/307 (82%) Strand = Plus / Minus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatcttagc 396 ||||||| |||||||||||||| || ||||| ||||||||||||||||||||||| | Sbjct: 1435 actttggaaacaactccggcaccaactgtcctccctccttccctcagcgcaaatctctgg 1376 Query: 397 cctggttcgagtggaacaggcaacatcaactcaaagattgcggttacgttgtcaccaggc 456 ||||| || || |||||||| | ||||||||||| ||| ||||| || ||||||||| Sbjct: 1375 cctggctcaaggggaacaggtgatatcaactcaaatcctgcagttacattatcaccaggc 1316 Query: 457 ataaccatcttcacatccggaggcaactcgattttcccacagatatcagctgtcctgaag 516 |||||||| | ||| | ||| ||| | | ||| ||| || ||| || ||||| ||| Sbjct: 1315 ataaccatttccacgccatcaggtaacacaacttttccagtgacatcggcagtcctaaag 1256 Query: 517 tagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtctttggtg 576 |||||||| || |||||||| || |||||||| ||||||||||||||||| || || || Sbjct: 1255 tagaactgtggactgtaatttgacaagaaggctgtgtggcgaccaccttcatcctttgta 1196 Query: 577 aggacataaatttcagcctcaaacttcttgtaggtctttacggtgccgggtttgcacacc 636 ||||| |||||||| ||||||||||| | ||| ||||| ||||| || |||||||||||| Sbjct: 1195 aggacgtaaatttccgcctcaaacttttggtacgtcttaacggtaccaggtttgcacacc 1136 Query: 637 acctggc 643 ||||||| Sbjct: 1135 acctggc 1129
>dbj|AK058640.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-D12, full insert sequence Length = 752 Score = 172 bits (87), Expect = 9e-40 Identities = 252/307 (82%) Strand = Plus / Minus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatcttagc 396 ||||||| |||||||||||||| || ||||| ||||||||||||||||||||||| | Sbjct: 431 actttggaaacaactccggcaccaactgtcctccctccttccctcagcgcaaatctctgg 372 Query: 397 cctggttcgagtggaacaggcaacatcaactcaaagattgcggttacgttgtcaccaggc 456 ||||| || || |||||||| | ||||||||||| ||| ||||| || ||||||||| Sbjct: 371 cctggctcaaggggaacaggtgatatcaactcaaatcctgcagttacattatcaccaggc 312 Query: 457 ataaccatcttcacatccggaggcaactcgattttcccacagatatcagctgtcctgaag 516 |||||||| | ||| | ||| ||| | | ||| ||| || ||| || ||||| ||| Sbjct: 311 ataaccatttccacgccatcaggtaacacaacttttccagtgacatcggcagtcctaaag 252 Query: 517 tagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtctttggtg 576 |||||||| || |||||||| || |||||||| ||||||||||||||||| || || || Sbjct: 251 tagaactgtggactgtaatttgacaagaaggctgtgtggcgaccaccttcatcctttgta 192 Query: 577 aggacataaatttcagcctcaaacttcttgtaggtctttacggtgccgggtttgcacacc 636 ||||| |||||||| ||||||||||| | ||| ||||| ||||| || |||||||||||| Sbjct: 191 aggacgtaaatttccgcctcaaacttttggtacgtcttaacggtaccaggtttgcacacc 132 Query: 637 acctggc 643 ||||||| Sbjct: 131 acctggc 125
>gb|AY104241.1| Zea mays PCO131873 mRNA sequence Length = 1815 Score = 141 bits (71), Expect = 3e-30 Identities = 248/307 (80%) Strand = Plus / Minus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatcttagc 396 ||||||| ||| ||||| |||||||| || || ||||||||||| | |||||||||| || Sbjct: 1460 actttggagacgactccagcaccgaccgttcttcctccttccctaatcgcaaatctttgc 1401 Query: 397 cctggttcgagtggaacaggcaacatcaactcaaagattgcggttacgttgtcaccaggc 456 || ||||| || |||||||| | ||||||||||| | || ||||| |||||||| ||| Sbjct: 1400 ccaggttcaagaggaacaggtgatatcaactcaaaattcgcagttacattgtcaccgggc 1341 Query: 457 ataaccatcttcacatccggaggcaactcgattttcccacagatatcagctgtcctgaag 516 | ||||||||||| ||| | ||| ||| | | ||| || |||||||||||||||| Sbjct: 1340 aaaaccatcttcatctccccaagcagctcaacccttccagtgacatcagctgtcctgaag 1281 Query: 517 tagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtctttggtg 576 ||||| || ||||||||||| | || ||||||||||| || |||||||| || || || Sbjct: 1280 tagaattgggggctgtaatttgtgacaaaggcagtgtgccggccaccttcatcctttgtc 1221 Query: 577 aggacataaatttcagcctcaaacttcttgtaggtctttacggtgccgggtttgcacacc 636 ||||| || ||||| ||||||||||| ||||| ||||| | | || |||||||||||| Sbjct: 1220 aggacgtatatttctgcctcaaactttttgtatgtcttcagactaccaggtttgcacacc 1161 Query: 637 acctggc 643 ||||||| Sbjct: 1160 acctggc 1154
>gb|BT018862.1| Zea mays clone EL01N0559E06.d mRNA sequence Length = 2272 Score = 133 bits (67), Expect = 8e-28 Identities = 247/307 (80%) Strand = Plus / Minus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatcttagc 396 ||||||| |||||| |||||||| || ||||| ||||||||||||| |||||||||| || Sbjct: 2058 actttggagacaaccccggcaccaactgtcctccctccttccctcatcgcaaatctttgc 1999 Query: 397 cctggttcgagtggaacaggcaacatcaactcaaagattgcggttacgttgtcaccaggc 456 || | ||| || ||||||||| | |||||||| || | |||||||| |||||||| ||| Sbjct: 1998 ccagtttcaagaggaacaggcgatatcaactcgaaattcgcggttacattgtcaccgggc 1939 Query: 457 ataaccatcttcacatccggaggcaactcgattttcccacagatatcagctgtcctgaag 516 | |||||||||| || | ||||||| | || ||| || |||||| ||||||||| Sbjct: 1938 aaaaccatcttcgtctcaccaagcaactcaacctttccagtgacatcagcagtcctgaag 1879 Query: 517 tagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtctttggtg 576 ||||| || || ||||||| | || ||||||||||| || |||||||| || || || Sbjct: 1878 tagaattggggtgtgtaatttgtgacaaaggcagtgtgccggccaccttcatcctttgtc 1819 Query: 577 aggacataaatttcagcctcaaacttcttgtaggtctttacggtgccgggtttgcacacc 636 ||||| || ||||| ||||||||||| ||||| ||||| | | || |||||||||||| Sbjct: 1818 aggacgtatatttctgcctcaaactttttgtatgtcttcagactaccaggtttgcacacc 1759 Query: 637 acctggc 643 ||||||| Sbjct: 1758 acctggc 1752
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 123 bits (62), Expect = 8e-25 Identities = 116/134 (86%) Strand = Plus / Plus Query: 508 gtcctgaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcg 567 ||||| ||||||||||| || |||||||| || |||||||| ||||||||||||||||| Sbjct: 35523117 gtcctaaagtagaactgtggactgtaatttgacaagaaggctgtgtggcgaccaccttca 35523176 Query: 568 tctttggtgaggacataaatttcagcctcaaacttcttgtaggtctttacggtgccgggt 627 || || || ||||| |||||||| ||||||||||| | ||| ||||| ||||| || ||| Sbjct: 35523177 tcctttgtaaggacgtaaatttccgcctcaaacttttggtacgtcttaacggtaccaggt 35523236 Query: 628 ttgcacaccacctg 641 |||||||||||||| Sbjct: 35523237 ttgcacaccacctg 35523250 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Plus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatct 392 ||||||| |||||||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 35522857 actttggaaacaactccggcaccaactgtcctccctccttccctcagcgcaaatct 35522912
>gb|AF327062.1|AF327062 Oryza sativa translational elongation factor Tu (tufM) gene, complete cds; nuclear gene for mitochondrial product Length = 3532 Score = 123 bits (62), Expect = 8e-25 Identities = 116/134 (86%) Strand = Plus / Minus Query: 508 gtcctgaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcg 567 ||||| ||||||||||| || |||||||| || |||||||| ||||||||||||||||| Sbjct: 3136 gtcctaaagtagaactgtggactgtaatttgacaagaaggctgtgtggcgaccaccttca 3077 Query: 568 tctttggtgaggacataaatttcagcctcaaacttcttgtaggtctttacggtgccgggt 627 || || || ||||| |||||||| ||||||||||| | ||| ||||| ||||| || ||| Sbjct: 3076 tcctttgtaaggacgtaaatttccgcctcaaacttttggtacgtcttaacggtaccaggt 3017 Query: 628 ttgcacaccacctg 641 |||||||||||||| Sbjct: 3016 ttgcacaccacctg 3003 Score = 63.9 bits (32), Expect = 6e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatct 392 ||||||| |||||||||||||| || ||||| || |||||||||||||||||||| Sbjct: 3396 actttggaaacaactccggcaccaactgtcctcccgccttccctcagcgcaaatct 3341
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 123 bits (62), Expect = 8e-25 Identities = 116/134 (86%) Strand = Plus / Plus Query: 508 gtcctgaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcg 567 ||||| ||||||||||| || |||||||| || |||||||| ||||||||||||||||| Sbjct: 35613189 gtcctaaagtagaactgtggactgtaatttgacaagaaggctgtgtggcgaccaccttca 35613248 Query: 568 tctttggtgaggacataaatttcagcctcaaacttcttgtaggtctttacggtgccgggt 627 || || || ||||| |||||||| ||||||||||| | ||| ||||| ||||| || ||| Sbjct: 35613249 tcctttgtaaggacgtaaatttccgcctcaaacttttggtacgtcttaacggtaccaggt 35613308 Query: 628 ttgcacaccacctg 641 |||||||||||||| Sbjct: 35613309 ttgcacaccacctg 35613322 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Plus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatct 392 ||||||| |||||||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 35612929 actttggaaacaactccggcaccaactgtcctccctccttccctcagcgcaaatct 35612984
>gb|AC096688.4| Oryza sativa chromosome 3 BAC OSJNBa0015N08 genomic sequence, complete sequence Length = 145290 Score = 123 bits (62), Expect = 8e-25 Identities = 116/134 (86%) Strand = Plus / Plus Query: 508 gtcctgaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcg 567 ||||| ||||||||||| || |||||||| || |||||||| ||||||||||||||||| Sbjct: 56080 gtcctaaagtagaactgtggactgtaatttgacaagaaggctgtgtggcgaccaccttca 56139 Query: 568 tctttggtgaggacataaatttcagcctcaaacttcttgtaggtctttacggtgccgggt 627 || || || ||||| |||||||| ||||||||||| | ||| ||||| ||||| || ||| Sbjct: 56140 tcctttgtaaggacgtaaatttccgcctcaaacttttggtacgtcttaacggtaccaggt 56199 Query: 628 ttgcacaccacctg 641 |||||||||||||| Sbjct: 56200 ttgcacaccacctg 56213 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Plus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatct 392 ||||||| |||||||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 55820 actttggaaacaactccggcaccaactgtcctccctccttccctcagcgcaaatct 55875
>gb|AY110625.1| Zea mays CL1125_2 mRNA sequence Length = 575 Score = 103 bits (52), Expect = 7e-19 Identities = 211/264 (79%) Strand = Plus / Minus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatcttagc 396 ||||||| |||||| |||||||| || || || ||||||||||||| |||||||||| || Sbjct: 336 actttggagacaaccccggcaccaactgttctccctccttccctcatcgcaaatctttgc 277 Query: 397 cctggttcgagtggaacaggcaacatcaactcaaagattgcggttacgttgtcaccaggc 456 || | ||| || ||||||||| | |||||||| || | |||||||| |||||||| ||| Sbjct: 276 ccagtttcaagaggaacaggcgatatcaactcgaaattcgcggttacattgtcaccgggc 217 Query: 457 ataaccatcttcacatccggaggcaactcgattttcccacagatatcagctgtcctgaag 516 | |||||||||| || | ||||||| | || ||| || |||||| ||||||||| Sbjct: 216 aaaaccatcttcgtctcaccaagcaactcaacctttccagggacatcagcagtcctgaag 157 Query: 517 tagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtctttggtg 576 ||||| || || ||||||| | || ||||||||||| || |||||||| || || || Sbjct: 156 tagaattggggtgtgtaatttgggacaaaggcagtgtgccggccaccttcatcctttgta 97 Query: 577 aggacataaatttcagcctcaaac 600 ||||| || ||||| ||||||||| Sbjct: 96 aggacgtatatttctgcctcaaac 73
>gb|AF264877.1|AF264877 Zea mays translational elongation factor EF-TuM gene, complete cds, nuclear gene for mitochondrial product Length = 5993 Score = 83.8 bits (42), Expect = 7e-13 Identities = 87/102 (85%) Strand = Plus / Minus Query: 501 atcagctgtcctgaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgacc 560 ||||||||||||||||||||| || ||||||||||| | || ||||||||||| || || Sbjct: 5267 atcagctgtcctgaagtagaattgggggctgtaatttgtgacaaaggcagtgtgccggcc 5208 Query: 561 accttcgtctttggtgaggacataaatttcagcctcaaactt 602 |||||| || || || |||||||| ||||| ||||| ||||| Sbjct: 5207 accttcatcctttgtcaggacatatatttccgcctcgaactt 5166 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Minus Query: 337 actttggcgacaactccggcaccgacggtcctgcctccttccctcagcgcaaatcttagc 396 ||||||| ||| ||||| |||||||| || || ||||||||||| | |||||||||| || Sbjct: 5594 actttggagacgactccagcaccgaccgttcttcctccttccctaatcgcaaatctttgc 5535 Query: 397 cctg 400 |||| Sbjct: 5534 cctg 5531
>ref|NM_116527.2| Arabidopsis thaliana GTP binding / translation elongation factor AT4G02930 mRNA, complete cds Length = 1750 Score = 81.8 bits (41), Expect = 3e-12 Identities = 194/245 (79%) Strand = Plus / Minus Query: 370 cctccttccctcagcgcaaatcttagccctggttcgagtggaacaggcaacatcaactca 429 ||||||||||| | ||||||||| | |||| ||||||||| ||||||| || ||||| Sbjct: 1365 cctccttcccttaaggcaaatctttgacctgtttcgagtgggacaggcatgattaactcg 1306 Query: 430 aagattgcggttacgttgtcaccaggcataaccatcttcacatccggaggcaactcgatt 489 || | || || || |||||||||||||||||||||||||| | || || || | | Sbjct: 1305 aaaacagctgtgacattgtcaccaggcataaccatcttcacgttttcgggtaattccact 1246 Query: 490 ttcccacagatatcagctgtcctgaagtagaactgcgggctgtaattcgagaagaaggca 549 || ||| |||||| || ||||| ||||| ||||| || ||||| || ||||| || ||| Sbjct: 1245 ttgccagtgatatctgcagtcctcaagtaaaactgaggcctgtagttagagaaaaatgca 1186 Query: 550 gtgtggcgaccaccttcgtctttggtgaggacataaatttcagcctcaaacttcttgtag 609 ||||| || |||||||| || || ||||| || ||||| || || |||||||||||||| Sbjct: 1185 gtgtgacgtccaccttcatcctttgtgagcacgtaaatctctgcttcaaacttcttgtat 1126 Query: 610 gtctt 614 ||||| Sbjct: 1125 gtctt 1121
>gb|BT008755.1| Arabidopsis thaliana At4g02930 mRNA, complete cds Length = 1365 Score = 81.8 bits (41), Expect = 3e-12 Identities = 194/245 (79%) Strand = Plus / Minus Query: 370 cctccttccctcagcgcaaatcttagccctggttcgagtggaacaggcaacatcaactca 429 ||||||||||| | ||||||||| | |||| ||||||||| ||||||| || ||||| Sbjct: 1322 cctccttcccttaaggcaaatctttgacctgtttcgagtgggacaggcatgattaactcg 1263 Query: 430 aagattgcggttacgttgtcaccaggcataaccatcttcacatccggaggcaactcgatt 489 || | || || || |||||||||||||||||||||||||| | || || || | | Sbjct: 1262 aaaacagctgtgacattgtcaccaggcataaccatcttcacgttttcgggtaattccact 1203 Query: 490 ttcccacagatatcagctgtcctgaagtagaactgcgggctgtaattcgagaagaaggca 549 || ||| |||||| || ||||| ||||| ||||| || ||||| || ||||| || ||| Sbjct: 1202 ttgccagtgatatctgcagtcctcaagtaaaactgaggcctgtagttagagaaaaatgca 1143 Query: 550 gtgtggcgaccaccttcgtctttggtgaggacataaatttcagcctcaaacttcttgtag 609 ||||| || |||||||| || || ||||| || ||||| || || |||||||||||||| Sbjct: 1142 gtgtgacgtccaccttcatcctttgtgagcacgtaaatctctgcttcaaacttcttgtat 1083 Query: 610 gtctt 614 ||||| Sbjct: 1082 gtctt 1078
>emb|X89227.1|ATRNAMEFT A.thaliana mRNA for mitochondrial elongation factor Tu Length = 1425 Score = 81.8 bits (41), Expect = 3e-12 Identities = 194/245 (79%) Strand = Plus / Minus Query: 370 cctccttccctcagcgcaaatcttagccctggttcgagtggaacaggcaacatcaactca 429 ||||||||||| | ||||||||| | |||| ||||||||| ||||||| || ||||| Sbjct: 1382 cctccttcccttaaggcaaatctttgacctgtttcgagtgggacaggcatgattaactcg 1323 Query: 430 aagattgcggttacgttgtcaccaggcataaccatcttcacatccggaggcaactcgatt 489 || | || || || |||||||||||||||||||||||||| | || || || | | Sbjct: 1322 aaaacagctgtgacattgtcaccaggcataaccatcttcacgttttcgggtaattccact 1263 Query: 490 ttcccacagatatcagctgtcctgaagtagaactgcgggctgtaattcgagaagaaggca 549 || ||| |||||| || ||||| ||||| ||||| || ||||| || ||||| || ||| Sbjct: 1262 ttgccagtgatatctgcagtcctcaagtaaaactgaggcctgtagttagagaaaaatgca 1203 Query: 550 gtgtggcgaccaccttcgtctttggtgaggacataaatttcagcctcaaacttcttgtag 609 ||||| || |||||||| || || ||||| || ||||| || || |||||||||||||| Sbjct: 1202 gtgtgacgtccaccttcatcctttgtgagcacgtaaatctctgcttcaaacttcttgtat 1143 Query: 610 gtctt 614 ||||| Sbjct: 1142 gtctt 1138
>gb|AY136421.1| Arabidopsis thaliana mitochondrial elongation factor Tu (At4g02930) mRNA, complete cds Length = 1629 Score = 81.8 bits (41), Expect = 3e-12 Identities = 194/245 (79%) Strand = Plus / Minus Query: 370 cctccttccctcagcgcaaatcttagccctggttcgagtggaacaggcaacatcaactca 429 ||||||||||| | ||||||||| | |||| ||||||||| ||||||| || ||||| Sbjct: 1351 cctccttcccttaaggcaaatctttgacctgtttcgagtgggacaggcatgattaactcg 1292 Query: 430 aagattgcggttacgttgtcaccaggcataaccatcttcacatccggaggcaactcgatt 489 || | || || || |||||||||||||||||||||||||| | || || || | | Sbjct: 1291 aaaacagctgtgacattgtcaccaggcataaccatcttcacgttttcgggtaattccact 1232 Query: 490 ttcccacagatatcagctgtcctgaagtagaactgcgggctgtaattcgagaagaaggca 549 || ||| |||||| || ||||| ||||| ||||| || ||||| || ||||| || ||| Sbjct: 1231 ttgccagtgatatctgcagtcctcaagtaaaactgaggcctgtagttagagaaaaatgca 1172 Query: 550 gtgtggcgaccaccttcgtctttggtgaggacataaatttcagcctcaaacttcttgtag 609 ||||| || |||||||| || || ||||| || ||||| || || |||||||||||||| Sbjct: 1171 gtgtgacgtccaccttcatcctttgtgagcacgtaaatctctgcttcaaacttcttgtat 1112 Query: 610 gtctt 614 ||||| Sbjct: 1111 gtctt 1107
>emb|BX827237.1|CNS0A3M3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS25ZB09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1594 Score = 81.8 bits (41), Expect = 3e-12 Identities = 194/245 (79%) Strand = Plus / Minus Query: 370 cctccttccctcagcgcaaatcttagccctggttcgagtggaacaggcaacatcaactca 429 ||||||||||| | ||||||||| | |||| ||||||||| ||||||| || ||||| Sbjct: 1343 cctccttcccttaaggcaaatctttgacctgtttcgagtgggacaggcatgattaactcg 1284 Query: 430 aagattgcggttacgttgtcaccaggcataaccatcttcacatccggaggcaactcgatt 489 || | || || || |||||||||||||||||||||||||| | || || || | | Sbjct: 1283 aaaacagctgtgacattgtcaccaggcataaccatcttcacgttttcgggtaattccact 1224 Query: 490 ttcccacagatatcagctgtcctgaagtagaactgcgggctgtaattcgagaagaaggca 549 || ||| |||||| || ||||| ||||| ||||| || ||||| || ||||| || ||| Sbjct: 1223 ttgccagtgatatctgcagtcctcaagtaaaactgaggcctgtagttagagaaaaatgca 1164 Query: 550 gtgtggcgaccaccttcgtctttggtgaggacataaatttcagcctcaaacttcttgtag 609 ||||| || |||||||| || || ||||| || ||||| || || |||||||||||||| Sbjct: 1163 gtgtgacgtccaccttcatcctttgtgagcacgtaaatctctgcttcaaacttcttgtat 1104 Query: 610 gtctt 614 ||||| Sbjct: 1103 gtctt 1099
>gb|AC004044.1| Arabidopsis thaliana BAC T5J8 from chromosome IV, top arm, complete sequence Length = 98527 Score = 67.9 bits (34), Expect = 4e-08 Identities = 136/170 (80%) Strand = Plus / Plus Query: 445 ttgtcaccaggcataaccatcttcacatccggaggcaactcgattttcccacagatatca 504 |||||||||||||||||||||||||| | || || || | ||| ||| |||||| Sbjct: 93045 ttgtcaccaggcataaccatcttcacgttttcgggtaattccactttgccagtgatatct 93104 Query: 505 gctgtcctgaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccacct 564 || ||||| ||||| ||||| || ||||| || ||||| || |||||||| || |||||| Sbjct: 93105 gcagtcctcaagtaaaactgaggcctgtagttagagaaaaatgcagtgtgacgtccacct 93164 Query: 565 tcgtctttggtgaggacataaatttcagcctcaaacttcttgtaggtctt 614 || || || ||||| || ||||| || || |||||||||||||| ||||| Sbjct: 93165 tcatcctttgtgagcacgtaaatctctgcttcaaacttcttgtatgtctt 93214
>gb|AF069442.1| Arabidopsis thaliana BAC T4I9, chromosome IV, near 17 cM, complete sequence Length = 98913 Score = 67.9 bits (34), Expect = 4e-08 Identities = 136/170 (80%) Strand = Plus / Minus Query: 445 ttgtcaccaggcataaccatcttcacatccggaggcaactcgattttcccacagatatca 504 |||||||||||||||||||||||||| | || || || | ||| ||| |||||| Sbjct: 87386 ttgtcaccaggcataaccatcttcacgttttcgggtaattccactttgccagtgatatct 87327 Query: 505 gctgtcctgaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccacct 564 || ||||| ||||| ||||| || ||||| || ||||| || |||||||| || |||||| Sbjct: 87326 gcagtcctcaagtaaaactgaggcctgtagttagagaaaaatgcagtgtgacgtccacct 87267 Query: 565 tcgtctttggtgaggacataaatttcagcctcaaacttcttgtaggtctt 614 || || || ||||| || ||||| || || |||||||||||||| ||||| Sbjct: 87266 tcatcctttgtgagcacgtaaatctctgcttcaaacttcttgtatgtctt 87217
>emb|AL161495.2|ATCHRIV7 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 7 Length = 199615 Score = 67.9 bits (34), Expect = 4e-08 Identities = 136/170 (80%) Strand = Plus / Plus Query: 445 ttgtcaccaggcataaccatcttcacatccggaggcaactcgattttcccacagatatca 504 |||||||||||||||||||||||||| | || || || | ||| ||| |||||| Sbjct: 141716 ttgtcaccaggcataaccatcttcacgttttcgggtaattccactttgccagtgatatct 141775 Query: 505 gctgtcctgaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccacct 564 || ||||| ||||| ||||| || ||||| || ||||| || |||||||| || |||||| Sbjct: 141776 gcagtcctcaagtaaaactgaggcctgtagttagagaaaaatgcagtgtgacgtccacct 141835 Query: 565 tcgtctttggtgaggacataaatttcagcctcaaacttcttgtaggtctt 614 || || || ||||| || ||||| || || |||||||||||||| ||||| Sbjct: 141836 tcatcctttgtgagcacgtaaatctctgcttcaaacttcttgtatgtctt 141885
>emb|BX827558.1|CNS0A3N6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS73ZE07 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1575 Score = 65.9 bits (33), Expect = 2e-07 Identities = 84/101 (83%) Strand = Plus / Minus Query: 370 cctccttccctcagcgcaaatcttagccctggttcgagtggaacaggcaacatcaactca 429 ||||||||||| | ||||||||| | |||| ||||||||| ||||||| || ||||| Sbjct: 1327 cctccttcccttaaggcaaatctttgacctgtttcgagtgggacaggcatgattaactcg 1268 Query: 430 aagattgcggttacgttgtcaccaggcataaccatcttcac 470 || | || || || |||||||||||||||||||||||||| Sbjct: 1267 aaaacagctgtgacattgtcaccaggcataaccatcttcac 1227
>emb|AJ965256.1| Dehalococcoides sp. CBDB1 complete genome Length = 1395502 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Plus Query: 540 gaagaaggcagtgtggcgaccaccttcgtctttggtgaggacataaatttcagc 593 |||||| | ||| ||||||||||||||||| ||| |||| ||||||| |||||| Sbjct: 784252 gaagaaaggagtatggcgaccaccttcgtccttgctgagtacataaacttcagc 784305
>emb|AL935258.1| Lactobacillus plantarum strain WCFS1 complete genome; segment 7/11 Length = 297050 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||||||||||||||||||||| Sbjct: 56028 gttacgttgtcaccaggcataaccat 56053
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 50.1 bits (25), Expect = 0.009 Identities = 61/73 (83%) Strand = Plus / Minus Query: 508 gtcctgaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcg 567 |||| ||||||||||||||| | ||| |||| |||||| | |||||||| || ||||| Sbjct: 288811 gtccggaagtagaactgcggacggtagttcgcgaagaacggggtgtggcggccgccttcc 288752 Query: 568 tctttggtgagga 580 ||||| ||||||| Sbjct: 288751 tctttcgtgagga 288739 Score = 42.1 bits (21), Expect = 2.2 Identities = 60/73 (82%) Strand = Plus / Minus Query: 508 gtcctgaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcg 567 |||| ||||||||||||||| | ||| || | |||||| | |||||||| || ||||| Sbjct: 307488 gtccggaagtagaactgcggacggtagttggcgaagaacggggtgtggcggccgccttcc 307429 Query: 568 tctttggtgagga 580 ||||| ||||||| Sbjct: 307428 tctttcgtgagga 307416
>emb|X76872.1|WS1740TUF W.succinogenes (DSM 1740) tuf gene Length = 1203 Score = 50.1 bits (25), Expect = 0.009 Identities = 25/25 (100%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataaccatct 466 ||||||||||||||||||||||||| Sbjct: 1088 acgttgtcaccaggcataaccatct 1064
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 50.1 bits (25), Expect = 0.009 Identities = 61/73 (83%) Strand = Plus / Plus Query: 508 gtcctgaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcg 567 |||| ||||||||||||||||| ||| || |||||||| |||||||| ||||| ||| Sbjct: 3109313 gtccggaagtagaactgcgggcggtagttgttgaagaagggcgtgtggcggccaccctcg 3109372 Query: 568 tctttggtgagga 580 || |||| ||||| Sbjct: 3109373 tccttggagagga 3109385
>emb|BX571658.1| Wolinella succinogenes, complete genome; segment 2/7 Length = 346792 Score = 50.1 bits (25), Expect = 0.009 Identities = 25/25 (100%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataaccatct 466 ||||||||||||||||||||||||| Sbjct: 106947 acgttgtcaccaggcataaccatct 106923
>emb|AJ401093.1|ANA401093 Actinomyces naeslundii ef-TU gene (partial), ORF977 and fimA gene (partial) Length = 4647 Score = 48.1 bits (24), Expect = 0.036 Identities = 57/68 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||||||||| | ||| |||||| |||||| ||||||| || || ||||| || Sbjct: 429 gaagtagaactgcggacggtagttcgagtagaaggggttgtggcggccgccctcgtcctt 370 Query: 573 ggtgagga 580 |||||||| Sbjct: 369 ggtgagga 362
>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome Length = 2201561 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 440 ttacgttgtcaccaggcataaccatct 466 ||||||||||||| ||||||||||||| Sbjct: 344216 ttacgttgtcacctggcataaccatct 344190
>gb|BT012778.1| Lycopersicon esculentum clone 113757F, mRNA sequence Length = 1751 Score = 46.1 bits (23), Expect = 0.14 Identities = 74/91 (81%) Strand = Plus / Minus Query: 516 gtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtctttggt 575 ||||||||| || || || || ||||| || |||||||| ||||||||||| || || || Sbjct: 1217 gtagaactgaggcctatagtttgagaaaaaagcagtgtgccgaccaccttcatccttagt 1158 Query: 576 gaggacataaatttcagcctcaaacttcttg 606 || || || ||||| |||||||| |||||| Sbjct: 1157 tagtacgtatatttctgcctcaaatttcttg 1127
>gb|AY372046.1| Bifidobacterium breve strain ATCC 15700 Tuf gene, partial cds Length = 991 Score = 46.1 bits (23), Expect = 0.14 Identities = 53/63 (84%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||||||||| | ||| ||||||||||| | | |||||| ||||| ||||| || Sbjct: 845 gaagtagaactgcggacggtagttcgagaagaacggcgagtggcggccaccctcgtcctt 786 Query: 573 ggt 575 ||| Sbjct: 785 ggt 783
>emb|X61957.1|TTTUFB T.thermophilus HB8 tufB gene for elongation factor Tu Length = 1553 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataaccatcttcacatccggaggcaact 484 |||||||| |||||||| ||||||| ||| |||||||||||| Sbjct: 1178 acgttgtccccaggcatcaccatctccacgcccggaggcaact 1136
>emb|Z46265.1|TTRPS10L3 T.thermophilus genes for ribosomal proteind L3 and S10 Length = 1333 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataaccatcttcacatccggaggcaact 484 |||||||| |||||||| ||||||| ||| |||||||||||| Sbjct: 275 acgttgtccccaggcatcaccatctccacgcccggaggcaact 233
>emb|AJ130966.1|CRO130966 Catharanthus roseus mRNA for mitochondrial elongation factor Tu, partial Length = 635 Score = 46.1 bits (23), Expect = 0.14 Identities = 41/47 (87%) Strand = Plus / Minus Query: 532 taattcgagaagaaggcagtgtggcgaccaccttcgtctttggtgag 578 ||||| ||||| || ||||||||||| |||||||| ||||| ||||| Sbjct: 557 taatttgagaaaaatgcagtgtggcggccaccttcatctttagtgag 511
>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome Length = 1849742 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Plus Query: 442 acgttgtcaccaggcataaccatcttcacatccggaggcaact 484 |||||||| |||||||| ||||||| ||| |||||||||||| Sbjct: 1591211 acgttgtccccaggcatcaccatctccacgcccggaggcaact 1591253 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Plus Query: 442 acgttgtcaccaggcataaccatcttcacatccggaggcaact 484 |||||||| |||||||| ||||||| ||| |||||||||||| Sbjct: 239062 acgttgtccccaggcatcaccatctccacgcccggaggcaact 239104
>emb|X05977.1|TTTUF1 Thermus thermophilus tuf1 gene for elongation factor Tu Length = 1576 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataaccatcttcacatccggaggcaact 484 |||||||| |||||||| ||||||| ||| |||||||||||| Sbjct: 1326 acgttgtccccaggcatcaccatctccacgcccggaggcaact 1284
>emb|X06657.1|TTTUF Thermus thermophilus HB8 tuf gene for elongation factor Tu (EF-Tu) Length = 1578 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataaccatcttcacatccggaggcaact 484 |||||||| |||||||| ||||||| ||| |||||||||||| Sbjct: 1328 acgttgtccccaggcatcaccatctccacgcccggaggcaact 1286
>gb|AE000511.1| Helicobacter pylori 26695, complete genome Length = 1667867 Score = 46.1 bits (23), Expect = 0.14 Identities = 74/91 (81%) Strand = Plus / Plus Query: 517 tagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtctttggtg 576 ||||| ||||||| |||||| | |||||| | |||||| | || ||||| ||||| | Sbjct: 1280869 tagaattgcgggcggtaattggtgaagaatggagtgtgtctcccgccttcttctttagaa 1280928 Query: 577 aggacataaatttcagcctcaaacttcttgt 607 |||||||||||||| ||||||| ||||||| Sbjct: 1280929 aggacataaatttctccctcaaatttcttgt 1280959
>gb|AE017221.1| Thermus thermophilus HB27, complete genome Length = 1894877 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataaccatcttcacatccggaggcaact 484 |||||||| |||||||| ||||||| ||| |||||||||||| Sbjct: 1651018 acgttgtccccaggcatcaccatctccacgcccggaggcaact 1650976 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Plus Query: 442 acgttgtcaccaggcataaccatcttcacatccggaggcaact 484 |||||||| |||||||| ||||||| ||| |||||||||||| Sbjct: 1267081 acgttgtccccaggcatcaccatctccacgcccggaggcaact 1267123
>gb|L10348.1|TTHNUSG Thermus thermophilus transcription factor (nusG) gene, complete cds Length = 1314 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataaccatcttcacatccggaggcaact 484 |||||||| |||||||| ||||||| ||| |||||||||||| Sbjct: 94 acgttgtccccaggcatcaccatctccacgcccggaggcaact 52
>gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome Length = 1899877 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||| ||||||||||||||||| Sbjct: 521117 gttacgttatcaccaggcataaccat 521092
>gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome Length = 1937111 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||| ||||||||||||||||| Sbjct: 509659 gttacgttatcaccaggcataaccat 509634
>gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118, complete genome Length = 1827111 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||| ||||||||||||||||| Sbjct: 686848 gttacgttatcaccaggcataaccat 686823
>gb|AC151725.26| Medicago truncatula clone mth2-164l16, complete sequence Length = 115069 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 448 tcaccaggcataaccatcttcacatc 473 |||||||||||||||||||| ||||| Sbjct: 79312 tcaccaggcataaccatcttgacatc 79287
>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome Length = 3523383 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 441 tacgttgtcaccaggcataaccatct 466 |||||| ||||||||||||||||||| Sbjct: 1255309 tacgttatcaccaggcataaccatct 1255284 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 441 tacgttgtcaccaggcataaccat 464 |||||| ||||||||||||||||| Sbjct: 1272178 tacgttatcaccaggcataaccat 1272155
>emb|AJ418909.2|LJE418909 Lactobacillus jensenii partial mRNA for putative elongation factor Tu (tuf gene), strain ATCC 25258 Length = 761 Score = 44.1 bits (22), Expect = 0.56 Identities = 58/70 (82%) Strand = Plus / Minus Query: 538 gagaagaaggcagtgtggcgaccaccttcgtctttggtgaggacataaatttcagcctca 597 |||||||| | |||||| |||||||||||||| || | | |||||||| || | ||| | Sbjct: 683 gagaagaatggagtgtgacgaccaccttcgtccttcttcaagacataaacttgaccctta 624 Query: 598 aacttcttgt 607 |||||||||| Sbjct: 623 aacttcttgt 614
>gb|AC129803.3| Homo sapiens 3 BAC RP11-15N24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 185721 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 294 ccaaaaagaaaggtctggaaca 315 |||||||||||||||||||||| Sbjct: 177928 ccaaaaagaaaggtctggaaca 177949
>gb|AC130887.4| Homo sapiens 3 BAC RP13-517F19 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 106897 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 294 ccaaaaagaaaggtctggaaca 315 |||||||||||||||||||||| Sbjct: 81288 ccaaaaagaaaggtctggaaca 81267
>gb|AE010001.1| Streptococcus pyogenes strain MGAS8232, section 49 of 173 of the complete genome Length = 10344 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||| ||||||||||||||||| Sbjct: 5772 gttacgttatcaccaggcataaccat 5747
>gb|AF274743.1|AF274743 Streptococcus pyogenes elongation factor Tu (tuf) gene, partial cds Length = 822 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||| ||||||||||||||||| Sbjct: 775 gttacgttatcaccaggcataaccat 750
>gb|AF274736.1|AF274736 Enterococcus saccharolyticus elongation factor Tu (tuf) gene, partial cds Length = 835 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||||||||||||||| ||||| Sbjct: 777 gttacgttgtcaccaggcattaccat 752
>gb|AF274730.1|AF274730 Enterococcus mundtii strain ATCC43186 elongation factor Tu (tufA) gene, partial cds Length = 835 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 ||||||||||| |||||||||||||| Sbjct: 777 gttacgttgtcgccaggcataaccat 752
>gb|AF274726.1|AF274726 Enterococcus hirae strain ATCC8043 elongation factor Tu (tufA) gene, partial cds Length = 835 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 ||||||||||| |||||||||||||| Sbjct: 777 gttacgttgtcgccaggcataaccat 752
>gb|AF274722.1|AF274722 Enterococcus durans strain ATCC19432 elongation factor Tu (tufA) gene, partial cds Length = 835 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 ||||||||||| |||||||||||||| Sbjct: 777 gttacgttgtcgccaggcataaccat 752
>gb|AF274718.1|AF274718 Enterococcus cecorum elongation factor Tu (tuf) gene, partial cds Length = 826 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||| ||||||||||||||||| Sbjct: 776 gttacgttatcaccaggcataaccat 751
>gb|AF274717.1|AF274717 Enterococcus casseliflavus strain ATCC25788 elongation factor Tu (tufB) gene, partial cds Length = 835 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||||||||||||||| ||||| Sbjct: 777 gttacgttgtcaccaggcatcaccat 752
>gb|AF274716.1|AF274716 Enterococcus casseliflavus strain ATCC25788 elongation factor Tu (tufA) gene, partial cds Length = 835 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||| ||||||||||||||||| Sbjct: 777 gttacgttatcaccaggcataaccat 752
>emb|CR936503.1| Lactobacillus sakei strain 23K complete genome Length = 1884661 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Plus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||| ||||||||||||||||| Sbjct: 1057669 gttacgttatcaccaggcataaccat 1057694
>gb|AE015924.1| Porphyromonas gingivalis W83, complete genome Length = 2343476 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||||||||| ||||||||||| Sbjct: 421858 gttacgttgtcaccgggcataaccat 421833 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 421748 agtgtggcgaccaccttcttcttt 421725
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 44.1 bits (22), Expect = 0.56 Identities = 52/62 (83%) Strand = Plus / Plus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||||||||| | ||| |||| |||||| | ||||| || ||||||||||| || Sbjct: 4532325 gaagtagaactgcggacggtagttcgcgaagaacggggtgtgacggccaccttcgtcctt 4532384 Query: 573 gg 574 || Sbjct: 4532385 gg 4532386
>emb|AL929024.9| Mouse DNA sequence from clone RP23-480H10 on chromosome 2, complete sequence Length = 159617 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 410 gaacaggcaacatcaactcaaa 431 |||||||||||||||||||||| Sbjct: 20042 gaacaggcaacatcaactcaaa 20063
>dbj|AB035466.1| Bacteroides forsythus gene for EF-Tu, complete cds, strain:ATCC 43037 Length = 1188 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||||||||| ||||||||||| Sbjct: 1076 gttacgttgtcaccgggcataaccat 1051 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 966 agtgtggcgaccaccttcttcttt 943
>dbj|AB035465.1| Porphyromonas gingivalis gene for EF-Tu, complete cds, strain:ATCC 33277 Length = 1188 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||||||||| ||||||||||| Sbjct: 1076 gttacgttgtcaccgggcataaccat 1051 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 966 agtgtggcgaccaccttcttcttt 943
>dbj|AB035464.1| Porphyromonas gingivalis gene for EF-Tu, complete cds, strain:A7A1-28 Length = 1188 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||||||||| ||||||||||| Sbjct: 1076 gttacgttgtcaccgggcataaccat 1051 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 966 agtgtggcgaccaccttcttcttt 943
>dbj|AB035463.1| Porphyromonas gingivalis gene for EF-Tu, complete cds, strain:SUNY 1021 Length = 1188 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||||||||| ||||||||||| Sbjct: 1076 gttacgttgtcaccgggcataaccat 1051 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 966 agtgtggcgaccaccttcttcttt 943
>dbj|AB035462.1| Porphyromonas gingivalis gene for EF-Tu, complete cds, strain:W83 Length = 1188 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||||||||| ||||||||||| Sbjct: 1076 gttacgttgtcaccgggcataaccat 1051 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 966 agtgtggcgaccaccttcttcttt 943
>dbj|AB035461.1| Porphyromonas gingivalis gene for EF-Tu, complete cds, strain:FDC 381 Length = 1188 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 439 gttacgttgtcaccaggcataaccat 464 |||||||||||||| ||||||||||| Sbjct: 1076 gttacgttgtcaccgggcataaccat 1051 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 966 agtgtggcgaccaccttcttcttt 943
>gb|AE017138.1| Yersinia pestis biovar Medievalis str. 91001 section 12 of 16 of the complete genome Length = 290924 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 440 ttacgttgtcaccaggcataaccat 464 ||||||||||||||||||| ||||| Sbjct: 272848 ttacgttgtcaccaggcatgaccat 272872
>gb|AE009952.1| Yersinia pestis KIM, complete genome Length = 4600755 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 440 ttacgttgtcaccaggcataaccat 464 ||||||||||||||||||| ||||| Sbjct: 535813 ttacgttgtcaccaggcatgaccat 535789
>gb|AY370922.1| Bifidobacterium animalis strain NCC383 Tuf gene, partial cds Length = 948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaa 545 ||||||||||||||| | ||| ||||||||||| Sbjct: 814 gaagtagaactgcggacggtagttcgagaagaa 782
>gb|AY370921.1| Bifidobacterium animalis strain ATCC 27672 Tuf gene, partial cds Length = 948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaa 545 ||||||||||||||| | ||| ||||||||||| Sbjct: 814 gaagtagaactgcggacggtagttcgagaagaa 782
>gb|AY370918.1| Bifidobacterium animalis strain ATCC 27674 Tuf gene, partial cds Length = 948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaa 545 ||||||||||||||| | ||| ||||||||||| Sbjct: 814 gaagtagaactgcggacggtagttcgagaagaa 782
>gb|AY370917.1| Bifidobacterium animalis strain ATCC 27673 Tuf gene, partial cds Length = 948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaa 545 ||||||||||||||| | ||| ||||||||||| Sbjct: 814 gaagtagaactgcggacggtagttcgagaagaa 782
>gb|AY370916.1| Bifidobacterium animalis strain NCC402 Tuf gene, partial cds Length = 948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaa 545 ||||||||||||||| | ||| ||||||||||| Sbjct: 814 gaagtagaactgcggacggtagttcgagaagaa 782
>gb|AY370915.1| Bifidobacterium animalis strain NCC363 Tuf gene, partial cds Length = 948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaa 545 ||||||||||||||| | ||| ||||||||||| Sbjct: 814 gaagtagaactgcggacggtagttcgagaagaa 782
>gb|AY370914.1| Bifidobacterium animalis strain NCC311 Tuf gene, partial cds Length = 948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaa 545 ||||||||||||||| | ||| ||||||||||| Sbjct: 814 gaagtagaactgcggacggtagttcgagaagaa 782
>gb|AY370913.1| Bifidobacterium animalis strain NCC239 Tuf gene, partial cds Length = 948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaa 545 ||||||||||||||| | ||| ||||||||||| Sbjct: 814 gaagtagaactgcggacggtagttcgagaagaa 782
>gb|AY370912.1| Bifidobacterium animalis strain ATCC 27536 Tuf gene, partial cds Length = 948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaa 545 ||||||||||||||| | ||| ||||||||||| Sbjct: 814 gaagtagaactgcggacggtagttcgagaagaa 782
>gb|AY372049.1| Lactobacillus johnsonii strain NCC 533 RpsT, RpsO, metallo beta subunit lactamase, hypothetical protein, Tuf, trigger factor, Clp protease, GTP binding protein, and phosphotyrosinase protein phosphatase genes, complete cds Length = 9074 Score = 42.1 bits (21), Expect = 2.2 Identities = 51/61 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||| || || | ||||| |||||||| | |||||| ||||||||||| ||||| Sbjct: 4697 gaagtagaattgtggacggtaatctgagaagaatggagtgtgacgaccaccttcatcttt 4638 Query: 573 g 573 | Sbjct: 4637 g 4637
>gb|AY372047.1| Lactobacillus gasseri strain ATCC 33323 Tuf gene, partial cds Length = 700 Score = 42.1 bits (21), Expect = 2.2 Identities = 51/61 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||| || || | ||||| |||||||| | |||||| ||||||||||| ||||| Sbjct: 695 gaagtagaattgtggacggtaatctgagaagaatggagtgtgacgaccaccttcatcttt 636 Query: 573 g 573 | Sbjct: 635 g 635
>gb|AY372035.1| Lactobacillus gasseri strain ATCC 19992 Tuf gene, partial cds Length = 700 Score = 42.1 bits (21), Expect = 2.2 Identities = 51/61 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||| || || | ||||| |||||||| | |||||| ||||||||||| ||||| Sbjct: 695 gaagtagaattgtggacggtaatctgagaagaatggagtgtgacgaccaccttcatcttt 636 Query: 573 g 573 | Sbjct: 635 g 635
>gb|AY370920.1| Bifidobacterium animalis strain ATCC25527 Tuf gene, partial cds Length = 948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaa 545 ||||||||||||||| | ||| ||||||||||| Sbjct: 814 gaagtagaactgcggacggtagttcgagaagaa 782
>gb|AY370919.1| Bifidobacterium animalis strain DSM10140 Tuf gene, partial cds Length = 948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaa 545 ||||||||||||||| | ||| ||||||||||| Sbjct: 814 gaagtagaactgcggacggtagttcgagaagaa 782
>gb|CP000302.1| Shewanella denitrificans OS217, complete genome Length = 4545906 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 444 gttgtcaccaggcataaccat 464 ||||||||||||||||||||| Sbjct: 195852 gttgtcaccaggcataaccat 195832
>emb|AL035467.23|HS288M22 Human DNA sequence from clone RP1-288M22 on chromosome 6q12-13 Contains a novel gene, the gene for a novel protein (FLJ13189) and a CpG Island, complete sequence Length = 155960 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 266 attcatttgtttactaaaatt 286 ||||||||||||||||||||| Sbjct: 38690 attcatttgtttactaaaatt 38670
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence Length = 4744671 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 440 ttacgttgtcaccaggcataaccat 464 ||||||||||||||||||| ||||| Sbjct: 331889 ttacgttgtcaccaggcatgaccat 331865
>emb|BX572100.1| Prochlorococcus marinus MIT9313 complete genome; segment 6/7 Length = 348071 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 345 gacaactccggcaccgacggtcctgcctccttc 377 ||||||||||||||||| ||| | ||||||||| Sbjct: 138021 gacaactccggcaccgatggtgcggcctccttc 137989
>emb|AJ418908.2|LJO418908 Lactobacillus johnsonii partial mRNA for putative elongation factor Tu (tuf gene), strain ATCC 33200 Length = 761 Score = 42.1 bits (21), Expect = 2.2 Identities = 51/61 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||| || || | ||||| |||||||| | |||||| ||||||||||| ||||| Sbjct: 708 gaagtagaattgtggacggtaatctgagaagaatggagtgtgacgaccaccttcatcttt 649 Query: 573 g 573 | Sbjct: 648 g 648
>emb|AJ418907.2|LGA418907 Lactobacillus gasseri partial mRNA for putative elongation factor Tu (tuf gene), strain ATCC 33323 Length = 761 Score = 42.1 bits (21), Expect = 2.2 Identities = 51/61 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||| || || | ||||| |||||||| | |||||| ||||||||||| ||||| Sbjct: 708 gaagtagaattgtggacggtaatctgagaagaatggagtgtgacgaccaccttcatcttt 649 Query: 573 g 573 | Sbjct: 648 g 648
>emb|AJ414158.1| Yersinia pestis strain CO92 complete genome; segment 18/20 Length = 235050 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 440 ttacgttgtcaccaggcataaccat 464 ||||||||||||||||||| ||||| Sbjct: 193902 ttacgttgtcaccaggcatgaccat 193926
>emb|AL645570.13| Mouse DNA sequence from clone RP23-377H12 on chromosome 11 Contains two novel genes, the 3' end of the Meis1 gene for myeloid ecotropic viral integration site 1 and two CpG islands, complete sequence Length = 190198 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 487 attttcccacagatatcagct 507 ||||||||||||||||||||| Sbjct: 93868 attttcccacagatatcagct 93848
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtc 569 ||||||||||||||||| ||| || | |||||| | ||||| || ||||||||||| Sbjct: 1297710 gaagtagaactgcgggcggtagttggcgaagaacggcgtgtgacggccaccttcgtc 1297654
>dbj|AK054238.1| Mus musculus 2 days pregnant adult female oviduct cDNA, RIKEN full-length enriched library, clone:E230038I17 product:unclassifiable, full insert sequence Length = 2512 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 487 attttcccacagatatcagct 507 ||||||||||||||||||||| Sbjct: 769 attttcccacagatatcagct 789
>gb|AE006470.1| Chlorobium tepidum TLS, complete genome Length = 2154946 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 444 gttgtcaccaggcataaccat 464 ||||||||||||||||||||| Sbjct: 2064941 gttgtcaccaggcataaccat 2064961
>dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete genome Length = 3544776 Score = 42.1 bits (21), Expect = 2.2 Identities = 57/69 (82%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||| ||||| | ||| ||||||||||| | ||| ||||| || ||||| ||||| Sbjct: 127203 gaagtagaattgcggacggtagttcgagaagaacggagtatggcgtccgccttcttcttt 127144 Query: 573 ggtgaggac 581 || ||||| Sbjct: 127143 cgtcaggac 127135
>dbj|AK071959.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013087K05, full insert sequence Length = 1639 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 410 gaacaggcaacatcaactcaa 430 ||||||||||||||||||||| Sbjct: 1219 gaacaggcaacatcaactcaa 1239
>gb|AE017198.1| Lactobacillus johnsonii NCC 533, complete genome Length = 1992676 Score = 42.1 bits (21), Expect = 2.2 Identities = 51/61 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||| || || | ||||| |||||||| | |||||| ||||||||||| ||||| Sbjct: 910014 gaagtagaattgtggacggtaatctgagaagaatggagtgtgacgaccaccttcatcttt 909955 Query: 573 g 573 | Sbjct: 909954 g 909954
>gb|AC160761.6| Mus musculus BAC clone RP24-163J22 from chromosome 7, complete sequence Length = 199480 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 agaaaaaatagcaattcttc 130 |||||||||||||||||||| Sbjct: 194606 agaaaaaatagcaattcttc 194587
>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome Length = 4222334 Score = 40.1 bits (20), Expect = 8.8 Identities = 50/60 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 |||||||||||| |||| ||| || |||||||| | |||||| || ||||| || ||||| Sbjct: 132961 gaagtagaactgagggcggtagttagagaagaatggagtgtgacgtccaccctcttcttt 132902
>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome Length = 4222645 Score = 40.1 bits (20), Expect = 8.8 Identities = 50/60 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 |||||||||||| |||| ||| || |||||||| | |||||| || ||||| || ||||| Sbjct: 132772 gaagtagaactgagggcggtagttagagaagaatggagtgtgacgtccaccctcttcttt 132713
>ref|XM_747492.1| Aspergillus fumigatus Af293 translation elongation factor EF-Tu (Afu1g12170) partial mRNA Length = 1323 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataac 461 |||||||||||||||||||| Sbjct: 1205 acgttgtcaccaggcataac 1186
>gb|AY372036.1| Lactobacillus johnsonii strain ATCC 33200 Tuf gene, partial cds Length = 701 Score = 40.1 bits (20), Expect = 8.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 538 gagaagaaggcagtgtggcgaccaccttcgtctttg 573 |||||||| | |||||| ||||||||||| |||||| Sbjct: 670 gagaagaatggagtgtgacgaccaccttcatctttg 635
>gb|AC165163.2| Mus musculus BAC clone RP23-146B12 from chromosome 14, complete sequence Length = 178254 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 99 aacatgacaagaagaaaaaa 118 |||||||||||||||||||| Sbjct: 165733 aacatgacaagaagaaaaaa 165752
>gb|AC146334.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone B1356F10, complete sequence Length = 170681 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 367 ctgcctccttccctcagcgc 386 |||||||||||||||||||| Sbjct: 157865 ctgcctccttccctcagcgc 157846
>emb|X67057.1|SRTUF1 S.ramocissimus tuf1 gene for elongation factor Tu1 Length = 2836 Score = 40.1 bits (20), Expect = 8.8 Identities = 56/68 (82%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||||||||||| ||| || |||||| | |||||||| ||||| ||||| || Sbjct: 2191 gaagtagaactgcgggcggtagttgttgaagaacggcgtgtggcggccaccctcgtcctt 2132 Query: 573 ggtgagga 580 || ||||| Sbjct: 2131 ggagagga 2124
>emb|BX649605.1| Aspergillus fumigatus BAC pilot project supercontig; segment 1/3 Length = 345637 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataac 461 |||||||||||||||||||| Sbjct: 259756 acgttgtcaccaggcataac 259737
>emb|AL683874.1|AFA14E5 Aspergillus fumigatus BAC AfA14E5 Length = 68100 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataac 461 |||||||||||||||||||| Sbjct: 8320 acgttgtcaccaggcataac 8301
>emb|AJ555817.1|PGI555817 Porphyromonas gingivalis partial ef-tu gene, strain PP118/10 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555816.1|PGI555816 Porphyromonas gingivalis partial ef-tu gene, strain GDR8 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555815.1|PGI555815 Porphyromonas gingivalis partial ef-tu gene, strain GDR17 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555814.1|PGI555814 Porphyromonas gingivalis partial ef-tu gene, strain GDR11 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555813.1|PGI555813 Porphyromonas gingivalis partial ef-tu gene, strain Fr7 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555812.1|PGI555812 Porphyromonas gingivalis partial ef-tu gene, strain Fr22 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555811.1|PGI555811 Porphyromonas gingivalis partial ef-tu gene, strain Fr19 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555810.1|PGI555810 Porphyromonas gingivalis partial ef-tu gene, strain Fr14 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555809.1|PGI555809 Porphyromonas gingivalis partial ef-tu gene, strain Fr048 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555808.1|PGI555808 Porphyromonas gingivalis partial ef-tu gene, strain Eli90 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555807.1|PGI555807 Porphyromonas gingivalis partial ef-tu gene, strain Eli88 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555806.1|PGI555806 Porphyromonas gingivalis partial ef-tu gene, strain Eli85 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555805.1|PGI555805 Porphyromonas gingivalis partial ef-tu gene, strain Eli80 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555804.1|PGI555804 Porphyromonas gingivalis partial ef-tu gene, strain Eli60 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555803.1|PGI555803 Porphyromonas gingivalis partial ef-tu gene, strain Eli55 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555802.1|PGI555802 Porphyromonas gingivalis partial ef-tu gene, strain Eli47 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555801.1|PGI555801 Porphyromonas gingivalis partial ef-tu gene, strain Eli33 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555800.1|PGI555800 Porphyromonas gingivalis partial ef-tu gene, strain D165 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ555799.1|PGI555799 Porphyromonas gingivalis partial ef-tu gene, strain 53977 Length = 380 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 549 agtgtggcgaccaccttcgtcttt 572 |||||||||||||||||| ||||| Sbjct: 326 agtgtggcgaccaccttcttcttt 303
>emb|AJ418902.2|LAC418902 Lactobacillus acidophilus partial mRNA for putative elongation factor Tu (tuf gene), strain ATCC4356 Length = 761 Score = 40.1 bits (20), Expect = 8.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 538 gagaagaaggcagtgtggcgaccaccttcgtc 569 |||||||| | |||||| |||||||||||||| Sbjct: 683 gagaagaatggagtgtgacgaccaccttcgtc 652
>gb|AC146756.17| Medicago truncatula clone mth2-15l17, complete sequence Length = 120437 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 281 aaaattcactacgccaaaaa 300 |||||||||||||||||||| Sbjct: 66704 aaaattcactacgccaaaaa 66685
>gb|AC022634.8| Homo sapiens chromosome , clone RP11-25P11, complete sequence Length = 161602 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 534 attcgagaagaaggcagtgt 553 |||||||||||||||||||| Sbjct: 128521 attcgagaagaaggcagtgt 128502
>gb|AC153138.3| Mus musculus BAC clone RP23-442K7 from chromosome 7, complete sequence Length = 206648 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 agaaaaaatagcaattcttc 130 |||||||||||||||||||| Sbjct: 174256 agaaaaaatagcaattcttc 174275
>gb|AC155231.2| Mus musculus BAC clone RP24-336I23 from chromosome 12, complete sequence Length = 175296 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 ccaacatgacaagaagaaaa 116 |||||||||||||||||||| Sbjct: 123763 ccaacatgacaagaagaaaa 123744
>gb|AF298799.1|AF298799 Staphylococcus cohnii subsp. ureolyticus translation elongation factor Tu (tuf) gene, partial cds Length = 815 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 441 tacgttgtcaccaggcataaccat 464 ||||||||| |||||||||||||| Sbjct: 772 tacgttgtcgccaggcataaccat 749
>dbj|AK017701.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length enriched library, clone:5730478E03 product:karyopherin (importin) beta 3, full insert sequence Length = 2093 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 99 aacatgacaagaagaaaaaa 118 |||||||||||||||||||| Sbjct: 856 aacatgacaagaagaaaaaa 837
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 367 ctgcctccttccctcagcgc 386 |||||||||||||||||||| Sbjct: 21634346 ctgcctccttccctcagcgc 21634327
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 97 ccaacatgacaagaagaaaa 116 |||||||||||||||||||| Sbjct: 8649876 ccaacatgacaagaagaaaa 8649895
>gb|AF234537.1|AF234537 Pelargonium graveolens chloroplast translational elongation factor Tu (tufA) mRNA, complete cds; nuclear gene for chloroplast product Length = 1584 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tcaccaggcataaccatctt 467 |||||||||||||||||||| Sbjct: 1324 tcaccaggcataaccatctt 1305
>gb|AC013448.7| Homo sapiens BAC clone RP11-551D18 from 2, complete sequence Length = 129553 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 272 ttgtttactaaaattcacta 291 |||||||||||||||||||| Sbjct: 304 ttgtttactaaaattcacta 323
>gb|AC079120.6| Homo sapiens BAC clone RP11-345M24 from 2, complete sequence Length = 104547 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 272 ttgtttactaaaattcacta 291 |||||||||||||||||||| Sbjct: 102851 ttgtttactaaaattcacta 102870
>gb|AC004557.2|AC004557 Genomic sequence for Arabidopsis thaliana BAC F17L21 from chromosome I, complete sequence Length = 99690 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 308 ctggaacatattattgttat 327 |||||||||||||||||||| Sbjct: 53143 ctggaacatattattgttat 53162
>gb|AC154283.1| Mus musculus BAC clone RP24-279H4 from chromosome 14, complete sequence Length = 192706 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 99 aacatgacaagaagaaaaaa 118 |||||||||||||||||||| Sbjct: 44467 aacatgacaagaagaaaaaa 44486
>dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome Length = 4202352 Score = 40.1 bits (20), Expect = 8.8 Identities = 50/60 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||||||||| | || || |||||||| | |||||| || |||||||| ||||| Sbjct: 167640 gaagtagaactgcggacgatagttagagaagaatggagtgtgacgtccaccttcttcttt 167581
>dbj|AP005510.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0009N02 Length = 121142 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 97 ccaacatgacaagaagaaaa 116 |||||||||||||||||||| Sbjct: 119199 ccaacatgacaagaagaaaa 119218
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 8.8 Identities = 56/68 (82%) Strand = Plus / Plus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||||||||| | ||| || | |||||| | ||||||||||| || || || || Sbjct: 5937174 gaagtagaactgcggacggtagttggtgaagaacggggtgtggcgaccgccctcttcctt 5937233 Query: 573 ggtgagga 580 |||||||| Sbjct: 5937234 ggtgagga 5937241
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 40.1 bits (20), Expect = 8.8 Identities = 56/68 (82%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||||||||| | ||| || | |||||| | ||||| || ||||||||||| || Sbjct: 208957 gaagtagaactgcggacggtagttggtgaagaacggcgtgtgacggccaccttcgtcctt 208898 Query: 573 ggtgagga 580 ||| |||| Sbjct: 208897 ggtcagga 208890 Score = 40.1 bits (20), Expect = 8.8 Identities = 56/68 (82%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||||||||| | ||| || | |||||| | ||||| || ||||||||||| || Sbjct: 186086 gaagtagaactgcggacggtagttggtgaagaacggcgtgtgacggccaccttcgtcctt 186027 Query: 573 ggtgagga 580 ||| |||| Sbjct: 186026 ggtcagga 186019
>emb|BX000444.11| Zebrafish DNA sequence from clone RP71-31C2 in linkage group 9, complete sequence Length = 128377 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 110 aagaaaaaatagcaattctt 129 |||||||||||||||||||| Sbjct: 17170 aagaaaaaatagcaattctt 17189
>gb|L46370.1|BATTUFC Non-culturable plant pathogenic bacterial sp. clone STOLF elongation factor EF-TU (tuf) gene, partial cds Length = 977 Score = 40.1 bits (20), Expect = 8.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 442 acgttgtcaccaggcataaccatcttcacatc 473 ||||||||||| ||||||||||| || ||||| Sbjct: 953 acgttgtcacctggcataaccattttaacatc 922
>dbj|AP004875.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0463G12 Length = 145403 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 97 ccaacatgacaagaagaaaa 116 |||||||||||||||||||| Sbjct: 56923 ccaacatgacaagaagaaaa 56942
>gb|CP000033.1| Lactobacillus acidophilus NCFM, complete genome Length = 1993564 Score = 40.1 bits (20), Expect = 8.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 538 gagaagaaggcagtgtggcgaccaccttcgtc 569 |||||||| | |||||| |||||||||||||| Sbjct: 828420 gagaagaatggagtgtgacgaccaccttcgtc 828389
>gb|AF124225.1|AF124225 Abiotrophia defectiva putative elongation factor Tu (tuf) gene, partial cds Length = 751 Score = 40.1 bits (20), Expect = 8.8 Identities = 50/60 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||| || || | ||| || |||||||| | |||||| ||||||||||| ||||| Sbjct: 703 gaagtagaattgtggacggtagttagagaagaatggagtgtgacgaccaccttcttcttt 644
>gb|AE000657.1| Aquifex aeolicus VF5, complete genome Length = 1551335 Score = 40.1 bits (20), Expect = 8.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 502 tcagctgtcctgaagtagaactgcgggctgta 533 ||||| ||||||||||| |||||||| ||||| Sbjct: 1357971 tcagccgtcctgaagtaaaactgcggtctgta 1357940 Score = 40.1 bits (20), Expect = 8.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 502 tcagctgtcctgaagtagaactgcgggctgta 533 ||||| ||||||||||| |||||||| ||||| Sbjct: 3156 tcagccgtcctgaagtaaaactgcggtctgta 3125
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome Length = 5224283 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 441 tacgttgtcaccaggcataaccat 464 |||||||||||||||||| ||||| Sbjct: 120450 tacgttgtcaccaggcattaccat 120427
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 367 ctgcctccttccctcagcgc 386 |||||||||||||||||||| Sbjct: 21944545 ctgcctccttccctcagcgc 21944526
>emb|AL929194.8| Mouse DNA sequence from clone RP23-385L14 on chromosome 2, complete sequence Length = 120827 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 580 acataaatttcagcctcaaa 599 |||||||||||||||||||| Sbjct: 78376 acataaatttcagcctcaaa 78395
>gb|AC150903.2| Mus musculus BAC clone RP23-35B12 from chromosome 7, complete sequence Length = 217178 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 agaaaaaatagcaattcttc 130 |||||||||||||||||||| Sbjct: 129709 agaaaaaatagcaattcttc 129690
>dbj|AB017508.1| Bacillus halodurans C-125 genomic DNA, 32 kb fragment, complete cds Length = 32050 Score = 40.1 bits (20), Expect = 8.8 Identities = 50/60 (83%) Strand = Plus / Minus Query: 513 gaagtagaactgcgggctgtaattcgagaagaaggcagtgtggcgaccaccttcgtcttt 572 ||||||||||||||| | || || |||||||| | |||||| || |||||||| ||||| Sbjct: 12154 gaagtagaactgcggacgatagttagagaagaatggagtgtgacgtccaccttcttcttt 12095 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,779,081 Number of Sequences: 3902068 Number of extensions: 5779081 Number of successful extensions: 123440 Number of sequences better than 10.0: 155 Number of HSP's better than 10.0 without gapping: 152 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 122635 Number of HSP's gapped (non-prelim): 801 length of query: 643 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 620 effective length of database: 17,143,297,704 effective search space: 10628844576480 effective search space used: 10628844576480 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
