ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags10f05 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_550447.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1937 Score = 474 bits (239), Expect = e-130 Identities = 464/539 (86%) Strand = Plus / Minus Query: 172 tacagcagcatggtcgtcgggttctcaaggtagctcttgaatgccttgagccattccgca 231 ||||||| ||||||||| || ||||| | ||||| |||||| ||||| | |||||| ||| Sbjct: 1711 tacagcaacatggtcgttggattctcgatgtagcccttgaacgccttcatccattctgca 1652 Query: 232 cccatggcgccatcaatgacccggtggtcgcagcttagcgtggctgacatgaaggacccg 291 || ||||| || ||||||||||||||||||||||| | || |||||||| || || || Sbjct: 1651 ccaatggcaccgtcaatgacccggtggtcgcagctcaatgttgctgacataaacgaacca 1592 Query: 292 acttcaaattggccctcaactccagggaccaccctcttctcagcagagccaatagccaag 351 |||||||| || |||||| ||||||||| ||||||||||||||| |||||||||||||| Sbjct: 1591 acttcaaactgaccctcagctccagggatcaccctcttctcagctgagccaatagccaaa 1532 Query: 352 attgccgattggggagggtttacgatggcacagaattgcttgattccgaaagggcctccc 411 ||||| ||||| ||||| ||||||||||||||||||||||| ||||| |||||||||||| Sbjct: 1531 attgctgattgtggaggatttacgatggcacagaattgcttaattccaaaagggcctccc 1472 Query: 412 agattcgagacggtgaaagtgccaccctcgtaatcttctggttttaggctgttatccctt 471 | || || || ||||||||||||||||| ||||| ||||| || |||||||| |||||| Sbjct: 1471 aagtttgacacagtgaaagtgccaccctcataatcctctggcttaaggctgttgtccctt 1412 Query: 472 gctcttagagccaactgcttcacctcatcagcaatagtggccaaccctttcttgtccgcg 531 ||||| |||||| ||||||||||||||||| |||||||| | || |||||||| || Sbjct: 1411 gctctctgagccagttgcttcacctcatcagcgatagtggctaggcccttcttgtcagca 1352 Query: 532 tccctaactactggaacgaacaaaccatgctcagtctgtacagcaacattaatgttcacg 591 ||||| | ||| ||||| ||||| |||| |||||| |||||||||||||| |||||||| Sbjct: 1351 tcccttattacgggaacaaacaagccatcctcagtttgtacagcaacattgatgttcaca 1292 Query: 592 ttgtggtactggcgaataaaatcattcatccaggaactgttacacgcaggaaccttacga 651 |||||||| ||||||||||||||||||||||| || || |||||| ||||||| |||||| Sbjct: 1291 ttgtggtattggcgaataaaatcattcatccaagagctattacactcaggaacattacga 1232 Query: 652 agagccaacgctgcagccttaatgacaagatcatttatagatatcttcttcccgccaga 710 |||||||| ||||| ||||| || |||||||||||||| ||||||||||| || ||||| Sbjct: 1231 agagccaatgctgcggccttgataacaagatcatttatggatatcttcttgccaccaga 1173
>dbj|AK071985.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091O21, full insert sequence Length = 1936 Score = 474 bits (239), Expect = e-130 Identities = 464/539 (86%) Strand = Plus / Minus Query: 172 tacagcagcatggtcgtcgggttctcaaggtagctcttgaatgccttgagccattccgca 231 ||||||| ||||||||| || ||||| | ||||| |||||| ||||| | |||||| ||| Sbjct: 1710 tacagcaacatggtcgttggattctcgatgtagcccttgaacgccttcatccattctgca 1651 Query: 232 cccatggcgccatcaatgacccggtggtcgcagcttagcgtggctgacatgaaggacccg 291 || ||||| || ||||||||||||||||||||||| | || |||||||| || || || Sbjct: 1650 ccaatggcaccgtcaatgacccggtggtcgcagctcaatgttgctgacataaacgaacca 1591 Query: 292 acttcaaattggccctcaactccagggaccaccctcttctcagcagagccaatagccaag 351 |||||||| || |||||| ||||||||| ||||||||||||||| |||||||||||||| Sbjct: 1590 acttcaaactgaccctcagctccagggatcaccctcttctcagctgagccaatagccaaa 1531 Query: 352 attgccgattggggagggtttacgatggcacagaattgcttgattccgaaagggcctccc 411 ||||| ||||| ||||| ||||||||||||||||||||||| ||||| |||||||||||| Sbjct: 1530 attgctgattgtggaggatttacgatggcacagaattgcttaattccaaaagggcctccc 1471 Query: 412 agattcgagacggtgaaagtgccaccctcgtaatcttctggttttaggctgttatccctt 471 | || || || ||||||||||||||||| ||||| ||||| || |||||||| |||||| Sbjct: 1470 aagtttgacacagtgaaagtgccaccctcataatcctctggcttaaggctgttgtccctt 1411 Query: 472 gctcttagagccaactgcttcacctcatcagcaatagtggccaaccctttcttgtccgcg 531 ||||| |||||| ||||||||||||||||| |||||||| | || |||||||| || Sbjct: 1410 gctctctgagccagttgcttcacctcatcagcgatagtggctaggcccttcttgtcagca 1351 Query: 532 tccctaactactggaacgaacaaaccatgctcagtctgtacagcaacattaatgttcacg 591 ||||| | ||| ||||| ||||| |||| |||||| |||||||||||||| |||||||| Sbjct: 1350 tcccttattacgggaacaaacaagccatcctcagtttgtacagcaacattgatgttcaca 1291 Query: 592 ttgtggtactggcgaataaaatcattcatccaggaactgttacacgcaggaaccttacga 651 |||||||| ||||||||||||||||||||||| || || |||||| ||||||| |||||| Sbjct: 1290 ttgtggtattggcgaataaaatcattcatccaagagctattacactcaggaacattacga 1231 Query: 652 agagccaacgctgcagccttaatgacaagatcatttatagatatcttcttcccgccaga 710 |||||||| ||||| ||||| || |||||||||||||| ||||||||||| || ||||| Sbjct: 1230 agagccaatgctgcggccttgataacaagatcatttatggatatcttcttgccaccaga 1172
>ref|XM_463813.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2223 Score = 353 bits (178), Expect = 5e-94 Identities = 337/390 (86%) Strand = Plus / Minus Query: 321 caccctcttctcagcagagccaatagccaagattgccgattggggagggtttacgatggc 380 ||||||||||||||||| ||||| ||||||||||| || || ||||| |||| |||||| Sbjct: 1651 caccctcttctcagcagtaccaatggccaagattgctgactgaggaggatttatgatggc 1592 Query: 381 acagaattgcttgattccgaaagggcctcccagattcgagacggtgaaagtgccaccctc 440 ||||||||| |||||||||||||| ||||| || || || | |||||| ||||| ||||| Sbjct: 1591 acagaattgtttgattccgaaaggacctcctaggtttgatatggtgaatgtgcctccctc 1532 Query: 441 gtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacctcatc 500 |||||||| ||||||| ||||||||||||||||||| |||||| |||||||||||| || Sbjct: 1531 ataatcttcaggttttaagctgttatcccttgctctttgagccacctgcttcacctcctc 1472 Query: 501 agcaatagtggccaaccctttcttgtccgcgtccctaactactggaacgaacaaaccatg 560 |||||| || | | || |||||||| || ||||||| ||||||||| ||||| ||||| Sbjct: 1471 agcaattgtaccaagtcccttcttgtctgcatccctaattactggaacaaacaacccatg 1412 Query: 561 ctcagtctgtacagcaacattaatgttcacgttgtggtactggcgaataaaatcattcat 620 ||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||| |||| Sbjct: 1411 ctcagtctgtacagcaacattgatgttcacgttgtggtattggcggataaaatcactcat 1352 Query: 621 ccaggaactgttacacgcaggaaccttacgaagagccaacgctgcagccttaatgacaag 680 ||| || || |||||| ||| ||||| |||||||||| ||||||||||| || ||||| Sbjct: 1351 ccacgagctattacactgagggacctttcgaagagccagagctgcagcctttataacaag 1292 Query: 681 atcatttatagatatcttcttcccgccaga 710 ||| || |||||||||||||| |||||||| Sbjct: 1291 atcgttaatagatatcttcttaccgccaga 1262
>dbj|AK063525.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-A04, full insert sequence Length = 2223 Score = 353 bits (178), Expect = 5e-94 Identities = 337/390 (86%) Strand = Plus / Minus Query: 321 caccctcttctcagcagagccaatagccaagattgccgattggggagggtttacgatggc 380 ||||||||||||||||| ||||| ||||||||||| || || ||||| |||| |||||| Sbjct: 1651 caccctcttctcagcagtaccaatggccaagattgctgactgaggaggatttatgatggc 1592 Query: 381 acagaattgcttgattccgaaagggcctcccagattcgagacggtgaaagtgccaccctc 440 ||||||||| |||||||||||||| ||||| || || || | |||||| ||||| ||||| Sbjct: 1591 acagaattgtttgattccgaaaggacctcctaggtttgatatggtgaatgtgcctccctc 1532 Query: 441 gtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacctcatc 500 |||||||| ||||||| ||||||||||||||||||| |||||| |||||||||||| || Sbjct: 1531 ataatcttcaggttttaagctgttatcccttgctctttgagccacctgcttcacctcctc 1472 Query: 501 agcaatagtggccaaccctttcttgtccgcgtccctaactactggaacgaacaaaccatg 560 |||||| || | | || |||||||| || ||||||| ||||||||| ||||| ||||| Sbjct: 1471 agcaattgtaccaagtcccttcttgtctgcatccctaattactggaacaaacaacccatg 1412 Query: 561 ctcagtctgtacagcaacattaatgttcacgttgtggtactggcgaataaaatcattcat 620 ||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||| |||| Sbjct: 1411 ctcagtctgtacagcaacattgatgttcacgttgtggtattggcggataaaatcactcat 1352 Query: 621 ccaggaactgttacacgcaggaaccttacgaagagccaacgctgcagccttaatgacaag 680 ||| || || |||||| ||| ||||| |||||||||| ||||||||||| || ||||| Sbjct: 1351 ccacgagctattacactgagggacctttcgaagagccagagctgcagcctttataacaag 1292 Query: 681 atcatttatagatatcttcttcccgccaga 710 ||| || |||||||||||||| |||||||| Sbjct: 1291 atcgttaatagatatcttcttaccgccaga 1262
>gb|AF135014.1|AF135014 Zea mays dihydrolipoamide S-acetyltransferase mRNA, complete cds; nuclear gene for mitochondrial product Length = 1981 Score = 339 bits (171), Expect = 8e-90 Identities = 449/541 (82%), Gaps = 3/541 (0%) Strand = Plus / Minus Query: 173 acagcagcatggtcgtcgggttctcaaggtagctcttgaatgccttgagccattccgcac 232 |||||||||| | || |||||||| | ||| | ||||||||| || || ||||||||| Sbjct: 1719 acagcagcattgaagttgggttctcgatgtatcccttgaatgctttcagaaattccgcac 1660 Query: 233 ccatggcgccatcaatgacccggtggtcgcagcttagcgtggctgacatgaaggacccga 292 | || |||||||| || |||| |||||| ||||| || || ||||||||||| || || | Sbjct: 1659 cgattgcgccatctataaccctgtggtcacagctcagtgtagctgacatgaatgaaccaa 1600 Query: 293 cttcaaattggccctcaact---ccagggaccaccctcttctcagcagagccaatagcca 349 |||||| ||||| ||| | ||||| | |||||||||||||||||| ||||| |||| Sbjct: 1599 attcaaactggccatcagcggaaccaggtatcaccctcttctcagcagaaccaatggcca 1540 Query: 350 agattgccgattggggagggtttacgatggcacagaattgcttgattccgaaagggcctc 409 | ||||| || |||||||| |||| |||||| |||||||| || |||||||| || |||| Sbjct: 1539 aaattgctgactggggaggatttatgatggcgcagaattgtttaattccgaagggacctc 1480 Query: 410 ccagattcgagacggtgaaagtgccaccctcgtaatcttctggttttaggctgttatccc 469 ||| ||| || || ||||| ||||| |||||||||||| ||||||||||||| ||||| | Sbjct: 1479 ccaaatttgatacagtgaaggtgccgccctcgtaatctgctggttttaggctattatctc 1420 Query: 470 ttgctcttagagccaactgcttcacctcatcagcaatagtggccaaccctttcttgtccg 529 ||||| || ||||||||||||||||||| |||||||| | | | || |||||||| | Sbjct: 1419 ttgctttttgagccaactgcttcacctcctcagcaattgcaccgagtcccttcttgtctg 1360 Query: 530 cgtccctaactactggaacgaacaaaccatgctcagtctgtacagcaacattaatgttca 589 | ||||||| ||||||||| ||||| ||||| |||||||||||||| || || ||||||| Sbjct: 1359 catccctaattactggaacaaacaatccatgttcagtctgtacagccacgttgatgttca 1300 Query: 590 cgttgtggtactggcgaataaaatcattcatccaggaactgttacacgcaggaaccttac 649 | |||||||| || |||||||||||||||||||| || ||||||||| ||| ||||| | Sbjct: 1299 cattgtggtattgccgaataaaatcattcatccatgagctgttacactgagggacctttc 1240 Query: 650 gaagagccaacgctgcagccttaatgacaagatcatttatagatatcttcttcccgccag 709 |||| ||||| ||||||||||| |||||||||||||| || ||||| ||||| || |||| Sbjct: 1239 gaagggccaaagctgcagccttgatgacaagatcattaattgatattttctttccaccag 1180 Query: 710 a 710 | Sbjct: 1179 a 1179
>ref|XM_477668.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2399 Score = 319 bits (161), Expect = 7e-84 Identities = 326/381 (85%) Strand = Plus / Minus Query: 321 caccctcttctcagcagagccaatagccaagattgccgattggggagggtttacgatggc 380 ||||||| |||||||||| ||||| |||||||||||||| || ||||| |||| |||||| Sbjct: 1771 caccctcctctcagcagaaccaatggccaagattgccgactgaggaggatttatgatggc 1712 Query: 381 acagaattgcttgattccgaaagggcctcccagattcgagacggtgaaagtgccaccctc 440 ||| |||||||| ||||| ||||| ||||||| || || | |||||| ||||| ||||| Sbjct: 1711 acaaaattgcttaattccaaaaggacctcccaagtttgatatggtgaatgtgcctccctc 1652 Query: 441 gtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacctcatc 500 ||||| |||||||| | |||||||||||||||||| ||||||||||||||||||| || Sbjct: 1651 ataatcatctggtttcaaactgttatcccttgctctttgagccaactgcttcacctcctc 1592 Query: 501 agcaatagtggccaaccctttcttgtccgcgtccctaactactggaacgaacaaaccatg 560 ||||| | | | ||||||||||| || ||||| | ||||||||| |||| ||||| Sbjct: 1591 cgcaatcataccaagtcctttcttgtctgcatccctgattactggaacaaacagtccatg 1532 Query: 561 ctcagtctgtacagcaacattaatgttcacgttgtggtactggcgaataaaatcattcat 620 ||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 1531 ctcagtctgtacagcaacattgatgttcacgttgtggtattggcggataaaatcattcat 1472 Query: 621 ccaggaactgttacacgcaggaaccttacgaagagccaacgctgcagccttaatgacaag 680 |||||| || |||||| ||| ||||| |||||||||| ||||||||||| || || || Sbjct: 1471 ccaggagctattacactgagggacctttcgaagagccagagctgcagcctttataactag 1412 Query: 681 atcatttatagatatcttctt 701 |||||| |||||||||||||| Sbjct: 1411 atcattaatagatatcttctt 1391
>dbj|AK070846.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023068C09, full insert sequence Length = 2398 Score = 319 bits (161), Expect = 7e-84 Identities = 326/381 (85%) Strand = Plus / Minus Query: 321 caccctcttctcagcagagccaatagccaagattgccgattggggagggtttacgatggc 380 ||||||| |||||||||| ||||| |||||||||||||| || ||||| |||| |||||| Sbjct: 1771 caccctcctctcagcagaaccaatggccaagattgccgactgaggaggatttatgatggc 1712 Query: 381 acagaattgcttgattccgaaagggcctcccagattcgagacggtgaaagtgccaccctc 440 ||| |||||||| ||||| ||||| ||||||| || || | |||||| ||||| ||||| Sbjct: 1711 acaaaattgcttaattccaaaaggacctcccaagtttgatatggtgaatgtgcctccctc 1652 Query: 441 gtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacctcatc 500 ||||| |||||||| | |||||||||||||||||| ||||||||||||||||||| || Sbjct: 1651 ataatcatctggtttcaaactgttatcccttgctctttgagccaactgcttcacctcctc 1592 Query: 501 agcaatagtggccaaccctttcttgtccgcgtccctaactactggaacgaacaaaccatg 560 ||||| | | | ||||||||||| || ||||| | ||||||||| |||| ||||| Sbjct: 1591 cgcaatcataccaagtcctttcttgtctgcatccctgattactggaacaaacagtccatg 1532 Query: 561 ctcagtctgtacagcaacattaatgttcacgttgtggtactggcgaataaaatcattcat 620 ||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 1531 ctcagtctgtacagcaacattgatgttcacgttgtggtattggcggataaaatcattcat 1472 Query: 621 ccaggaactgttacacgcaggaaccttacgaagagccaacgctgcagccttaatgacaag 680 |||||| || |||||| ||| ||||| |||||||||| ||||||||||| || || || Sbjct: 1471 ccaggagctattacactgagggacctttcgaagagccagagctgcagcctttataactag 1412 Query: 681 atcatttatagatatcttctt 701 |||||| |||||||||||||| Sbjct: 1411 atcattaatagatatcttctt 1391
>gb|AY109496.1| Zea mays CL1480_1 mRNA sequence Length = 1932 Score = 317 bits (160), Expect = 3e-83 Identities = 445/541 (82%), Gaps = 3/541 (0%) Strand = Plus / Minus Query: 173 acagcagcatggtcgtcgggttctcaaggtagctcttgaatgccttgagccattccgcac 232 |||||||||| | || |||||||| | ||| | ||||||||| || || ||||||||| Sbjct: 1690 acagcagcattgaagttgggttctcgatgtatcccttgaatgctttcagaaattccgcac 1631 Query: 233 ccatggcgccatcaatgacccggtggtcgcagcttagcgtggctgacatgaaggacccga 292 | || |||||||| || |||| |||||| ||||| || || ||||||||||| || || | Sbjct: 1630 cgattgcgccatctataaccctgtggtcacagctcagtgttgctgacatgaatgaaccaa 1571 Query: 293 cttcaaattggccctcaact---ccagggaccaccctcttctcagcagagccaatagcca 349 |||||| || || ||| | ||||| | |||||||||||||||||| ||||| |||| Sbjct: 1570 attcaaactgaccatcagcggaaccaggtatcaccctcttctcagcagaaccaatggcca 1511 Query: 350 agattgccgattggggagggtttacgatggcacagaattgcttgattccgaaagggcctc 409 | ||||| || |||||||| |||| |||||| |||||||| || |||||||| || |||| Sbjct: 1510 aaattgctgactggggaggatttatgatggcgcagaattgtttaattccgaagggacctc 1451 Query: 410 ccagattcgagacggtgaaagtgccaccctcgtaatcttctggttttaggctgttatccc 469 ||| ||| || || ||||| ||||| |||||||||||| ||||||||||||| ||||| | Sbjct: 1450 ccaaatttgatacagtgaaggtgccgccctcgtaatctgctggttttaggctattatctc 1391 Query: 470 ttgctcttagagccaactgcttcacctcatcagcaatagtggccaaccctttcttgtccg 529 |||| ||||||||||||||||||| |||||||| | | | || |||||||| | Sbjct: 1390 ttgcnnnnngagccaactgcttcacctcctcagcaattgcaccgagtcccttcttgtctg 1331 Query: 530 cgtccctaactactggaacgaacaaaccatgctcagtctgtacagcaacattaatgttca 589 | ||||||| ||||||||| ||||| ||||| |||||||||||||| || || ||||||| Sbjct: 1330 catccctaattactggaacaaacaatccatgttcagtctgtacagccacgttgatgttca 1271 Query: 590 cgttgtggtactggcgaataaaatcattcatccaggaactgttacacgcaggaaccttac 649 | |||||||| || |||||||||||||||||||| || ||||||||| ||| ||||| | Sbjct: 1270 cattgtggtattgccgaataaaatcattcatccatgagctgttacactgagggacctttc 1211 Query: 650 gaagagccaacgctgcagccttaatgacaagatcatttatagatatcttcttcccgccag 709 |||| ||||| ||||||||||| |||||||||||||| || ||||| ||||| || |||| Sbjct: 1210 gaagggccaaagctgcagccttgatgacaagatcattaattgatattttctttccaccag 1151 Query: 710 a 710 | Sbjct: 1150 a 1150
>ref|XM_550448.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2201 Score = 242 bits (122), Expect = 1e-60 Identities = 236/274 (86%) Strand = Plus / Minus Query: 437 cctcgtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacct 496 |||| ||||| ||||| || |||||||| ||||||||||| |||||| |||||||||| Sbjct: 1464 cctcataatcctctggcttaaggctgttgtcccttgctctctgagccagttgcttcacct 1405 Query: 497 catcagcaatagtggccaaccctttcttgtccgcgtccctaactactggaacgaacaaac 556 ||||||| |||||||| | || |||||||| || ||||| | ||| ||||| ||||| | Sbjct: 1404 catcagcgatagtggctaggcccttcttgtcagcatcccttattacgggaacaaacaagc 1345 Query: 557 catgctcagtctgtacagcaacattaatgttcacgttgtggtactggcgaataaaatcat 616 ||| |||||| |||||||||||||| |||||||| |||||||| |||||||||||||||| Sbjct: 1344 catcctcagtttgtacagcaacattgatgttcacattgtggtattggcgaataaaatcat 1285 Query: 617 tcatccaggaactgttacacgcaggaaccttacgaagagccaacgctgcagccttaatga 676 ||||||| || || |||||| ||||||| |||||||||||||| ||||| ||||| || | Sbjct: 1284 tcatccaagagctattacactcaggaacattacgaagagccaatgctgcggccttgataa 1225 Query: 677 caagatcatttatagatatcttcttcccgccaga 710 ||||||||||||| ||||||||||| || ||||| Sbjct: 1224 caagatcatttatggatatcttcttgccaccaga 1191 Score = 238 bits (120), Expect = 2e-59 Identities = 231/268 (86%) Strand = Plus / Minus Query: 172 tacagcagcatggtcgtcgggttctcaaggtagctcttgaatgccttgagccattccgca 231 ||||||| ||||||||| || ||||| | ||||| |||||| ||||| | |||||| ||| Sbjct: 1798 tacagcaacatggtcgttggattctcgatgtagcccttgaacgccttcatccattctgca 1739 Query: 232 cccatggcgccatcaatgacccggtggtcgcagcttagcgtggctgacatgaaggacccg 291 || ||||| || ||||||||||||||||||||||| | || |||||||| || || || Sbjct: 1738 ccaatggcaccgtcaatgacccggtggtcgcagctcaatgttgctgacataaacgaacca 1679 Query: 292 acttcaaattggccctcaactccagggaccaccctcttctcagcagagccaatagccaag 351 |||||||| || |||||| ||||||||| ||||||||||||||| |||||||||||||| Sbjct: 1678 acttcaaactgaccctcagctccagggatcaccctcttctcagctgagccaatagccaaa 1619 Query: 352 attgccgattggggagggtttacgatggcacagaattgcttgattccgaaagggcctccc 411 ||||| ||||| ||||| ||||||||||||||||||||||| ||||| |||||||||||| Sbjct: 1618 attgctgattgtggaggatttacgatggcacagaattgcttaattccaaaagggcctccc 1559 Query: 412 agattcgagacggtgaaagtgccaccct 439 | || || || |||||||||||||||| Sbjct: 1558 aagtttgacacagtgaaagtgccaccct 1531
>dbj|AK103793.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033145O03, full insert sequence Length = 2199 Score = 242 bits (122), Expect = 1e-60 Identities = 236/274 (86%) Strand = Plus / Minus Query: 437 cctcgtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacct 496 |||| ||||| ||||| || |||||||| ||||||||||| |||||| |||||||||| Sbjct: 1462 cctcataatcctctggcttaaggctgttgtcccttgctctctgagccagttgcttcacct 1403 Query: 497 catcagcaatagtggccaaccctttcttgtccgcgtccctaactactggaacgaacaaac 556 ||||||| |||||||| | || |||||||| || ||||| | ||| ||||| ||||| | Sbjct: 1402 catcagcgatagtggctaggcccttcttgtcagcatcccttattacgggaacaaacaagc 1343 Query: 557 catgctcagtctgtacagcaacattaatgttcacgttgtggtactggcgaataaaatcat 616 ||| |||||| |||||||||||||| |||||||| |||||||| |||||||||||||||| Sbjct: 1342 catcctcagtttgtacagcaacattgatgttcacattgtggtattggcgaataaaatcat 1283 Query: 617 tcatccaggaactgttacacgcaggaaccttacgaagagccaacgctgcagccttaatga 676 ||||||| || || |||||| ||||||| |||||||||||||| ||||| ||||| || | Sbjct: 1282 tcatccaagagctattacactcaggaacattacgaagagccaatgctgcggccttgataa 1223 Query: 677 caagatcatttatagatatcttcttcccgccaga 710 ||||||||||||| ||||||||||| || ||||| Sbjct: 1222 caagatcatttatggatatcttcttgccaccaga 1189 Score = 238 bits (120), Expect = 2e-59 Identities = 231/268 (86%) Strand = Plus / Minus Query: 172 tacagcagcatggtcgtcgggttctcaaggtagctcttgaatgccttgagccattccgca 231 ||||||| ||||||||| || ||||| | ||||| |||||| ||||| | |||||| ||| Sbjct: 1796 tacagcaacatggtcgttggattctcgatgtagcccttgaacgccttcatccattctgca 1737 Query: 232 cccatggcgccatcaatgacccggtggtcgcagcttagcgtggctgacatgaaggacccg 291 || ||||| || ||||||||||||||||||||||| | || |||||||| || || || Sbjct: 1736 ccaatggcaccgtcaatgacccggtggtcgcagctcaatgttgctgacataaacgaacca 1677 Query: 292 acttcaaattggccctcaactccagggaccaccctcttctcagcagagccaatagccaag 351 |||||||| || |||||| ||||||||| ||||||||||||||| |||||||||||||| Sbjct: 1676 acttcaaactgaccctcagctccagggatcaccctcttctcagctgagccaatagccaaa 1617 Query: 352 attgccgattggggagggtttacgatggcacagaattgcttgattccgaaagggcctccc 411 ||||| ||||| ||||| ||||||||||||||||||||||| ||||| |||||||||||| Sbjct: 1616 attgctgattgtggaggatttacgatggcacagaattgcttaattccaaaagggcctccc 1557 Query: 412 agattcgagacggtgaaagtgccaccct 439 | || || || |||||||||||||||| Sbjct: 1556 aagtttgacacagtgaaagtgccaccct 1529
>gb|AY111798.1| Zea mays CL1480_2 mRNA sequence Length = 659 Score = 141 bits (71), Expect = 4e-30 Identities = 156/186 (83%) Strand = Plus / Minus Query: 321 caccctcttctcagcagagccaatagccaagattgccgattggggagggtttacgatggc 380 |||||||||||| ||||| ||||||||||| ||||| || || ||||| |||| |||||| Sbjct: 195 caccctcttctcggcagaaccaatagccaaaattgctgactgaggaggatttatgatggc 136 Query: 381 acagaattgcttgattccgaaagggcctcccagattcgagacggtgaaagtgccaccctc 440 ||||||||| ||||||||||| || ||||||| || || | ||||| ||||||||||| Sbjct: 135 acagaattgtttgattccgaagggacctcccaagtttgatatcgtgaaggtgccaccctc 76 Query: 441 gtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacctcatc 500 |||||| ||||||||| ||| || || ||||| ||||||||||||||||||| || Sbjct: 75 ataatctgctggttttaagctattgtctcttgcnnnnngagccaactgcttcacctcctc 16 Query: 501 agcaat 506 |||||| Sbjct: 15 agcaat 10 Score = 71.9 bits (36), Expect = 3e-09 Identities = 93/112 (83%) Strand = Plus / Minus Query: 173 acagcagcatggtcgtcgggttctcaaggtagctcttgaatgccttgagccattccgcac 232 |||||||||| | ||||||||||| | ||||| ||||||||| || || ||||||||| Sbjct: 346 acagcagcatcgaagtcgggttctcgatgtagcccttgaatgctttcagaaattccgcac 287 Query: 233 ccatggcgccatcaatgacccggtggtcgcagcttagcgtggctgacatgaa 284 | || || ||||| || |||| |||||| ||||| || |||||||||||||| Sbjct: 286 cgattgcaccatctataaccctgtggtcacagctcagtgtggctgacatgaa 235
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 117 bits (59), Expect = 5e-23 Identities = 92/103 (89%) Strand = Plus / Plus Query: 337 gagccaatagccaagattgccgattggggagggtttacgatggcacagaattgcttgatt 396 |||||||||||||| ||||| ||||| ||||| ||||||||||||||||||||||| ||| Sbjct: 369891 gagccaatagccaaaattgctgattgtggaggatttacgatggcacagaattgcttaatt 369950 Query: 397 ccgaaagggcctcccagattcgagacggtgaaagtgccaccct 439 || ||||||||||||| || || || |||||||||||||||| Sbjct: 369951 ccaaaagggcctcccaagtttgacacagtgaaagtgccaccct 369993 Score = 89.7 bits (45), Expect = 1e-14 Identities = 66/73 (90%) Strand = Plus / Plus Query: 598 tactggcgaataaaatcattcatccaggaactgttacacgcaggaaccttacgaagagcc 657 |||||||||||||||||||||||||| || || |||||| ||||||| |||||||||||| Sbjct: 370376 tactggcgaataaaatcattcatccaagagctattacactcaggaacattacgaagagcc 370435 Query: 658 aacgctgcagcct 670 || ||||| |||| Sbjct: 370436 aatgctgcggcct 370448 Score = 87.7 bits (44), Expect = 5e-14 Identities = 80/92 (86%) Strand = Plus / Plus Query: 244 tcaatgacccggtggtcgcagcttagcgtggctgacatgaaggacccgacttcaaattgg 303 ||||||||||||||||||||||| | || |||||||| || || || |||||||| || Sbjct: 369670 tcaatgacccggtggtcgcagctcaatgttgctgacataaacgaaccaacttcaaactga 369729 Query: 304 ccctcaactccagggaccaccctcttctcagc 335 |||||| ||||||||| ||||||||||||||| Sbjct: 369730 ccctcagctccagggatcaccctcttctcagc 369761 Score = 71.9 bits (36), Expect = 3e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 437 cctcgtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacct 496 |||| ||||| ||||| || |||||||| ||||||||||| |||||| |||||||||| Sbjct: 370060 cctcataatcctctggcttaaggctgttgtcccttgctctctgagccagttgcttcacct 370119 Query: 497 catcagcaatagtggc 512 ||||||| |||||||| Sbjct: 370120 catcagcgatagtggc 370135 Score = 63.9 bits (32), Expect = 7e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 544 ggaacgaacaaaccatgctcagtctgtacagcaacattaatgttcacgttgtggta 599 ||||| ||||| |||| |||||| |||||||||||||| |||||||| |||||||| Sbjct: 370237 ggaacaaacaagccatcctcagtttgtacagcaacattgatgttcacattgtggta 370292 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Plus Query: 676 acaagatcatttatagatatcttcttcccgccaga 710 |||||||||||||| ||||||||||| || ||||| Sbjct: 370613 acaagatcatttatggatatcttcttgccaccaga 370647
>dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0644B06 Length = 194509 Score = 117 bits (59), Expect = 5e-23 Identities = 92/103 (89%) Strand = Plus / Plus Query: 337 gagccaatagccaagattgccgattggggagggtttacgatggcacagaattgcttgatt 396 |||||||||||||| ||||| ||||| ||||| ||||||||||||||||||||||| ||| Sbjct: 79844 gagccaatagccaaaattgctgattgtggaggatttacgatggcacagaattgcttaatt 79903 Query: 397 ccgaaagggcctcccagattcgagacggtgaaagtgccaccct 439 || ||||||||||||| || || || |||||||||||||||| Sbjct: 79904 ccaaaagggcctcccaagtttgacacagtgaaagtgccaccct 79946 Score = 89.7 bits (45), Expect = 1e-14 Identities = 66/73 (90%) Strand = Plus / Plus Query: 598 tactggcgaataaaatcattcatccaggaactgttacacgcaggaaccttacgaagagcc 657 |||||||||||||||||||||||||| || || |||||| ||||||| |||||||||||| Sbjct: 80329 tactggcgaataaaatcattcatccaagagctattacactcaggaacattacgaagagcc 80388 Query: 658 aacgctgcagcct 670 || ||||| |||| Sbjct: 80389 aatgctgcggcct 80401 Score = 87.7 bits (44), Expect = 5e-14 Identities = 80/92 (86%) Strand = Plus / Plus Query: 244 tcaatgacccggtggtcgcagcttagcgtggctgacatgaaggacccgacttcaaattgg 303 ||||||||||||||||||||||| | || |||||||| || || || |||||||| || Sbjct: 79623 tcaatgacccggtggtcgcagctcaatgttgctgacataaacgaaccaacttcaaactga 79682 Query: 304 ccctcaactccagggaccaccctcttctcagc 335 |||||| ||||||||| ||||||||||||||| Sbjct: 79683 ccctcagctccagggatcaccctcttctcagc 79714 Score = 71.9 bits (36), Expect = 3e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 437 cctcgtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacct 496 |||| ||||| ||||| || |||||||| ||||||||||| |||||| |||||||||| Sbjct: 80013 cctcataatcctctggcttaaggctgttgtcccttgctctctgagccagttgcttcacct 80072 Query: 497 catcagcaatagtggc 512 ||||||| |||||||| Sbjct: 80073 catcagcgatagtggc 80088 Score = 63.9 bits (32), Expect = 7e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 544 ggaacgaacaaaccatgctcagtctgtacagcaacattaatgttcacgttgtggta 599 ||||| ||||| |||| |||||| |||||||||||||| |||||||| |||||||| Sbjct: 80190 ggaacaaacaagccatcctcagtttgtacagcaacattgatgttcacattgtggta 80245 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Plus Query: 676 acaagatcatttatagatatcttcttcccgccaga 710 |||||||||||||| ||||||||||| || ||||| Sbjct: 80566 acaagatcatttatggatatcttcttgccaccaga 80600
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 101 bits (51), Expect = 3e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 533 ccctaactactggaacgaacaaaccatgctcagtctgtacagcaacattaatgttcacgt 592 |||||| ||||||||| ||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 292497 ccctaattactggaacaaacaacccatgctcagtctgtacagcaacattgatgttcacgt 292438 Query: 593 tgtggta 599 ||||||| Sbjct: 292437 tgtggta 292431 Score = 91.7 bits (46), Expect = 3e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 437 cctcgtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacct 496 |||| |||||||| ||||||| ||||||||||||||||||| |||||| ||||||||||| Sbjct: 292666 cctcataatcttcaggttttaagctgttatcccttgctctttgagccacctgcttcacct 292607 Query: 497 catcagcaat 506 | |||||||| Sbjct: 292606 cctcagcaat 292597 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Minus Query: 340 ccaatagccaagattgccgattggggagggtttacgatggcacagaattgcttgattccg 399 ||||| ||||||||||| || || ||||| |||| ||||||||||||||| ||||||||| Sbjct: 292838 ccaatggccaagattgctgactgaggaggatttatgatggcacagaattgtttgattccg 292779 Query: 400 aaagggcctcccagattcgagacggtgaaagtgccaccct 439 ||||| ||||| || || || | |||||| ||||| |||| Sbjct: 292778 aaaggacctcctaggtttgatatggtgaatgtgcctccct 292739 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Minus Query: 676 acaagatcatttatagatatcttcttcccgccaga 710 |||||||| || |||||||||||||| |||||||| Sbjct: 292135 acaagatcgttaatagatatcttcttaccgccaga 292101
>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1359_D06 Length = 146805 Score = 101 bits (51), Expect = 3e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 533 ccctaactactggaacgaacaaaccatgctcagtctgtacagcaacattaatgttcacgt 592 |||||| ||||||||| ||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 21281 ccctaattactggaacaaacaacccatgctcagtctgtacagcaacattgatgttcacgt 21222 Query: 593 tgtggta 599 ||||||| Sbjct: 21221 tgtggta 21215 Score = 91.7 bits (46), Expect = 3e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 437 cctcgtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacct 496 |||| |||||||| ||||||| ||||||||||||||||||| |||||| ||||||||||| Sbjct: 21450 cctcataatcttcaggttttaagctgttatcccttgctctttgagccacctgcttcacct 21391 Query: 497 catcagcaat 506 | |||||||| Sbjct: 21390 cctcagcaat 21381 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Minus Query: 340 ccaatagccaagattgccgattggggagggtttacgatggcacagaattgcttgattccg 399 ||||| ||||||||||| || || ||||| |||| ||||||||||||||| ||||||||| Sbjct: 21622 ccaatggccaagattgctgactgaggaggatttatgatggcacagaattgtttgattccg 21563 Query: 400 aaagggcctcccagattcgagacggtgaaagtgccaccct 439 ||||| ||||| || || || | |||||| ||||| |||| Sbjct: 21562 aaaggacctcctaggtttgatatggtgaatgtgcctccct 21523 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Minus Query: 676 acaagatcatttatagatatcttcttcccgccaga 710 |||||||| || |||||||||||||| |||||||| Sbjct: 20919 acaagatcgttaatagatatcttcttaccgccaga 20885
>dbj|AP004049.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1212_C06 Length = 110989 Score = 101 bits (51), Expect = 3e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 533 ccctaactactggaacgaacaaaccatgctcagtctgtacagcaacattaatgttcacgt 592 |||||| ||||||||| ||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 102472 ccctaattactggaacaaacaacccatgctcagtctgtacagcaacattgatgttcacgt 102413 Query: 593 tgtggta 599 ||||||| Sbjct: 102412 tgtggta 102406 Score = 91.7 bits (46), Expect = 3e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 437 cctcgtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacct 496 |||| |||||||| ||||||| ||||||||||||||||||| |||||| ||||||||||| Sbjct: 102641 cctcataatcttcaggttttaagctgttatcccttgctctttgagccacctgcttcacct 102582 Query: 497 catcagcaat 506 | |||||||| Sbjct: 102581 cctcagcaat 102572 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Minus Query: 340 ccaatagccaagattgccgattggggagggtttacgatggcacagaattgcttgattccg 399 ||||| ||||||||||| || || ||||| |||| ||||||||||||||| ||||||||| Sbjct: 102813 ccaatggccaagattgctgactgaggaggatttatgatggcacagaattgtttgattccg 102754 Query: 400 aaagggcctcccagattcgagacggtgaaagtgccaccct 439 ||||| ||||| || || || | |||||| ||||| |||| Sbjct: 102753 aaaggacctcctaggtttgatatggtgaatgtgcctccct 102714 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Minus Query: 676 acaagatcatttatagatatcttcttcccgccaga 710 |||||||| || |||||||||||||| |||||||| Sbjct: 102110 acaagatcgttaatagatatcttcttaccgccaga 102076
>dbj|AP006720.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, clone:OJA1212_C06 Length = 113554 Score = 101 bits (51), Expect = 3e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 533 ccctaactactggaacgaacaaaccatgctcagtctgtacagcaacattaatgttcacgt 592 |||||| ||||||||| ||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 105037 ccctaattactggaacaaacaacccatgctcagtctgtacagcaacattgatgttcacgt 104978 Query: 593 tgtggta 599 ||||||| Sbjct: 104977 tgtggta 104971 Score = 91.7 bits (46), Expect = 3e-15 Identities = 64/70 (91%) Strand = Plus / Minus Query: 437 cctcgtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacct 496 |||| |||||||| ||||||| ||||||||||||||||||| |||||| ||||||||||| Sbjct: 105206 cctcataatcttcaggttttaagctgttatcccttgctctttgagccacctgcttcacct 105147 Query: 497 catcagcaat 506 | |||||||| Sbjct: 105146 cctcagcaat 105137 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Minus Query: 340 ccaatagccaagattgccgattggggagggtttacgatggcacagaattgcttgattccg 399 ||||| ||||||||||| || || ||||| |||| ||||||||||||||| ||||||||| Sbjct: 105378 ccaatggccaagattgctgactgaggaggatttatgatggcacagaattgtttgattccg 105319 Query: 400 aaagggcctcccagattcgagacggtgaaagtgccaccct 439 ||||| ||||| || || || | |||||| ||||| |||| Sbjct: 105318 aaaggacctcctaggtttgatatggtgaatgtgcctccct 105279 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Minus Query: 676 acaagatcatttatagatatcttcttcccgccaga 710 |||||||| || |||||||||||||| |||||||| Sbjct: 104675 acaagatcgttaatagatatcttcttaccgccaga 104641
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 87.7 bits (44), Expect = 5e-14 Identities = 56/60 (93%) Strand = Plus / Plus Query: 540 tactggaacgaacaaaccatgctcagtctgtacagcaacattaatgttcacgttgtggta 599 ||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 12759543 tactggaacaaacagtccatgctcagtctgtacagcaacattgatgttcacgttgtggta 12759602 Score = 75.8 bits (38), Expect = 2e-10 Identities = 62/70 (88%) Strand = Plus / Plus Query: 437 cctcgtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacct 496 |||| ||||| |||||||| | |||||||||||||||||| |||||||||||||||||| Sbjct: 12759378 cctcataatcatctggtttcaaactgttatcccttgctctttgagccaactgcttcacct 12759437 Query: 497 catcagcaat 506 | || ||||| Sbjct: 12759438 cctccgcaat 12759447 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Plus Query: 335 cagagccaatagccaagattgccgattggggagggtttacgatggcacagaattgcttga 394 |||| ||||| |||||||||||||| || ||||| |||| ||||||||| |||||||| | Sbjct: 12759197 cagaaccaatggccaagattgccgactgaggaggatttatgatggcacaaaattgcttaa 12759256 Query: 395 ttccgaaagggcctccca 412 |||| ||||| ||||||| Sbjct: 12759257 ttccaaaaggacctccca 12759274 Score = 73.8 bits (37), Expect = 7e-10 Identities = 64/73 (87%) Strand = Plus / Plus Query: 598 tactggcgaataaaatcattcatccaggaactgttacacgcaggaaccttacgaagagcc 657 |||||||| |||||||||||||||||||| || |||||| ||| ||||| ||||||||| Sbjct: 12759679 tactggcggataaaatcattcatccaggagctattacactgagggacctttcgaagagcc 12759738 Query: 658 aacgctgcagcct 670 | |||||||||| Sbjct: 12759739 agagctgcagcct 12759751
>dbj|AP005325.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0710F09 Length = 198867 Score = 87.7 bits (44), Expect = 5e-14 Identities = 56/60 (93%) Strand = Plus / Plus Query: 540 tactggaacgaacaaaccatgctcagtctgtacagcaacattaatgttcacgttgtggta 599 ||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 17667 tactggaacaaacagtccatgctcagtctgtacagcaacattgatgttcacgttgtggta 17726 Score = 75.8 bits (38), Expect = 2e-10 Identities = 62/70 (88%) Strand = Plus / Plus Query: 437 cctcgtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacct 496 |||| ||||| |||||||| | |||||||||||||||||| |||||||||||||||||| Sbjct: 17502 cctcataatcatctggtttcaaactgttatcccttgctctttgagccaactgcttcacct 17561 Query: 497 catcagcaat 506 | || ||||| Sbjct: 17562 cctccgcaat 17571 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Plus Query: 335 cagagccaatagccaagattgccgattggggagggtttacgatggcacagaattgcttga 394 |||| ||||| |||||||||||||| || ||||| |||| ||||||||| |||||||| | Sbjct: 17321 cagaaccaatggccaagattgccgactgaggaggatttatgatggcacaaaattgcttaa 17380 Query: 395 ttccgaaagggcctccca 412 |||| ||||| ||||||| Sbjct: 17381 ttccaaaaggacctccca 17398 Score = 73.8 bits (37), Expect = 7e-10 Identities = 64/73 (87%) Strand = Plus / Plus Query: 598 tactggcgaataaaatcattcatccaggaactgttacacgcaggaaccttacgaagagcc 657 |||||||| |||||||||||||||||||| || |||||| ||| ||||| ||||||||| Sbjct: 17803 tactggcggataaaatcattcatccaggagctattacactgagggacctttcgaagagcc 17862 Query: 658 aacgctgcagcct 670 | |||||||||| Sbjct: 17863 agagctgcagcct 17875
>dbj|AP004305.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0492E07 Length = 143794 Score = 87.7 bits (44), Expect = 5e-14 Identities = 56/60 (93%) Strand = Plus / Plus Query: 540 tactggaacgaacaaaccatgctcagtctgtacagcaacattaatgttcacgttgtggta 599 ||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 134013 tactggaacaaacagtccatgctcagtctgtacagcaacattgatgttcacgttgtggta 134072 Score = 75.8 bits (38), Expect = 2e-10 Identities = 62/70 (88%) Strand = Plus / Plus Query: 437 cctcgtaatcttctggttttaggctgttatcccttgctcttagagccaactgcttcacct 496 |||| ||||| |||||||| | |||||||||||||||||| |||||||||||||||||| Sbjct: 133848 cctcataatcatctggtttcaaactgttatcccttgctctttgagccaactgcttcacct 133907 Query: 497 catcagcaat 506 | || ||||| Sbjct: 133908 cctccgcaat 133917 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Plus Query: 335 cagagccaatagccaagattgccgattggggagggtttacgatggcacagaattgcttga 394 |||| ||||| |||||||||||||| || ||||| |||| ||||||||| |||||||| | Sbjct: 133667 cagaaccaatggccaagattgccgactgaggaggatttatgatggcacaaaattgcttaa 133726 Query: 395 ttccgaaagggcctccca 412 |||| ||||| ||||||| Sbjct: 133727 ttccaaaaggacctccca 133744 Score = 73.8 bits (37), Expect = 7e-10 Identities = 64/73 (87%) Strand = Plus / Plus Query: 598 tactggcgaataaaatcattcatccaggaactgttacacgcaggaaccttacgaagagcc 657 |||||||| |||||||||||||||||||| || |||||| ||| ||||| ||||||||| Sbjct: 134149 tactggcggataaaatcattcatccaggagctattacactgagggacctttcgaagagcc 134208 Query: 658 aacgctgcagcct 670 | |||||||||| Sbjct: 134209 agagctgcagcct 134221
>ref|NM_112247.2| Arabidopsis thaliana acyltransferase/ dihydrolipoyllysine-residue acetyltransferase/ protein binding AT3G13930 mRNA, complete cds Length = 2147 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Minus Query: 639 aggaaccttacgaagagccaacgctgcagccttaatgacaagatcatttatagatatc 696 |||||| || |||||||||| || ||||||||||| ||||||||||||| ||||||| Sbjct: 1350 aggaacttttcgaagagccagtgcagcagccttaataacaagatcatttacagatatc 1293
>ref|NM_104300.2| Arabidopsis thaliana acyltransferase/ dihydrolipoyllysine-residue acetyltransferase/ protein binding AT1G54220 transcript variant AT1G54220.1 mRNA, complete cds Length = 2018 Score = 60.0 bits (30), Expect = 1e-05 Identities = 72/86 (83%) Strand = Plus / Minus Query: 379 gcacagaattgcttgattccgaaagggcctcccagattcgagacggtgaaagtgccaccc 438 ||||||||||||||||| || ||||| ||||||| || ||||| || || || || ||| Sbjct: 1477 gcacagaattgcttgatgccaaaaggtcctcccaagttagagacagtaaatgttcctccc 1418 Query: 439 tcgtaatcttctggttttaggctgtt 464 || ||||||||||| |||| |||||| Sbjct: 1417 tcataatcttctggctttaagctgtt 1392
>ref|NM_001036109.1| Arabidopsis thaliana acyltransferase/ dihydrolipoyllysine-residue acetyltransferase/ protein binding AT1G54220 transcript variant AT1G54220.2 mRNA, complete cds Length = 2035 Score = 60.0 bits (30), Expect = 1e-05 Identities = 72/86 (83%) Strand = Plus / Minus Query: 379 gcacagaattgcttgattccgaaagggcctcccagattcgagacggtgaaagtgccaccc 438 ||||||||||||||||| || ||||| ||||||| || ||||| || || || || ||| Sbjct: 1511 gcacagaattgcttgatgccaaaaggtcctcccaagttagagacagtaaatgttcctccc 1452 Query: 439 tcgtaatcttctggttttaggctgtt 464 || ||||||||||| |||| |||||| Sbjct: 1451 tcataatcttctggctttaagctgtt 1426
>gb|BT020419.1| Arabidopsis thaliana At1g54220 mRNA, complete cds Length = 1620 Score = 60.0 bits (30), Expect = 1e-05 Identities = 72/86 (83%) Strand = Plus / Minus Query: 379 gcacagaattgcttgattccgaaagggcctcccagattcgagacggtgaaagtgccaccc 438 ||||||||||||||||| || ||||| ||||||| || ||||| || || || || ||| Sbjct: 1409 gcacagaattgcttgatgccaaaaggtcctcccaagttagagacagtaaatgttcctccc 1350 Query: 439 tcgtaatcttctggttttaggctgtt 464 || ||||||||||| |||| |||||| Sbjct: 1349 tcataatcttctggctttaagctgtt 1324
>gb|BT000702.1| Arabidopsis thaliana clone RAFL07-10-F16 (R10941) putative acetyltransferase (At3g13930) mRNA, complete cds Length = 2045 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Minus Query: 639 aggaaccttacgaagagccaacgctgcagccttaatgacaagatcatttatagatatc 696 |||||| || |||||||||| || ||||||||||| ||||||||||||| ||||||| Sbjct: 1291 aggaacttttcgaagagccagtgcagcagccttaataacaagatcatttacagatatc 1234
>gb|BT000444.1| Arabidopsis thaliana putative acetyltransferase (At3g13930) mRNA, complete cds Length = 1946 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Minus Query: 639 aggaaccttacgaagagccaacgctgcagccttaatgacaagatcatttatagatatc 696 |||||| || |||||||||| || ||||||||||| ||||||||||||| ||||||| Sbjct: 1289 aggaacttttcgaagagccagtgcagcagccttaataacaagatcatttacagatatc 1232
>gb|AY092968.1| Arabidopsis thaliana dihydrolipoamide acetyltransferase (At3g13930) mRNA, complete cds Length = 2016 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Minus Query: 639 aggaaccttacgaagagccaacgctgcagccttaatgacaagatcatttatagatatc 696 |||||| || |||||||||| || ||||||||||| ||||||||||||| ||||||| Sbjct: 1343 aggaacttttcgaagagccagtgcagcagccttaataacaagatcatttacagatatc 1286
>gb|AY091691.1| Arabidopsis thaliana AT3g13930/MDC16_5 mRNA, complete cds Length = 1620 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Minus Query: 639 aggaaccttacgaagagccaacgctgcagccttaatgacaagatcatttatagatatc 696 |||||| || |||||||||| || ||||||||||| ||||||||||||| ||||||| Sbjct: 1149 aggaacttttcgaagagccagtgcagcagccttaataacaagatcatttacagatatc 1092
>gb|AF367302.1| Arabidopsis thaliana AT3g13930/MDC16_5 mRNA, complete cds Length = 2001 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Minus Query: 639 aggaaccttacgaagagccaacgctgcagccttaatgacaagatcatttatagatatc 696 |||||| || |||||||||| || ||||||||||| ||||||||||||| ||||||| Sbjct: 1289 aggaacttttcgaagagccagtgcagcagccttaataacaagatcatttacagatatc 1232
>gb|AY033001.1| Arabidopsis thaliana mono-lipoyl E2 mRNA, complete cds; nuclear gene for mitochondrial product Length = 1620 Score = 60.0 bits (30), Expect = 1e-05 Identities = 72/86 (83%) Strand = Plus / Minus Query: 379 gcacagaattgcttgattccgaaagggcctcccagattcgagacggtgaaagtgccaccc 438 ||||||||||||||||| || ||||| ||||||| || ||||| || || || || ||| Sbjct: 1409 gcacagaattgcttgatgccaaaaggtcctcccaagttagagacagtaaatgttcctccc 1350 Query: 439 tcgtaatcttctggttttaggctgtt 464 || ||||||||||| |||| |||||| Sbjct: 1349 tcataatcttctggctttaagctgtt 1324
>gb|BT001223.1| Arabidopsis thaliana putative acetyltransferase (At3g13930) mRNA, complete cds Length = 1687 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Minus Query: 639 aggaaccttacgaagagccaacgctgcagccttaatgacaagatcatttatagatatc 696 |||||| || |||||||||| || ||||||||||| ||||||||||||| ||||||| Sbjct: 1149 aggaacttttcgaagagccagtgcagcagccttaataacaagatcatttacagatatc 1092
>gb|AC140032.4| Medicago truncatula clone mth2-10i23, complete sequence Length = 124302 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 598 tactggcgaataaaatcattcatccaggaactgttacacgcaggaaccttacgaagagcc 657 |||||||||||| | ||||| |||| |||||||||||| |||||| ||||| |||||| Sbjct: 75513 tactggcgaatatagtcatttgtccatgaactgttacactgaggaactttacggagagcc 75454 Query: 658 aacgctgcagcct 670 || || ||||||| Sbjct: 75453 aaagcagcagcct 75441
>gb|AY136410.1| Arabidopsis thaliana dihydrolipoamide S-acetyltransferase, putative (At1g54220) mRNA, complete cds Length = 2018 Score = 56.0 bits (28), Expect = 2e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 379 gcacagaattgcttgattccgaaagggcctcccagattcgagacggtgaaagtgccaccc 438 ||||||||||||||||| || ||||| ||||||| || ||||| || || || || ||| Sbjct: 1477 gcacagaattgcttgatgccaaaaggtcctcccaagttagagacagtaaatgttcctccc 1418 Query: 439 tcgtaatcttctggttttaggctg 462 || ||||||||||| |||| |||| Sbjct: 1417 tcataatcttctggctttaagctg 1394
>gb|AC005287.4| Arabidopsis thaliana chromosome I BAC F20D21 genomic sequence, complete sequence Length = 143186 Score = 44.1 bits (22), Expect = 0.62 Identities = 31/34 (91%) Strand = Plus / Plus Query: 379 gcacagaattgcttgattccgaaagggcctccca 412 ||||||||||||||||| || ||||| ||||||| Sbjct: 18349 gcacagaattgcttgatgccaaaaggtcctccca 18382
>emb|BX005311.8| Zebrafish DNA sequence from clone DKEY-45J13 in linkage group 6, complete sequence Length = 40451 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 663 tgcagccttaatgacaagatcattta 688 |||| ||||||||||||||||||||| Sbjct: 14099 tgcaaccttaatgacaagatcattta 14124
>gb|AC096938.8| Rattus norvegicus 16 BAC CH230-49B24 (Children's Hospital Oakland Research Institute) complete sequence Length = 220401 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 322 accctcttctcagcagagcca 342 ||||||||||||||||||||| Sbjct: 39640 accctcttctcagcagagcca 39620
>gb|AC117058.19| Rattus norvegicus 16 BAC CH230-318I9 (Children's Hospital Oakland Research Institute) complete sequence Length = 181157 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 322 accctcttctcagcagagcca 342 ||||||||||||||||||||| Sbjct: 68692 accctcttctcagcagagcca 68712
>emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete chromosome; segment 6/12 Length = 329100 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 236 tggcgccatcaatgacccggtggtc 260 |||||||||| |||||||||||||| Sbjct: 273591 tggcgccatccatgacccggtggtc 273615
>gb|AC116772.6| Mus musculus chromosome 8, clone RP23-428C21, complete sequence Length = 232691 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 124 aaaaactgctctcatcatcatcatt 148 |||||||||| |||||||||||||| Sbjct: 114381 aaaaactgctatcatcatcatcatt 114405
>emb|AL356600.13| Human DNA sequence from clone RP5-974J14 on chromosome 1p31.2-32.1 Contains part of the NEGR1 gene for neuronal growth regulator 1 and part of a novel gene, complete sequence Length = 131457 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 40 gtttgtttgctcttggttccc 60 ||||||||||||||||||||| Sbjct: 9713 gtttgtttgctcttggttccc 9733
>emb|X79328.1|RNCABP1 R.norvegicus (Wistar) CaBP1 mRNA Length = 1296 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 431 tgccaccctcgtaatcttctggttt 455 ||||||||| ||||||||||||||| Sbjct: 325 tgccaccctggtaatcttctggttt 301
>ref|XM_576132.1| PREDICTED: Rattus norvegicus thioredoxin domain containing 7 (Txndc7), mRNA Length = 2122 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 431 tgccaccctcgtaatcttctggttt 455 ||||||||| ||||||||||||||| Sbjct: 396 tgccaccctggtaatcttctggttt 372
>dbj|AB019229.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MDC16 Length = 84294 Score = 42.1 bits (21), Expect = 2.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 668 ccttaatgacaagatcatttatagatatc 696 ||||||| ||||||||||||| ||||||| Sbjct: 24442 ccttaataacaagatcatttacagatatc 24414
>gb|BC082063.1| Rattus norvegicus protein disulfide isomerase associated 6, mRNA (cDNA clone MGC:95222 IMAGE:7132589), complete cds Length = 1744 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 431 tgccaccctcgtaatcttctggttt 455 ||||||||| ||||||||||||||| Sbjct: 385 tgccaccctggtaatcttctggttt 361
>ref|NM_001004442.1| Rattus norvegicus protein disulfide isomerase associated 6 (Pdia6), mRNA Length = 1744 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 431 tgccaccctcgtaatcttctggttt 455 ||||||||| ||||||||||||||| Sbjct: 385 tgccaccctggtaatcttctggttt 361
>ref|NM_001016432.2| Xenopus tropicalis hypothetical protein LOC549186 (LOC549186), mRNA Length = 2044 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 132 ctctcatcatcatcatttacagca 155 ||||||||||||||| |||||||| Sbjct: 312 ctctcatcatcatcaattacagca 289
>gb|AC110381.5| Mus musculus BAC clone RP24-198I16 from chromosome 10, complete sequence Length = 166554 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 555 accatgctcagtctgtacag 574 |||||||||||||||||||| Sbjct: 147174 accatgctcagtctgtacag 147155
>gb|AC167250.2| Mus musculus BAC clone RP23-69D2 from chromosome 9, complete sequence Length = 221255 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 598 tactggcgaataaaatcatt 617 |||||||||||||||||||| Sbjct: 209983 tactggcgaataaaatcatt 209964
>emb|CT009681.2| Pan troglodytes chromosome X BAC PTB-134F20, complete sequence Length = 180303 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tgtttgtttgctcttggttc 58 |||||||||||||||||||| Sbjct: 57787 tgtttgtttgctcttggttc 57806
>emb|Z54270.1|CEF11C1 Caenorhabditis elegans Cosmid F11C1, complete sequence Length = 40852 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 688 atagatatcttcttcccgcc 707 |||||||||||||||||||| Sbjct: 26047 atagatatcttcttcccgcc 26066
>gb|AC117227.3| Mus musculus BAC clone RP23-380C5 from 13, complete sequence Length = 190816 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 471 tgctcttagagccaactgct 490 |||||||||||||||||||| Sbjct: 15942 tgctcttagagccaactgct 15923
>gb|AC154171.5| Mus musculus BAC clone RP24-259F16 from chromosome 13, complete sequence Length = 173300 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 471 tgctcttagagccaactgct 490 |||||||||||||||||||| Sbjct: 82623 tgctcttagagccaactgct 82604
>gb|AC139154.3| Mus musculus chromosome 7 clone RP24-356B8, complete sequence Length = 164774 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 662 ctgcagccttaatgacaaga 681 |||||||||||||||||||| Sbjct: 106892 ctgcagccttaatgacaaga 106873
>emb|Z70272.1|HSJ30E17 Human DNA sequence from clone RP1-30E17 on chromosome X Contains a ribosomal protein L7a (RPL7A) pseudogene and part of a novel gene, complete sequence Length = 81984 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 tttgtttgctcttggttccc 60 |||||||||||||||||||| Sbjct: 17170 tttgtttgctcttggttccc 17151
>emb|AL390966.14| Human DNA sequence from clone RP11-155I19 on chromosome X, complete sequence Length = 160942 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tgtttgtttgctcttggttc 58 |||||||||||||||||||| Sbjct: 132335 tgtttgtttgctcttggttc 132354
>emb|AL138849.12| Human DNA sequence from clone RP5-965L7 on chromosome 1p32.1-33 Contains the 3' ends of genes FLJ34719 and KIAA0191, complete sequence Length = 127006 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 125 aaaactgctctcatcatcat 144 |||||||||||||||||||| Sbjct: 97752 aaaactgctctcatcatcat 97771
>emb|AL137881.12| Human DNA sequence from clone RP11-40A8 on chromosome 13 Contains a novel gene, the 3' end of the GUCY1B2 gene for guanylate cyclase 1 soluble beta 2 and a CpG island, complete sequence Length = 143324 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 39 tgtttgtttgctcttggttc 58 |||||||||||||||||||| Sbjct: 2647 tgtttgtttgctcttggttc 2628
>emb|AL136134.5| Human DNA sequence from clone RP1-132F20 on chromosome 6, complete sequence Length = 55247 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tgtttgtttgctcttggttc 58 |||||||||||||||||||| Sbjct: 12255 tgtttgtttgctcttggttc 12274
>emb|BX072104.1|CNS09RSS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 609 agcgtggctgacatgaagga 590
>emb|BX072103.1|CNS09RSR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 343 agcgtggctgacatgaagga 362
>emb|BX072102.1|CNS09RSQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 606 agcgtggctgacatgaagga 587
>emb|BX072101.1|CNS09RSP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 351 agcgtggctgacatgaagga 370
>emb|BX072044.1|CNS09RR4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 893 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 591 agcgtggctgacatgaagga 572
>emb|BX072043.1|CNS09RR3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 339 agcgtggctgacatgaagga 358
>emb|BX071900.1|CNS09RN4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 330 agcgtggctgacatgaagga 349
>emb|BX071795.1|CNS09RK7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 614 agcgtggctgacatgaagga 595
>emb|BX071794.1|CNS09RK6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 328 agcgtggctgacatgaagga 347
>emb|BX071773.1|CNS09RJL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 608 agcgtggctgacatgaagga 589
>emb|BX071772.1|CNS09RJK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 331 agcgtggctgacatgaagga 350
>emb|BX071703.1|CNS09RHN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 592 agcgtggctgacatgaagga 573
>emb|BX071702.1|CNS09RHM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 315 agcgtggctgacatgaagga 334
>emb|BX071484.1|CNS09RBK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 598 agcgtggctgacatgaagga 579
>emb|BX071483.1|CNS09RBJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 338 agcgtggctgacatgaagga 357
>emb|BX071109.1|CNS09R15 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 590 agcgtggctgacatgaagga 571
>emb|BX071108.1|CNS09R14 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 330 agcgtggctgacatgaagga 349
>emb|BX071294.1|CNS09R6A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 685 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 313 agcgtggctgacatgaagga 332
>emb|BX070984.1|CNS09QXO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 605 agcgtggctgacatgaagga 586
>emb|BX070983.1|CNS09QXN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 359 agcgtggctgacatgaagga 378
>emb|BX070927.1|CNS09QW3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 599 agcgtggctgacatgaagga 580
>emb|BX070926.1|CNS09QW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 685 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 317 agcgtggctgacatgaagga 336
>emb|BX070787.1|CNS09QS7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 600 agcgtggctgacatgaagga 581
>emb|BX070786.1|CNS09QS6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 344 agcgtggctgacatgaagga 363
>emb|BX070590.1|CNS09QMQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 606 agcgtggctgacatgaagga 587
>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 722 agcgtggctgacatgaagga 741
>emb|BX070475.1|CNS09QJJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7CD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 488 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 305 agcgtggctgacatgaagga 324
>emb|BX070293.1|CNS09QEH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 505 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 323 agcgtggctgacatgaagga 342
>emb|BX070240.1|CNS09QD0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 595 agcgtggctgacatgaagga 576
>emb|BX070239.1|CNS09QCZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 334 agcgtggctgacatgaagga 353
>emb|BX070199.1|CNS09QBV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 594 agcgtggctgacatgaagga 575
>emb|BX069996.1|CNS09Q68 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 590 agcgtggctgacatgaagga 571
>emb|BX069995.1|CNS09Q67 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 331 agcgtggctgacatgaagga 350
>emb|BX069964.1|CNS09Q5C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 426 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 313 agcgtggctgacatgaagga 332
>emb|BX069838.1|CNS09Q1U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 704 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 591 agcgtggctgacatgaagga 572
>emb|BX069837.1|CNS09Q1T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 711 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 314 agcgtggctgacatgaagga 333
>emb|BX069816.1|CNS09Q18 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 608 agcgtggctgacatgaagga 589
>emb|BX069815.1|CNS09Q17 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 707 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 335 agcgtggctgacatgaagga 354
>emb|BX061095.1|CNS09JAZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 587 agcgtggctgacatgaagga 568
>emb|BX061094.1|CNS09JAY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 314 agcgtggctgacatgaagga 333
>emb|BX060930.1|CNS09J6E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 583 agcgtggctgacatgaagga 564
>emb|BX060929.1|CNS09J6D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 509 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 272 agcgtggctgacatgaagga 291
>emb|BX069521.1|CNS09PT1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 612 agcgtggctgacatgaagga 593
>emb|BX069520.1|CNS09PT0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 353 agcgtggctgacatgaagga 372
>emb|BX069417.1|CNS09PQ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 595 agcgtggctgacatgaagga 576
>emb|BX069416.1|CNS09PQ4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 284 agcgtggctgacatgaagga 303
>emb|BX069166.1|CNS09PJ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 267 agcgtggctgacatgaagga 286
>emb|BX069144.1|CNS09PIK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 294 agcgtggctgacatgaagga 313
>emb|BX069128.1|CNS09PI4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 332 agcgtggctgacatgaagga 351
>emb|BX069125.1|CNS09PI1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 602 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 576 agcgtggctgacatgaagga 557
>emb|BX069124.1|CNS09PI0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 710 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 328 agcgtggctgacatgaagga 347
>emb|BX069070.1|CNS09PGI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 335 agcgtggctgacatgaagga 354
>emb|BX069043.1|CNS09PFR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 616 agcgtggctgacatgaagga 597
>emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 337 agcgtggctgacatgaagga 356
>emb|BX069033.1|CNS09PFH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 609 agcgtggctgacatgaagga 590
>emb|BX069032.1|CNS09PFG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 316 agcgtggctgacatgaagga 335
>emb|BX069017.1|CNS09PF1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 665 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 612 agcgtggctgacatgaagga 593
>emb|BX069016.1|CNS09PF0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 330 agcgtggctgacatgaagga 349
>emb|BX068852.1|CNS09PAG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 624 agcgtggctgacatgaagga 605
>emb|BX068851.1|CNS09PAF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 349 agcgtggctgacatgaagga 368
>emb|BX068818.1|CNS09P9I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 848 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 607 agcgtggctgacatgaagga 588
>emb|BX068817.1|CNS09P9H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 848 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 324 agcgtggctgacatgaagga 343
>emb|BX068776.1|CNS09P8C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 299 agcgtggctgacatgaagga 318
>emb|BX068622.1|CNS09P42 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 387 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 315 agcgtggctgacatgaagga 334
>emb|BX068497.1|CNS09P0L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 326 agcgtggctgacatgaagga 345
>emb|BX068480.1|CNS09P04 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 637 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 584 agcgtggctgacatgaagga 565
>emb|BX068479.1|CNS09P03 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 285 agcgtggctgacatgaagga 304
>emb|BX068124.1|CNS09OQ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 622 agcgtggctgacatgaagga 603
>emb|BX068123.1|CNS09OQ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 346 agcgtggctgacatgaagga 365
>emb|BX068046.1|CNS09OO2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 606 agcgtggctgacatgaagga 587
>emb|BX068045.1|CNS09OO1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 674 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 336 agcgtggctgacatgaagga 355
>emb|BX067898.1|CNS09OJY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1007 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 610 agcgtggctgacatgaagga 591
>emb|BX067672.1|CNS09ODO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 306 agcgtggctgacatgaagga 325
>emb|BX067486.1|CNS09O8I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 586 agcgtggctgacatgaagga 567
>emb|BX067485.1|CNS09O8H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 323 agcgtggctgacatgaagga 342
>emb|BX067448.1|CNS09O7G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 632 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 355 agcgtggctgacatgaagga 336
>emb|BX067447.1|CNS09O7F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 331 agcgtggctgacatgaagga 350
>emb|BX067015.1|CNS09NVF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 591 agcgtggctgacatgaagga 572
>emb|BX067014.1|CNS09NVE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 324 agcgtggctgacatgaagga 343
>emb|BX066921.1|CNS09NST Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 474 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 336 agcgtggctgacatgaagga 355
>emb|BX067271.1|CNS09O2J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 319 agcgtggctgacatgaagga 338
>emb|BX067265.1|CNS09O2D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 337 agcgtggctgacatgaagga 356
>emb|BX067249.1|CNS09O1X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 590 agcgtggctgacatgaagga 571
>emb|BX067248.1|CNS09O1W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 306 agcgtggctgacatgaagga 325
>emb|BX067222.1|CNS09O16 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 595 agcgtggctgacatgaagga 576
>emb|BX067221.1|CNS09O15 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 332 agcgtggctgacatgaagga 351
>emb|BX067182.1|CNS09O02 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 594 agcgtggctgacatgaagga 575
>emb|BX067181.1|CNS09O01 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 340 agcgtggctgacatgaagga 359
>emb|BX066729.1|CNS09NNH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 802 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 351 agcgtggctgacatgaagga 370
>emb|BX066570.1|CNS09NJ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 554 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 220 agcgtggctgacatgaagga 201
>emb|BX066569.1|CNS09NJ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 331 agcgtggctgacatgaagga 350
>emb|BX066542.1|CNS09NIA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 600 agcgtggctgacatgaagga 581
>emb|BX066541.1|CNS09NI9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 332 agcgtggctgacatgaagga 351
>emb|BX066194.1|CNS09N8M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 310 agcgtggctgacatgaagga 329
>emb|BX066150.1|CNS09N7E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 335 agcgtggctgacatgaagga 354
>emb|BX066095.1|CNS09N5V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 312 agcgtggctgacatgaagga 331
>emb|BX065974.1|CNS09N2I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5AD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 643 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 600 agcgtggctgacatgaagga 581
>emb|BX065973.1|CNS09N2H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 735 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 270 agcgtggctgacatgaagga 289
>emb|BX065830.1|CNS09MYI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 699 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 325 agcgtggctgacatgaagga 344
>emb|BX065805.1|CNS09MXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 713 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 607 agcgtggctgacatgaagga 588
>emb|BX065804.1|CNS09MXS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 607 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 341 agcgtggctgacatgaagga 360
>emb|BX065733.1|CNS09MVT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 748 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 267 agcgtggctgacatgaagga 286
>emb|BX065586.1|CNS09MRQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 973 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 320 agcgtggctgacatgaagga 339
>emb|BX065527.1|CNS09MQ3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 607 agcgtggctgacatgaagga 588
>emb|BX065526.1|CNS09MQ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 332 agcgtggctgacatgaagga 351
>emb|BX065395.1|CNS09MMF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 577 agcgtggctgacatgaagga 558
>emb|BX065394.1|CNS09MME Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 312 agcgtggctgacatgaagga 331
>emb|BX065268.1|CNS09MIW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49AD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 588 agcgtggctgacatgaagga 569
>emb|BX065267.1|CNS09MIV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 321 agcgtggctgacatgaagga 340
>emb|BX064786.1|CNS09M5I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 793 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 306 agcgtggctgacatgaagga 325
>emb|BX064593.1|CNS09M05 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 341 agcgtggctgacatgaagga 360
>emb|BX064578.1|CNS09LZQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 652 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 286 agcgtggctgacatgaagga 305
>emb|BX064559.1|CNS09LZ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 680 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 589 agcgtggctgacatgaagga 570
>emb|BX064558.1|CNS09LZ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 834 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 339 agcgtggctgacatgaagga 358
>emb|BX064318.1|CNS09LSI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 606 agcgtggctgacatgaagga 587
>emb|BX064317.1|CNS09LSH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 346 agcgtggctgacatgaagga 365
>emb|BX064256.1|CNS09LQS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 908 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 328 agcgtggctgacatgaagga 347
>emb|BX064193.1|CNS09LP1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 889 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 578 agcgtggctgacatgaagga 559
>emb|BX064192.1|CNS09LP0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 330 agcgtggctgacatgaagga 349
>emb|BX064097.1|CNS09LMD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1000 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 605 agcgtggctgacatgaagga 586
>emb|BX064096.1|CNS09LMC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 997 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 337 agcgtggctgacatgaagga 356
>emb|BX064002.1|CNS09LJQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 735 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 585 agcgtggctgacatgaagga 566
>emb|BX064001.1|CNS09LJP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 331 agcgtggctgacatgaagga 350
>emb|BX063585.1|CNS09L85 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 132 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 107 agcgtggctgacatgaagga 126
>emb|BX063528.1|CNS09L6K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 465 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 314 agcgtggctgacatgaagga 333
>emb|BX063517.1|CNS09L69 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 720 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 435 agcgtggctgacatgaagga 416
>emb|BX063516.1|CNS09L68 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 316 agcgtggctgacatgaagga 335
>emb|BX063197.1|CNS09KXD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 594 agcgtggctgacatgaagga 575
>emb|BX063196.1|CNS09KXC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 342 agcgtggctgacatgaagga 361
>emb|BX063195.1|CNS09KXB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 587 agcgtggctgacatgaagga 568
>emb|BX063194.1|CNS09KXA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 341 agcgtggctgacatgaagga 360
>emb|BX063139.1|CNS09KVR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 336 agcgtggctgacatgaagga 355
>emb|BX063130.1|CNS09KVI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 617 agcgtggctgacatgaagga 598
>emb|BX063129.1|CNS09KVH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 266 agcgtggctgacatgaagga 285
>emb|BX063083.1|CNS09KU7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44CH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1044 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 380 agcgtggctgacatgaagga 399
>emb|BX062737.1|CNS09KKL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 346 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 327 agcgtggctgacatgaagga 346
>emb|BX062398.1|CNS09KB6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 601 agcgtggctgacatgaagga 582
>emb|BX062397.1|CNS09KB5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 330 agcgtggctgacatgaagga 349
>emb|BX062345.1|CNS09K9P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 589 agcgtggctgacatgaagga 570
>emb|BX062344.1|CNS09K9O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 283 agcgtggctgacatgaagga 302
>emb|BX062249.1|CNS09K71 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 596 agcgtggctgacatgaagga 577
>emb|BX062248.1|CNS09K70 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 322 agcgtggctgacatgaagga 341
>emb|BX062217.1|CNS09K65 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 594 agcgtggctgacatgaagga 575
>emb|BX061945.1|CNS09JYL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 538 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 295 agcgtggctgacatgaagga 314
>emb|BX061917.1|CNS09JXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 586 agcgtggctgacatgaagga 567
>emb|BX061916.1|CNS09JXS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 310 agcgtggctgacatgaagga 329
>emb|BX061583.1|CNS09JOJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 727 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 319 agcgtggctgacatgaagga 338
>emb|BX061299.1|CNS09JGN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42AB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 602 agcgtggctgacatgaagga 583
>emb|BX061298.1|CNS09JGM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 310 agcgtggctgacatgaagga 329
>emb|BX060631.1|CNS09IY3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 570 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 453 agcgtggctgacatgaagga 434
>emb|BX060522.1|CNS09IV2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 580 agcgtggctgacatgaagga 561
>emb|BX060521.1|CNS09IV1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 324 agcgtggctgacatgaagga 343
>emb|BX060463.1|CNS09ITF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 663 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 590 agcgtggctgacatgaagga 571
>emb|BX060462.1|CNS09ITE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 831 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 325 agcgtggctgacatgaagga 344
>emb|BX060432.1|CNS09ISK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 596 agcgtggctgacatgaagga 577
>emb|BX060431.1|CNS09ISJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 325 agcgtggctgacatgaagga 344
>emb|BX060386.1|CNS09IRA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 790 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 603 agcgtggctgacatgaagga 584
>emb|BX060385.1|CNS09IR9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 737 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 346 agcgtggctgacatgaagga 365
>emb|BX060142.1|CNS09IKI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 559 agcgtggctgacatgaagga 540
>emb|BX060141.1|CNS09IKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 309 agcgtggctgacatgaagga 328
>emb|BX059767.1|CNS09IA3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 852 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 606 agcgtggctgacatgaagga 587
>emb|BX059766.1|CNS09IA2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 330 agcgtggctgacatgaagga 349
>emb|BX059737.1|CNS09I99 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 907 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 315 agcgtggctgacatgaagga 334
>emb|BX059721.1|CNS09I8T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 318 agcgtggctgacatgaagga 337
>emb|BX059691.1|CNS09I7Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 500 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 310 agcgtggctgacatgaagga 329
>emb|BX059325.1|CNS09HXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 613 agcgtggctgacatgaagga 594
>emb|BX059252.1|CNS09HVS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 628 agcgtggctgacatgaagga 609
>emb|BX059251.1|CNS09HVR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 324 agcgtggctgacatgaagga 343
>emb|BX059147.1|CNS09HSV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 607 agcgtggctgacatgaagga 588
>emb|BX059146.1|CNS09HSU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 343 agcgtggctgacatgaagga 362
>emb|BX059121.1|CNS09HS5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 324 agcgtggctgacatgaagga 343
>emb|BX059021.1|CNS09HPD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 798 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 579 agcgtggctgacatgaagga 560
>emb|BX059020.1|CNS09HPC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 318 agcgtggctgacatgaagga 337
>emb|BX058945.1|CNS09HN9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 621 agcgtggctgacatgaagga 602
>emb|BX058944.1|CNS09HN8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 350 agcgtggctgacatgaagga 369
>emb|BX058923.1|CNS09HMN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 577 agcgtggctgacatgaagga 558
>emb|BX058922.1|CNS09HMM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 309 agcgtggctgacatgaagga 328
>emb|BX058853.1|CNS09HKP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 308 agcgtggctgacatgaagga 327
>emb|BX058608.1|CNS09HDW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 449 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 315 agcgtggctgacatgaagga 334
>emb|BX058465.1|CNS09H9X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 343 agcgtggctgacatgaagga 362
>emb|BX056668.1|CNS09FW0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 327 agcgtggctgacatgaagga 346
>emb|BX057945.1|CNS09GVH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38AE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 741 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 591 agcgtggctgacatgaagga 572
>emb|BX057944.1|CNS09GVG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38AE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 329 agcgtggctgacatgaagga 348
>emb|BX057829.1|CNS09GS9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 876 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 319 agcgtggctgacatgaagga 338
>emb|BX057649.1|CNS09GN9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 732 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 621 agcgtggctgacatgaagga 602
>emb|BX057648.1|CNS09GN8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 351 agcgtggctgacatgaagga 370
>emb|BX057637.1|CNS09GMX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 621 agcgtggctgacatgaagga 602
>emb|BX057636.1|CNS09GMW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 317 agcgtggctgacatgaagga 336
>emb|BX057621.1|CNS09GMH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 381 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 329 agcgtggctgacatgaagga 348
>emb|BX057549.1|CNS09GKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 610 agcgtggctgacatgaagga 591
>emb|BX057548.1|CNS09GKG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 320 agcgtggctgacatgaagga 339
>emb|BX057427.1|CNS09GH3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 668 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 agcgtggctgacatgaagga 287 |||||||||||||||||||| Sbjct: 326 agcgtggctgacatgaagga 345 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,139,763 Number of Sequences: 3902068 Number of extensions: 6139763 Number of successful extensions: 128784 Number of sequences better than 10.0: 585 Number of HSP's better than 10.0 without gapping: 585 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 127873 Number of HSP's gapped (non-prelim): 908 length of query: 711 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 688 effective length of database: 17,143,297,704 effective search space: 11794588820352 effective search space used: 11794588820352 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
