ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags10a11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein ... 381 e-102
2gb|AF479033.1| Triticum aestivum 40S ribosomal protein mRNA, par... 293 2e-76
3gb|AY107461.1| Zea mays PCO108959 mRNA sequence 149 7e-33
4ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0... 137 3e-29
5dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clon... 137 3e-29
6dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clon... 137 3e-29
7ref|NM_122944.2| Arabidopsis thaliana structural constituent of ... 109 6e-21
8gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 109 6e-21
9gb|AY098949.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, comp... 109 6e-21
10gb|AY058057.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, comp... 109 6e-21
11dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 109 6e-21
12gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome... 109 6e-21
13gb|AY084320.1| Arabidopsis thaliana clone 10394 mRNA, complete s... 109 6e-21
14dbj|AB091077.1| Zinnia elegans ZeRPS3 mRNA for putative ribosoma... 101 2e-18
15gb|AY106013.1| Zea mays PCO066457 mRNA sequence 90 6e-15
16dbj|AB015477.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 84 4e-13
17gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA 78 2e-11
18ref|XM_479106.1| Oryza sativa (japonica cultivar-group), mRNA 74 3e-10
19dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
20emb|BX831845.1|CNS0A14G Arabidopsis thaliana Full-length cDNA Co... 72 1e-09
21gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence 70 5e-09
22gb|DQ294256.1| Solanum tuberosum clone 084G12 40S ribosomal prot... 70 5e-09
23dbj|AP004944.1| Lotus japonicus genomic DNA, chromosome 1, clone... 62 1e-06
24ref|NM_128718.3| Arabidopsis thaliana structural constituent of ... 60 5e-06
25gb|AY091208.1| Arabidopsis thaliana putative 40S ribosomal prote... 60 5e-06
26gb|AY046041.1| Arabidopsis thaliana putative 40S ribosomal prote... 60 5e-06
27gb|AC007071.7| Arabidopsis thaliana chromosome 2 clone T9H9 map ... 60 5e-06
28gb|AY081517.1| Arabidopsis thaliana 40S ribosomal protein; conta... 60 5e-06
29gb|AY054622.1| Arabidopsis thaliana 40S ribosomal protein (At2g3... 60 5e-06
30gb|AY052749.1| Arabidopsis thaliana At2g31610/T9H9.13 mRNA, comp... 60 5e-06
31gb|AF378887.1|AF378887 Arabidopsis thaliana At2g31610/T9H9.13 mR... 60 5e-06
32emb|BX819975.1|CNS0A8H0 Arabidopsis thaliana Full-length cDNA Co... 60 5e-06
33ref|NM_115247.2| Arabidopsis thaliana nucleic acid binding / str... 56 8e-05
34gb|AY059090.1| Arabidopsis thaliana putative ribosomal protein S... 56 8e-05
35gb|AY035022.1| Arabidopsis thaliana putative ribosomal protein S... 56 8e-05
36emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BA... 56 8e-05
37gb|AF428405.1|AF428405 Arabidopsis thaliana AT3g53870/F5K20_170 ... 56 8e-05
38emb|BX824880.1|CNS0A5OP Arabidopsis thaliana Full-length cDNA Co... 56 8e-05
39emb|BX823126.1|CNS0A5V8 Arabidopsis thaliana Full-length cDNA Co... 56 8e-05
40gb|AY088808.1| Arabidopsis thaliana clone 9568 mRNA, complete se... 56 8e-05
41emb|BX820098.1|CNS0A8HS Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
42ref|XM_754010.1| Ustilago maydis 521 hypothetical protein (UM029... 48 0.020
43gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb002... 48 0.020
44dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.020
45dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic D... 48 0.020
46dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.020
47gb|AY394937.1| Danio rerio clone RK045A1H03 ribosomal protein S3... 46 0.078
48ref|XM_566546.1| Cryptococcus neoformans var. neoformans JEC21 r... 46 0.078
49ref|NM_201153.1| Danio rerio ribosomal protein S3 (rps3), mRNA 46 0.078
50gb|BC045902.1| Danio rerio ribosomal protein S3, mRNA (cDNA clon... 46 0.078
51ref|XM_745219.1| Aspergillus fumigatus Af293 40s ribosomal prote... 44 0.31
52gb|BC061265.1| Xenopus tropicalis ribosomal protein S3, mRNA (cD... 42 1.2
53emb|V01441.1|XLRIB4 Fragment of Xenopus laevis mRNA for ribosoma... 42 1.2
54gb|AF402810.1| Ictalurus punctatus 40S ribosomal protein S3 mRNA... 42 1.2
55ref|NM_203788.1| Xenopus tropicalis ribosomal protein S3 (MGC756... 42 1.2
56dbj|D38596.1|RICRPS3A Oryza sativa mRNA, partial homologous to ... 42 1.2
57emb|Z34529.1|XLRIBS1R X.laevis rpS1b mRNA for ribosomal protein S1 42 1.2
58emb|CR848247.2| Xenopus tropicalis finished cDNA, clone TTpA010a01 42 1.2
59gb|DQ206605.1| Monosiga brevicollis isolate TOA26 ribosomal prot... 42 1.2
60ref|XM_527224.1| PREDICTED: Pan troglodytes similar to ribosomal... 40 4.8
61gb|BC078664.1| Homo sapiens cDNA clone IMAGE:3941503, containing... 40 4.8
62gb|BC034149.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 40 4.8
63gb|BC003137.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 40 4.8
64gb|BC100284.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 40 4.8
65gb|BC017103.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 40 4.8
66gb|BC029981.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 40 4.8
67gb|AC093458.6| Homo sapiens BAC clone RP11-445N20 from 7, comple... 40 4.8
68ref|NM_001005.3| Homo sapiens ribosomal protein S3 (RPS3), mRNA 40 4.8
69ref|XM_784326.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 4.8
70ref|XM_502846.1| Yarrowia lipolytica CLIB122, YALI0D15114g predi... 40 4.8
71gb|AC134516.1| Oryza sativa (japonica cultivar-group) chromosome... 40 4.8
72ref|XM_788097.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 4.8
73emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone ... 40 4.8
74emb|CR861393.1| Pongo pygmaeus mRNA; cDNA DKFZp459J022 (from clo... 40 4.8
75gb|AC007286.18| Homo sapiens 12q15 BAC RPCI11-298M11 (Roswell Pa... 40 4.8
76emb|CR623585.1| full-length cDNA clone CS0DA007YC19 of Neuroblas... 40 4.8
77emb|CR620902.1| full-length cDNA clone CS0DJ012YN02 of T cells (... 40 4.8
78emb|CR620201.1| full-length cDNA clone CS0DL012YJ20 of B cells (... 40 4.8
79emb|CR619698.1| full-length cDNA clone CS0DL005YA23 of B cells (... 40 4.8
80emb|CR617487.1| full-length cDNA clone CS0DK010YL21 of HeLa cell... 40 4.8
81emb|CR611679.1| full-length cDNA clone CS0DB002YE09 of Neuroblas... 40 4.8
82emb|CR610898.1| full-length cDNA clone CS0DD004YP10 of Neuroblas... 40 4.8
83emb|CR610850.1| full-length cDNA clone CS0DH003YE11 of T cells (... 40 4.8
84emb|CR611021.1| full-length cDNA clone CS0DL002YG06 of B cells (... 40 4.8
85emb|CR609618.1| full-length cDNA clone CS0DI083YP04 of Placenta ... 40 4.8
86emb|CR607881.1| full-length cDNA clone CS0DF032YC19 of Fetal bra... 40 4.8
87emb|CR608382.1| full-length cDNA clone CS0DM008YP04 of Fetal liv... 40 4.8
88emb|CR606914.1| full-length cDNA clone CS0DN003YN07 of Adult bra... 40 4.8
89emb|CR599459.1| full-length cDNA clone CS0DA012YB22 of Neuroblas... 40 4.8
90emb|CR599018.1| full-length cDNA clone CS0DK010YN19 of HeLa cell... 40 4.8
91emb|CR598363.1| full-length cDNA clone CS0CAP007YJ19 of Thymus o... 40 4.8
92emb|CR598084.1| full-length cDNA clone CS0DD009YH06 of Neuroblas... 40 4.8
93emb|CR597126.1| full-length cDNA clone CS0DK011YF16 of HeLa cell... 40 4.8
94emb|CR595698.1| full-length cDNA clone CS0DL005YD17 of B cells (... 40 4.8
95emb|CR593831.1| full-length cDNA clone CS0DI031YM23 of Placenta ... 40 4.8
96emb|CR591204.1| full-length cDNA clone CS0DC019YA14 of Neuroblas... 40 4.8
97gb|AC116926.1| Genomic sequence for Oryza sativa (japonica culti... 40 4.8
98gb|S42658.1| S3 ribosomal protein [human, colon, mRNA, 826 nt] 40 4.8
99gb|BC013196.1|BC013196 Homo sapiens, clone IMAGE:4347401, mRNA, ... 40 4.8
100gb|AC023163.25| Homo sapiens 12 BAC RP11-239B4 (Roswell Park Can... 40 4.8
101gb|BC003577.1|BC003577 Homo sapiens, clone IMAGE:3544292, mRNA, ... 40 4.8
102dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.8
103dbj|AK223048.1| Homo sapiens mRNA for ribosomal protein S3 varia... 40 4.8
104ref|NM_001009239.1| Rattus norvegicus ribosomal protein S3 (Rps3... 40 4.8
105gb|AC131235.4| Homo sapiens 3 BAC RP11-778D9 (Roswell Park Cance... 40 4.8
106ref|XM_575143.1| PREDICTED: Rattus norvegicus similar to 40S rib... 40 4.8
107gb|AY892063.1| Synthetic construct Homo sapiens clone FLH027749.... 40 4.8
108gb|BC071917.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 40 4.8
109gb|AC006582.13|AC006582 Pan troglodytes 12cp12 BAC RPCI43-77C18 ... 40 4.8
110emb|X51536.1|RRRPS3 Rat mRNA for ribosomal protein S3 40 4.8
111emb|CR555302.7| Zebrafish DNA sequence from clone CH211-212C19 i... 40 4.8
112gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 4.8
113emb|AL928672.14| Zebrafish DNA sequence from clone CH211-136O4, ... 40 4.8
114gb|BC013231.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 40 4.8
115gb|U14992.1|HSU14992 Human IMR-90 ribosomal protein S3 (rpS3) mR... 40 4.8
116gb|U14991.1|HSU14991 Human XP2NE ribosomal protein S3 (rpS3) mRN... 40 4.8
117gb|U14990.1|HSU14990 Human XP1PO ribosomal protein S3 (rpS3) mRN... 40 4.8
118emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 40 4.8
119gb|BC088450.1| Rattus norvegicus ribosomal protein S3, mRNA (cDN... 40 4.8
120emb|X55715.1|HSHUMS3 Human Hums3 mRNA for 40S ribosomal protein s3 40 4.8
121gb|AC078872.13| Homo sapiens 12q BAC RP11-542G14 (Roswell Park C... 40 4.8
122dbj|AB062288.1| Homo sapiens OK/SW-cl.26 mRNA for IMR-90 ribosom... 40 4.8 
>gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein S3 mRNA, complete
           cds
          Length = 1004

 Score =  381 bits (192), Expect = e-102
 Identities = 270/297 (90%), Gaps = 2/297 (0%)
 Strand = Plus / Minus

                                                                       
Query: 69  aggtaaccaaacgttgcatagcccac--ttgtcacaaggataggaaacaagctaggacca 126
           |||||||||| ||||||||||||| |  || ||||| |||||| |||| ||||| |||||
Sbjct: 873 aggtaaccaagcgttgcatagccctcgcttatcacagggatagaaaactagctacgacca 814

                                                                       
Query: 127 aaatgatgtgccgnntcatggnctgcttgcactactgggagtttagacctcaatcaaagc 186
           |||||||||| ||  |||||| |||||||| ||||||||| |||||||||||| ||||||
Sbjct: 813 aaatgatgtgacgtttcatggtctgcttgctctactgggactttagacctcaaccaaagc 754

                                                                       
Query: 187 cggggggcgcagctngtcctnctccttcggggggtggatggtgacgaggtcaggcagggg 246
           |||||||||||||| || || |||||||||||||||||||||||||||||||||||| ||
Sbjct: 753 cggggggcgcagctcgttctcctccttcggggggtggatggtgacgaggtcaggcagcgg 694

                                                                       
Query: 247 ggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatacc 306
            |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 693 agtggtagggccaagcttgcccttggggtcccagtcaagcataatcttcaccttgatacc 634

                                                                    
Query: 307 aagaacgccctgtctganaagaacgtgtctaacagctgcatcaatgtactcattgac 363
           ||||||||||||||||| ||||||||| ||||| || |||||||||||||| |||||
Sbjct: 633 aagaacgccctgtctgagaagaacgtgcctaactgcagcatcaatgtactcgttgac 577



 Score = 40.1 bits (20), Expect = 4.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 33  taacatagaagcattacacataaacttt 60
           |||||||| ||||||||||| |||||||
Sbjct: 921 taacatagcagcattacacagaaacttt 894
to top
>gb|AF479033.1| Triticum aestivum 40S ribosomal protein mRNA, partial cds
          Length = 240

 Score =  293 bits (148), Expect = 2e-76
 Identities = 178/189 (94%)
 Strand = Plus / Minus

                                                                       
Query: 169 ttagacctcaatcaaagccggggggcgcagctngtcctnctccttcggggggtggatggt 228
           ||||||||||| ||||||||| |||||||||| ||||| |||||||||||||||||||||
Sbjct: 240 ttagacctcaaccaaagccggtgggcgcagctcgtcctcctccttcggggggtggatggt 181

                                                                       
Query: 229 gacgaggtcaggcaggggggtggtagggccaagtttgcccttggggtcccagtcaagcat 288
           ||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 180 gacaaggtcaggcagcggggtggtagggccaagcttgcccttggggtcccagtcaagcat 121

                                                                       
Query: 289 aatcttcaccttgataccaagaacgccctgtctganaagaacgtgtctaacagctgcatc 348
           ||||||||||||||||||||||||||||||||||| ||||||||| ||||| || |||||
Sbjct: 120 aatcttcaccttgataccaagaacgccctgtctgagaagaacgtgcctaactgcagcatc 61

                    
Query: 349 aatgtactc 357
           |||||||||
Sbjct: 60  aatgtactc 52
to top
>gb|AY107461.1| Zea mays PCO108959 mRNA sequence
          Length = 794

 Score =  149 bits (75), Expect = 7e-33
 Identities = 147/172 (85%)
 Strand = Plus / Minus

                                                                       
Query: 186 ccggggggcgcagctngtcctnctccttcggggggtggatggtgacgaggtcaggcaggg 245
           |||| |||||| ||| |||||  |||||||||| ||||||||| || ||||| || || |
Sbjct: 478 ccggagggcgcggctcgtcctcgtccttcggggtgtggatggtcaccaggtccggaagag 419

                                                                       
Query: 246 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 305
           | ||| | |||||||  |||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 418 gagtgatcgggccaaccttgcccttcgggtcccagtcaagcatgatcttcaccttgatac 359

                                                               
Query: 306 caagaacgccctgtctganaagaacgtgtctaacagctgcatcaatgtactc 357
           | ||||| |||||||||| |||||||||||| ||||| |  |||||||||||
Sbjct: 358 cgagaacaccctgtctgagaagaacgtgtctcacagccgagtcaatgtactc 307
to top
>ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0008D12.4 mRNA
          Length = 1112

 Score =  137 bits (69), Expect = 3e-29
 Identities = 150/178 (84%)
 Strand = Plus / Minus

                                                                       
Query: 186 ccggggggcgcagctngtcctnctccttcggggggtggatggtgacgaggtcaggcaggg 245
           |||| ||||||||||  |||| |||||| || |  |||||||| || || || ||||| |
Sbjct: 780 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 721

                                                                       
Query: 246 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 305
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 720 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 661

                                                                     
Query: 306 caagaacgccctgtctganaagaacgtgtctaacagctgcatcaatgtactcattgac 363
           ||||||| |||||||| |  || |||||||| ||||| |  |||||||||||||||||
Sbjct: 660 caagaacaccctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgac 603
to top
>dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061B16, full
           insert sequence
          Length = 1054

 Score =  137 bits (69), Expect = 3e-29
 Identities = 150/178 (84%)
 Strand = Plus / Minus

                                                                       
Query: 186 ccggggggcgcagctngtcctnctccttcggggggtggatggtgacgaggtcaggcaggg 245
           |||| ||||||||||  |||| |||||| || |  |||||||| || || || ||||| |
Sbjct: 790 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 731

                                                                       
Query: 246 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 305
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 730 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 671

                                                                     
Query: 306 caagaacgccctgtctganaagaacgtgtctaacagctgcatcaatgtactcattgac 363
           ||||||| |||||||| |  || |||||||| ||||| |  |||||||||||||||||
Sbjct: 670 caagaacaccctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgac 613
to top
>dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-G04, full
           insert sequence
          Length = 1084

 Score =  137 bits (69), Expect = 3e-29
 Identities = 150/178 (84%)
 Strand = Plus / Minus

                                                                       
Query: 186 ccggggggcgcagctngtcctnctccttcggggggtggatggtgacgaggtcaggcaggg 245
           |||| ||||||||||  |||| |||||| || |  |||||||| || || || ||||| |
Sbjct: 792 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 733

                                                                       
Query: 246 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 305
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 732 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 673

                                                                     
Query: 306 caagaacgccctgtctganaagaacgtgtctaacagctgcatcaatgtactcattgac 363
           ||||||| |||||||| |  || |||||||| ||||| |  |||||||||||||||||
Sbjct: 672 caagaacaccctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgac 615
to top
>ref|NM_122944.2| Arabidopsis thaliana structural constituent of ribosome AT5G35530
           mRNA, complete cds
          Length = 1028

 Score =  109 bits (55), Expect = 6e-21
 Identities = 84/94 (89%)
 Strand = Plus / Minus

                                                                       
Query: 261 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 320
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 657 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 598

                                             
Query: 321 tganaagaacgtgtctaacagctgcatcaatgta 354
           | | |||||| || ||||| || |||||||||||
Sbjct: 597 taagaagaacatgcctaactgcagcatcaatgta 564
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  109 bits (55), Expect = 6e-21
 Identities = 113/133 (84%)
 Strand = Plus / Plus

                                                                            
Query: 186      ccggggggcgcagctngtcctnctccttcggggggtggatggtgacgaggtcaggcaggg 245
                |||| ||||||||||  |||| |||||| || |  |||||||| || || || ||||| |
Sbjct: 20905760 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 20905819

                                                                            
Query: 246      gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 305
                ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 20905820 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 20905879

                             
Query: 306      caagaacgccctg 318
                ||||||| |||||
Sbjct: 20905880 caagaacaccctg 20905892
to top
>gb|AY098949.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, complete cds
          Length = 747

 Score =  109 bits (55), Expect = 6e-21
 Identities = 84/94 (89%)
 Strand = Plus / Minus

                                                                       
Query: 261 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 320
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 592 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 533

                                             
Query: 321 tganaagaacgtgtctaacagctgcatcaatgta 354
           | | |||||| || ||||| || |||||||||||
Sbjct: 532 taagaagaacatgcctaactgcagcatcaatgta 499
to top
>gb|AY058057.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, complete cds
          Length = 955

 Score =  109 bits (55), Expect = 6e-21
 Identities = 84/94 (89%)
 Strand = Plus / Minus

                                                                       
Query: 261 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 320
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 656 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 597

                                             
Query: 321 tganaagaacgtgtctaacagctgcatcaatgta 354
           | | |||||| || ||||| || |||||||||||
Sbjct: 596 taagaagaacatgcctaactgcagcatcaatgta 563
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  109 bits (55), Expect = 6e-21
 Identities = 113/133 (84%)
 Strand = Plus / Plus

                                                                            
Query: 186      ccggggggcgcagctngtcctnctccttcggggggtggatggtgacgaggtcaggcaggg 245
                |||| ||||||||||  |||| |||||| || |  |||||||| || || || ||||| |
Sbjct: 20898789 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 20898848

                                                                            
Query: 246      gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 305
                ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 20898849 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 20898908

                             
Query: 306      caagaacgccctg 318
                ||||||| |||||
Sbjct: 20898909 caagaacaccctg 20898921
to top
>gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0008D12
             map MAP_LOC, complete sequence
          Length = 167323

 Score =  109 bits (55), Expect = 6e-21
 Identities = 113/133 (84%)
 Strand = Plus / Minus

                                                                         
Query: 186   ccggggggcgcagctngtcctnctccttcggggggtggatggtgacgaggtcaggcaggg 245
             |||| ||||||||||  |||| |||||| || |  |||||||| || || || ||||| |
Sbjct: 17163 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 17104

                                                                         
Query: 246   gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 305
             ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 17103 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 17044

                          
Query: 306   caagaacgccctg 318
             ||||||| |||||
Sbjct: 17043 caagaacaccctg 17031
to top
>gb|AY084320.1| Arabidopsis thaliana clone 10394 mRNA, complete sequence
          Length = 985

 Score =  109 bits (55), Expect = 6e-21
 Identities = 84/94 (89%)
 Strand = Plus / Minus

                                                                       
Query: 261 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 320
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 657 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 598

                                             
Query: 321 tganaagaacgtgtctaacagctgcatcaatgta 354
           | | |||||| || ||||| || |||||||||||
Sbjct: 597 taagaagaacatgcctaactgcagcatcaatgta 564
to top
>dbj|AB091077.1| Zinnia elegans ZeRPS3 mRNA for putative ribosomal protein S3,
           partial cds
          Length = 509

 Score =  101 bits (51), Expect = 2e-18
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 gggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacg 313
           ||||||||||||||  | ||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 172 gggccaagtttgccagtcgggtcccagtcaagcatgatcttaaccttgataccaagaaca 113

                                                             
Query: 314 ccctgtctganaagaacgtgtctaacagctgcatcaatgtactcattgac 363
           |||||||| | ||| |||||||| ||||| |  || |||||||| |||||
Sbjct: 112 ccctgtctaagaagcacgtgtctcacagcagagtcgatgtactctttgac 63
to top
>gb|AY106013.1| Zea mays PCO066457 mRNA sequence
          Length = 819

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 ttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtctg 322
           |||||||| || |||||||| ||||||||||| |||||||||||||| || |||||||| 
Sbjct: 643 ttgccctttggatcccagtccagcataatcttaaccttgataccaagcacaccctgtctc 584

                                           
Query: 323 anaagaacgtgtctaacagctgcatcaatgta 354
           |  ||||| ||||| ||||||| |||||||||
Sbjct: 583 aatagaacatgtctcacagctgaatcaatgta 552
to top
>dbj|AB015477.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOK9
          Length = 87459

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 54/58 (93%)
 Strand = Plus / Plus

                                                                       
Query: 261   gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctg 318
             |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||
Sbjct: 49326 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctg 49383
to top
>gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA
          Length = 938

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                       
Query: 261 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 320
           |||| ||||| || |||||||||||||| ||||| || ||||||||||| |||||||| |
Sbjct: 628 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaagcacgccctgcc 569

                                             
Query: 321 tganaagaacgtgtctaacagctgcatcaatgta 354
           | |  || || || ||||||||||||||||||||
Sbjct: 568 taagtagcacatgcctaacagctgcatcaatgta 535
to top
>ref|XM_479106.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 926

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 ttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtctg 322
           |||||||| || ||||| |||||||||||||| ||||| ||||| || || |||||||| 
Sbjct: 678 ttgcccttcggatcccaatcaagcataatcttgaccttaatacccagcacaccctgtctc 619

                               
Query: 323 anaagaacgtgtctaacagc 342
           | |||||| |||||||||||
Sbjct: 618 agaagaacatgtctaacagc 599
to top
>dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013092O21, full
           insert sequence
          Length = 926

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 ttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtctg 322
           |||||||| || ||||| |||||||||||||| ||||| ||||| || || |||||||| 
Sbjct: 678 ttgcccttcggatcccaatcaagcataatcttgaccttaatacccagcacaccctgtctc 619

                               
Query: 323 anaagaacgtgtctaacagc 342
           | |||||| |||||||||||
Sbjct: 618 agaagaacatgtctaacagc 599
to top
>emb|BX831845.1|CNS0A14G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH33ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/95 (85%), Gaps = 1/95 (1%)
 Strand = Plus / Minus

                                                                       
Query: 261 gtttgcccttggggtcccagtcaagcataatcttcaccttga-taccaagaacgccctgt 319
           ||||||||||||||||||||| |||||| |||||||||||||  || ||| || ||||||
Sbjct: 642 gtttgcccttggggtcccagtaaagcatgatcttcaccttgagaacaaagcacaccctgt 583

                                              
Query: 320 ctganaagaacgtgtctaacagctgcatcaatgta 354
           || | |||||| || || || || |||||||||||
Sbjct: 582 ctaagaagaacatgcctcactgcagcatcaatgta 548
to top
>gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence
          Length = 999

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 261 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 320
           |||| ||||| || |||||||||||||| ||||| || ||||||||||| || ||||| |
Sbjct: 678 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaagcacaccctgcc 619

                                             
Query: 321 tganaagaacgtgtctaacagctgcatcaatgta 354
           | |  ||||| || || |||||||||||||||||
Sbjct: 618 ttagtagaacatgccttacagctgcatcaatgta 585
to top
>gb|DQ294256.1| Solanum tuberosum clone 084G12 40S ribosomal protein-like protein
           mRNA, complete cds
          Length = 968

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                       
Query: 261 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 320
           |||| ||||| || |||||||||||||| ||||| || ||||||||||| |||||||| |
Sbjct: 631 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaagcacgccctgcc 572

                                         
Query: 321 tganaagaacgtgtctaacagctgcatcaa 350
           | |  || || || ||||||||||||||||
Sbjct: 571 taagtagcacatgcctaacagctgcatcaa 542
to top
>dbj|AP004944.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT43B20, TM0117a,
             complete sequence
          Length = 33359

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                
Query: 275   tcccagtcaagcataatcttcaccttgataccaag 309
             |||||||||||||||||||| ||||||||||||||
Sbjct: 28359 tcccagtcaagcataatcttaaccttgataccaag 28393
to top
>ref|NM_128718.3| Arabidopsis thaliana structural constituent of ribosome AT2G31610
           mRNA, complete cds
          Length = 1077

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 262 tttgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 621
to top
>gb|AY091208.1| Arabidopsis thaliana putative 40S ribosomal protein (At2g31610)
           mRNA, complete cds
          Length = 784

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 262 tttgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 550
to top
>gb|AY046041.1| Arabidopsis thaliana putative 40S ribosomal protein; contains
           C-terminal domain (At2g31610) mRNA, complete cds
          Length = 987

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 262 tttgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 621
to top
>gb|AC007071.7| Arabidopsis thaliana chromosome 2 clone T9H9 map nga361, complete
             sequence
          Length = 79734

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 262   tttgcccttggggtcccagtcaagcataatcttcaccttgat 303
             ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 40251 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 40210
to top
>gb|AY081517.1| Arabidopsis thaliana 40S ribosomal protein; contains C-terminal
           domain (At2g31610) mRNA, complete cds
          Length = 863

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 262 tttgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 550
to top
>gb|AY054622.1| Arabidopsis thaliana 40S ribosomal protein (At2g31610; T9H9.13)
           mRNA, complete cds
          Length = 992

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 262 tttgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 621
to top
>gb|AY052749.1| Arabidopsis thaliana At2g31610/T9H9.13 mRNA, complete cds
          Length = 753

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 262 tttgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 550
to top
>gb|AF378887.1|AF378887 Arabidopsis thaliana At2g31610/T9H9.13 mRNA, complete cds
          Length = 956

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 262 tttgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 621
to top
>emb|BX819975.1|CNS0A8H0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS55ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1056

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 262 tttgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 640 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 599
to top
>ref|NM_115247.2| Arabidopsis thaliana nucleic acid binding / structural constituent
           of ribosome AT3G53870 mRNA, complete cds
          Length = 976

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 264 tgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603
to top
>gb|AY059090.1| Arabidopsis thaliana putative ribosomal protein S3a homolog
           (At3g53870) mRNA, complete cds
          Length = 781

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 264 tgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 589 tgcccttagggtcccaatcaagcataaccttcaccttgat 550
to top
>gb|AY035022.1| Arabidopsis thaliana putative ribosomal protein S3a homolog
           (At3g53870) mRNA, complete cds
          Length = 957

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 264 tgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603
to top
>emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BAC clone F5K20
          Length = 119407

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 264   tgcccttggggtcccagtcaagcataatcttcaccttgat 303
             ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 55130 tgcccttagggtcccaatcaagcataaccttcaccttgat 55091
to top
>gb|AF428405.1|AF428405 Arabidopsis thaliana AT3g53870/F5K20_170 mRNA, complete cds
          Length = 926

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 264 tgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603
to top
>emb|BX824880.1|CNS0A5OP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZC06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 883

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 264 tgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 622 tgcccttagggtcccaatcaagcataaccttcaccttgat 583
to top
>emb|BX823126.1|CNS0A5V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZH06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 907

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 264 tgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 625 tgcccttagggtcccaatcaagcataaccttcaccttgat 586
to top
>gb|AY088808.1| Arabidopsis thaliana clone 9568 mRNA, complete sequence
          Length = 970

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 264 tgcccttggggtcccagtcaagcataatcttcaccttgat 303
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 643 tgcccttagggtcccaatcaagcataaccttcaccttgat 604
to top
>emb|BX820098.1|CNS0A8HS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS73ZG08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1228

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 273 ggtcccagtcaagcataatcttcaccttgat 303
           |||||||||||||||| ||||||||||||||
Sbjct: 916 ggtcccagtcaagcatgatcttcaccttgat 886
to top
>ref|XM_754010.1| Ustilago maydis 521 hypothetical protein (UM02956.1) partial mRNA
          Length = 720

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 271 ggggtcccagtcaagcataatcttcaccttgataccaagaacgccctg 318
           |||||||||| |  |||| ||||| ||||||||||||||||| |||||
Sbjct: 552 ggggtcccagccctgcatgatcttgaccttgataccaagaacaccctg 505
to top
>gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb0024A20, complete sequence
          Length = 129838

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 263    ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 306
              |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 122878 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 122835
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 263      ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 306
                |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 24966275 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 24966318
to top
>dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0072I06
          Length = 162411

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                          
Query: 263    ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 306
              |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 149907 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 149950
to top
>dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OSJNBb0018L13
          Length = 131155

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 263  ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 306
            |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 6955 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 6998
to top
>gb|AY394937.1| Danio rerio clone RK045A1H03 ribosomal protein S3 mRNA, complete
           cds
          Length = 821

 Score = 46.1 bits (23), Expect = 0.078
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 270 tggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 320
           |||| ||||||  |||||| |||||||||||||| ||||| || |||||||
Sbjct: 584 tgggatcccagggaagcatgatcttcaccttgattccaagcacaccctgtc 534
to top
>ref|XM_566546.1| Cryptococcus neoformans var. neoformans JEC21 ribosomal protein S3
           (CNA01060) partial mRNA
          Length = 901

 Score = 46.1 bits (23), Expect = 0.078
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 286 cataatcttcaccttgataccaagaacgccctgtctganaagaacgtgtc 335
           ||||||||| ||||||||||| || || ||||||| ||  ||||||||||
Sbjct: 621 cataatcttgaccttgataccgagcacaccctgtcggaggagaacgtgtc 572
to top
>ref|NM_201153.1| Danio rerio ribosomal protein S3 (rps3), mRNA
          Length = 850

 Score = 46.1 bits (23), Expect = 0.078
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 270 tggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 320
           |||| ||||||  |||||| |||||||||||||| ||||| || |||||||
Sbjct: 610 tgggatcccagggaagcatgatcttcaccttgattccaagcacaccctgtc 560
to top
>gb|BC045902.1| Danio rerio ribosomal protein S3, mRNA (cDNA clone MGC:56088
           IMAGE:5410588), complete cds
          Length = 850

 Score = 46.1 bits (23), Expect = 0.078
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 270 tggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 320
           |||| ||||||  |||||| |||||||||||||| ||||| || |||||||
Sbjct: 610 tgggatcccagggaagcatgatcttcaccttgattccaagcacaccctgtc 560
to top
>ref|XM_745219.1| Aspergillus fumigatus Af293 40s ribosomal protein S3 (Afu1g05630)
           partial mRNA
          Length = 801

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 285 gcataatcttcaccttgataccaagaacgccctg 318
           |||| ||||| ||||||||||||||||| |||||
Sbjct: 577 gcatgatcttgaccttgataccaagaacaccctg 544
to top
>gb|BC061265.1| Xenopus tropicalis ribosomal protein S3, mRNA (cDNA clone MGC:75699
           IMAGE:5380544), complete cds
          Length = 882

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 283 aagcataatcttcaccttgataccaagaacgccctgtctga 323
           |||||||||||| |||||||| ||||| || ||||| ||||
Sbjct: 605 aagcataatctttaccttgattccaaggacaccctgcctga 565
to top
>emb|V01441.1|XLRIB4 Fragment of Xenopus laevis mRNA for ribosomal protein S1
          Length = 382

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 283 aagcataatcttcaccttgataccaagaacgccctgtctga 323
           |||||||||||| |||||||| || ||||| ||||| ||||
Sbjct: 190 aagcataatctttaccttgattcccagaacaccctgcctga 150
to top
>gb|AF402810.1| Ictalurus punctatus 40S ribosomal protein S3 mRNA, complete cds
          Length = 799

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 270 tggggtcccagtcaagcataatcttcaccttgatacc 306
           |||||||||||  |||||| ||||| |||||||||||
Sbjct: 588 tggggtcccagggaagcatgatcttaaccttgatacc 552
to top
>ref|NM_203788.1| Xenopus tropicalis ribosomal protein S3 (MGC75699), mRNA
          Length = 882

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 283 aagcataatcttcaccttgataccaagaacgccctgtctga 323
           |||||||||||| |||||||| ||||| || ||||| ||||
Sbjct: 605 aagcataatctttaccttgattccaaggacaccctgcctga 565
to top
>dbj|D38596.1|RICRPS3A Oryza sativa mRNA, partial  homologous to ribosomal protein S3
           coding sequence
          Length = 368

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 267 ccttggggtcccagtcaagcataatcttc 295
           |||||||||||||||| ||||| ||||||
Sbjct: 346 ccttggggtcccagtcgagcatgatcttc 318
to top
>emb|Z34529.1|XLRIBS1R X.laevis rpS1b mRNA for ribosomal protein S1
          Length = 842

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 283 aagcataatcttcaccttgataccaagaacgccctgtctga 323
           |||||||||||| |||||||| || ||||| ||||| ||||
Sbjct: 596 aagcataatctttaccttgattcccagaacaccctgcctga 556
to top
>emb|CR848247.2| Xenopus tropicalis finished cDNA, clone TTpA010a01
          Length = 892

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 283 aagcataatcttcaccttgataccaagaacgccctgtctga 323
           |||||||||||| |||||||| ||||| || ||||| ||||
Sbjct: 576 aagcataatctttaccttgattccaaggacaccctgcctga 536
to top
>gb|DQ206605.1| Monosiga brevicollis isolate TOA26 ribosomal protein 3 small
           subunit mRNA, partial cds
          Length = 572

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 284 agcataatcttcaccttgataccaa 308
           ||||||||||| |||||||||||||
Sbjct: 488 agcataatcttgaccttgataccaa 464
to top
>ref|XM_527224.1| PREDICTED: Pan troglodytes similar to ribosomal protein S3; 40S
            ribosomal protein S3; IMR-90 ribosomal protein S3
            (LOC471846), mRNA
          Length = 1200

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 284  agcataatcttcaccttgataccaagaacgccctgtctga 323
            ||||| |||||||||||||| || || || ||||||||||
Sbjct: 1040 agcatgatcttcaccttgatgcccagcacaccctgtctga 1001
to top
>gb|BC078664.1| Homo sapiens cDNA clone IMAGE:3941503, containing frame-shift errors
          Length = 4397

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                    
Query: 284  agcataatcttcaccttgataccaagaacgccctgtctga 323
            ||||| |||||||||||||| || || || ||||||||||
Sbjct: 2030 agcatgatcttcaccttgatgcccagcacaccctgtctga 2069
to top
>gb|BC034149.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:32779
           IMAGE:4665438), complete cds
          Length = 872

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 599 agcatgatcttcaccttgatgcccagcacaccctgtctga 560
to top
>gb|BC003137.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:3657
           IMAGE:2906158), complete cds
          Length = 832

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 575 agcatgatcttcaccttgatgcccagcacaccctgtctga 536
to top
>gb|BC100284.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:117338
           IMAGE:6160514), complete cds
          Length = 851

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 587 agcatgatcttcaccttgatgcccagcacaccctgtctga 548
to top
>gb|BC017103.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone IMAGE:3503171),
            **** WARNING: chimeric clone ****
          Length = 1651

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 284  agcataatcttcaccttgataccaagaacgccctgtctga 323
            ||||| |||||||||||||| || || || ||||||||||
Sbjct: 1391 agcatgatcttcaccttgatgcccagcacaccctgtctga 1352
to top
>gb|BC029981.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone IMAGE:4705217)
          Length = 774

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 520 agcatgatcttcaccttgatgcccagcacaccctgtctga 481
to top
>gb|AC093458.6| Homo sapiens BAC clone RP11-445N20 from 7, complete sequence
          Length = 16677

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 216   gggggtggatggtgacgaggtcag 239
             |||||||||||||| |||||||||
Sbjct: 12587 gggggtggatggtgccgaggtcag 12610
to top
>ref|NM_001005.3| Homo sapiens ribosomal protein S3 (RPS3), mRNA
          Length = 855

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 599 agcatgatcttcaccttgatgcccagcacaccctgtctga 560
to top
>ref|XM_784326.1| PREDICTED: Strongylocentrotus purpuratus similar to cytosolic
           sialic acid 9-O-acetylesterase homolog (LOC584468),
           partial mRNA
          Length = 1182

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 284 agcataatcttcaccttgatacca 307
           ||||| ||||||||||||||||||
Sbjct: 714 agcattatcttcaccttgatacca 691
to top
>ref|XM_502846.1| Yarrowia lipolytica CLIB122, YALI0D15114g predicted mRNA
          Length = 1758

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 337  aacagctgcatcaatgtact 356
            ||||||||||||||||||||
Sbjct: 1500 aacagctgcatcaatgtact 1481
to top
>gb|AC134516.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OJA1208D02,
             complete sequence
          Length = 131922

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 108   aggaaacaagctaggaccaa 127
             ||||||||||||||||||||
Sbjct: 85738 aggaaacaagctaggaccaa 85719
to top
>ref|XM_788097.1| PREDICTED: Strongylocentrotus purpuratus similar to Sialate
           O-acetylesterase precursor (Sialic acid-specific
           9-O-acetylesterase) (Yolk sac protein 2) (LOC588411),
           mRNA
          Length = 1101

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 284 agcataatcttcaccttgatacca 307
           ||||| ||||||||||||||||||
Sbjct: 354 agcattatcttcaccttgatacca 331
to top
>emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone B8J22
          Length = 75335

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 106  ataggaaacaagctaggacc 125
            ||||||||||||||||||||
Sbjct: 7696 ataggaaacaagctaggacc 7677
to top
>emb|CR861393.1| Pongo pygmaeus mRNA; cDNA DKFZp459J022 (from clone DKFZp459J022)
          Length = 922

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 595 agcatgatcttcaccttgatgcccagcacaccctgtctga 556
to top
>gb|AC007286.18| Homo sapiens 12q15 BAC RPCI11-298M11 (Roswell Park Cancer Institute
             Human BAC Library) complete sequence
          Length = 93001

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    catagaagcattacacataa 55
             ||||||||||||||||||||
Sbjct: 80945 catagaagcattacacataa 80964
to top
>emb|CR623585.1| full-length cDNA clone CS0DA007YC19 of Neuroblastoma of Homo
           sapiens (human)
          Length = 824

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 579 agcatgatcttcaccttgatgcccagcacaccctgtctga 540
to top
>emb|CR620902.1| full-length cDNA clone CS0DJ012YN02 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 817

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 572 agcatgatcttcaccttgatgcccagcacaccctgtctga 533
to top
>emb|CR620201.1| full-length cDNA clone CS0DL012YJ20 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 818

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 573 agcatgatcttcaccttgatgcccagcacaccctgtctga 534
to top
>emb|CR619698.1| full-length cDNA clone CS0DL005YA23 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 830

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctga 546
to top
>emb|CR617487.1| full-length cDNA clone CS0DK010YL21 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 821

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 576 agcatgatcttcaccttgatgcccagcacaccctgtctga 537
to top
>emb|CR611679.1| full-length cDNA clone CS0DB002YE09 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 830

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctga 546
to top
>emb|CR610898.1| full-length cDNA clone CS0DD004YP10 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 796

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctga 546
to top
>emb|CR610850.1| full-length cDNA clone CS0DH003YE11 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1356

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 284  agcataatcttcaccttgataccaagaacgccctgtctga 323
            ||||| |||||||||||||| || || || ||||||||||
Sbjct: 1203 agcatgatcttcaccttgatgcccagcacaccctgtctga 1164
to top
>emb|CR611021.1| full-length cDNA clone CS0DL002YG06 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 817

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 576 agcatgatcttcaccttgatgcccagcacaccctgtctga 537
to top
>emb|CR609618.1| full-length cDNA clone CS0DI083YP04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1307

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 352 agcatgatcttcaccttgatgcccagcacaccctgtctga 313
to top
>emb|CR607881.1| full-length cDNA clone CS0DF032YC19 of Fetal brain of Homo sapiens
           (human)
          Length = 1306

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 586 agcatgatcttcaccttgatgcccagcacaccctgtctga 547
to top
>emb|CR608382.1| full-length cDNA clone CS0DM008YP04 of Fetal liver of Homo sapiens
           (human)
          Length = 830

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctga 546
to top
>emb|CR606914.1| full-length cDNA clone CS0DN003YN07 of Adult brain of Homo sapiens
           (human)
          Length = 836

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 591 agcatgatcttcaccttgatgcccagcacaccctgtctga 552
to top
>emb|CR599459.1| full-length cDNA clone CS0DA012YB22 of Neuroblastoma of Homo
           sapiens (human)
          Length = 814

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctga 546
to top
>emb|CR599018.1| full-length cDNA clone CS0DK010YN19 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 831

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 586 agcatgatcttcaccttgatgcccagcacaccctgtctga 547
to top
>emb|CR598363.1| full-length cDNA clone CS0CAP007YJ19 of Thymus of Homo sapiens
           (human)
          Length = 799

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 587 agcatgatcttcaccttgatgcccagcacaccctgtctga 548
to top
>emb|CR598084.1| full-length cDNA clone CS0DD009YH06 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 825

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 580 agcatgatcttcaccttgatgcccagcacaccctgtctga 541
to top
>emb|CR597126.1| full-length cDNA clone CS0DK011YF16 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 830

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctga 546
to top
>emb|CR595698.1| full-length cDNA clone CS0DL005YD17 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 830

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctga 546
to top
>emb|CR593831.1| full-length cDNA clone CS0DI031YM23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 813

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 568 agcatgatcttcaccttgatgcccagcacaccctgtctga 529
to top
>emb|CR591204.1| full-length cDNA clone CS0DC019YA14 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 803

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 558 agcatgatcttcaccttgatgcccagcacaccctgtctga 519
to top
>gb|AC116926.1| Genomic sequence for Oryza sativa (japonica cultivar-group) cultivar
             Nipponbare clone OJ1341F06, from chromosome 10, complete
             sequence
          Length = 102520

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   aggaaacaagctaggaccaa 127
             ||||||||||||||||||||
Sbjct: 88705 aggaaacaagctaggaccaa 88724
to top
>gb|S42658.1| S3 ribosomal protein [human, colon, mRNA, 826 nt]
          Length = 826

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 577 agcatgatcttcaccttgatgcccagcacaccctgtctga 538
to top
>gb|BC013196.1|BC013196 Homo sapiens, clone IMAGE:4347401, mRNA, partial cds
          Length = 852

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 567 agcatgatcttcaccttgatgcccagcacaccctgtctga 528
to top
>gb|AC023163.25| Homo sapiens 12 BAC RP11-239B4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 122882

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 36    catagaagcattacacataa 55
             ||||||||||||||||||||
Sbjct: 40405 catagaagcattacacataa 40386
to top
>gb|BC003577.1|BC003577 Homo sapiens, clone IMAGE:3544292, mRNA, partial cds
          Length = 826

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 567 agcatgatcttcaccttgatgcccagcacaccctgtctga 528
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 108      aggaaacaagctaggaccaa 127
                ||||||||||||||||||||
Sbjct: 11277750 aggaaacaagctaggaccaa 11277731
to top
>dbj|AK223048.1| Homo sapiens mRNA for ribosomal protein S3 variant, clone: KAT00103
          Length = 922

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 575 agcatgatcttcaccttgatgcccagcacaccctgtctga 536
to top
>ref|NM_001009239.1| Rattus norvegicus ribosomal protein S3 (Rps3), mRNA
          Length = 843

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||| ||||| || || |||||||||||||
Sbjct: 581 agcatgatcttcactttgatgcccagcacgccctgtctga 542
to top
>gb|AC131235.4| Homo sapiens 3 BAC RP11-778D9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 174521

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                     
Query: 284   agcataatcttcaccttgataccaagaacgccctgtctga 323
             ||||| |||||||||||||| || || || ||||||||||
Sbjct: 61535 agcatgatcttcaccttgatgcccagcacaccctgtctga 61574
to top
>ref|XM_575143.1| PREDICTED: Rattus norvegicus similar to 40S ribosomal protein S3
           (LOC499803), mRNA
          Length = 830

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||| ||||| || || |||||||||||||
Sbjct: 587 agcatgatcttcactttgatgcccagcacgccctgtctga 548
to top
>gb|AY892063.1| Synthetic construct Homo sapiens clone FLH027749.01L ribosomal
           protein S3 (RPS3) mRNA, partial cds
          Length = 732

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctga 530
to top
>gb|BC071917.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:88599
           IMAGE:6297012), complete cds
          Length = 839

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 578 agcatgatcttcaccttgatgcccagcacaccctgtctga 539
to top
>gb|AC006582.13|AC006582 Pan troglodytes 12cp12 BAC RPCI43-77C18 (Roswell Park Cancer
            Institute Human BAC Library) complete sequence
          Length = 186092

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 36   catagaagcattacacataa 55
            ||||||||||||||||||||
Sbjct: 7614 catagaagcattacacataa 7633
to top
>emb|X51536.1|RRRPS3 Rat mRNA for ribosomal protein S3
          Length = 817

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||| ||||| || || |||||||||||||
Sbjct: 587 agcatgatcttcactttgatgcccagcacgccctgtctga 548
to top
>emb|CR555302.7| Zebrafish DNA sequence from clone CH211-212C19 in linkage group 10,
              complete sequence
          Length = 202469

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     attaaaatggcagcataaca 37
              ||||||||||||||||||||
Sbjct: 151367 attaaaatggcagcataaca 151386
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 108      aggaaacaagctaggaccaa 127
                ||||||||||||||||||||
Sbjct: 11284190 aggaaacaagctaggaccaa 11284171
to top
>emb|AL928672.14| Zebrafish DNA sequence from clone CH211-136O4, complete sequence
          Length = 187939

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    attaaaatggcagcataaca 37
             ||||||||||||||||||||
Sbjct: 56077 attaaaatggcagcataaca 56096
to top
>gb|BC013231.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone IMAGE:3462987)
          Length = 843

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 587 agcatgatcttcaccttgatgcccagcacaccctgtctga 548
to top
>gb|U14992.1|HSU14992 Human IMR-90 ribosomal protein S3 (rpS3) mRNA, complete cds
          Length = 754

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctga 530
to top
>gb|U14991.1|HSU14991 Human XP2NE ribosomal protein S3 (rpS3) mRNA, complete cds
          Length = 754

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctga 530
to top
>gb|U14990.1|HSU14990 Human XP1PO ribosomal protein S3 (rpS3) mRNA, complete cds
          Length = 754

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctga 530
to top
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 337     aacagctgcatcaatgtact 356
               ||||||||||||||||||||
Sbjct: 1841825 aacagctgcatcaatgtact 1841806
to top
>gb|BC088450.1| Rattus norvegicus ribosomal protein S3, mRNA (cDNA clone MGC:95096
           IMAGE:7126819), complete cds
          Length = 843

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||| ||||| || || |||||||||||||
Sbjct: 581 agcatgatcttcactttgatgcccagcacgccctgtctga 542
to top
>emb|X55715.1|HSHUMS3 Human Hums3 mRNA for 40S ribosomal protein s3
          Length = 833

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 591 agcatgatcttcaccttgatgcccagcacaccctgtctga 552
to top
>gb|AC078872.13| Homo sapiens 12q BAC RP11-542G14 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 166585

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                      
Query: 284    agcataatcttcaccttgataccaagaacgccctgtctga 323
              ||||| |||||||||||||| || || || ||||||||||
Sbjct: 102409 agcatgatcttcaccttgatgcccagcacaccctgtctga 102370
to top
>dbj|AB062288.1| Homo sapiens OK/SW-cl.26 mRNA for IMR-90 ribosomal protein S3,
           complete cds
          Length = 810

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 284 agcataatcttcaccttgataccaagaacgccctgtctga 323
           ||||| |||||||||||||| || || || ||||||||||
Sbjct: 562 agcatgatcttcaccttgatgcccagcacaccctgtctga 523


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,266,679
Number of Sequences: 3902068
Number of extensions: 2266679
Number of successful extensions: 33662
Number of sequences better than 10.0: 122
Number of HSP's better than 10.0 without gapping: 122
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33460
Number of HSP's gapped (non-prelim): 200
length of query: 363
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 341
effective length of database: 17,147,199,772
effective search space: 5847195122252
effective search space used: 5847195122252
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top