| Clone Name | rbags9p14 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC122536.4| Mus musculus BAC clone RP24-542K22 from chromosome 17, complete sequence Length = 150022 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 45 tatttcatgcatgttatgaa 64 |||||||||||||||||||| Sbjct: 26519 tatttcatgcatgttatgaa 26500
>gb|AC122876.4| Mus musculus BAC clone RP23-113K14 from 3, complete sequence Length = 190123 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 gttttcttattcctaaaaca 110 |||||||||||||||||||| Sbjct: 154189 gttttcttattcctaaaaca 154208
>gb|AC119847.12| Mus musculus chromosome 3, clone RP23-46L5, complete sequence Length = 227081 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 gttttcttattcctaaaaca 110 |||||||||||||||||||| Sbjct: 29197 gttttcttattcctaaaaca 29216
>emb|AL358913.4|CNS05TEE Human chromosome 14 DNA sequence BAC R-557C9 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 179862 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 tcttattcctaaaacatggc 114 |||||||||||||||||||| Sbjct: 7805 tcttattcctaaaacatggc 7824
>gb|AC163281.3| Mus musculus BAC clone RP23-443B19 from chromosome 8, complete sequence Length = 197609 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 90 tgttttcttattcctaaaa 108 ||||||||||||||||||| Sbjct: 112825 tgttttcttattcctaaaa 112807
>gb|AC182659.2| Populus trichocarpa clone Pop1-125A14, complete sequence Length = 75970 Score = 38.2 bits (19), Expect = 5.4 Identities = 22/23 (95%) Strand = Plus / Plus Query: 85 tagcatgttttcttattcctaaa 107 |||||||||||| |||||||||| Sbjct: 14312 tagcatgttttcctattcctaaa 14334
>emb|AL109822.1|SPBC409 S.pombe chromosome II cosmid c409 Length = 44865 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 86 agcatgttttcttattcct 104 ||||||||||||||||||| Sbjct: 43332 agcatgttttcttattcct 43314
>gb|AC010698.7| Drosophila melanogaster 3L BAC RP98-15K18 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 174631 Score = 38.2 bits (19), Expect = 5.4 Identities = 28/31 (90%) Strand = Plus / Plus Query: 44 atatttcatgcatgttatgaacctagcaaga 74 |||||||||||| |||||||| |||||||| Sbjct: 149158 atatttcatgcaagttatgaatatagcaaga 149188
>gb|AC105263.2| Drosophila melanogaster 3L BAC RP98-48G3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 153440 Score = 38.2 bits (19), Expect = 5.4 Identities = 28/31 (90%) Strand = Plus / Minus Query: 44 atatttcatgcatgttatgaacctagcaaga 74 |||||||||||| |||||||| |||||||| Sbjct: 137212 atatttcatgcaagttatgaatatagcaaga 137182
>gb|AC079319.19| Homo sapiens 12q BAC RP11-118A3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 152449 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 aagagcaagagtggtagca 89 ||||||||||||||||||| Sbjct: 94340 aagagcaagagtggtagca 94358
>ref|NM_001021382.1| Schizosaccharomyces pombe 972h- elongation factor G (SPBC409.22c), partial mRNA Length = 1677 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 86 agcatgttttcttattcct 104 ||||||||||||||||||| Sbjct: 1534 agcatgttttcttattcct 1552
>gb|AC091696.3| Felis catus clone RP86-117J4, complete sequence Length = 136083 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 85 tagcatgttttcttattcc 103 ||||||||||||||||||| Sbjct: 71651 tagcatgttttcttattcc 71669
>gb|AC096717.3| Homo sapiens BAC clone RP11-10O3 from 4, complete sequence Length = 109027 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 89 atgttttcttattcctaaa 107 ||||||||||||||||||| Sbjct: 25124 atgttttcttattcctaaa 25142
>gb|AC098586.3| Homo sapiens BAC clone RP11-109F18 from 4, complete sequence Length = 150172 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 88 catgttttcttattcctaa 106 ||||||||||||||||||| Sbjct: 26419 catgttttcttattcctaa 26437
>gb|AC092725.3| Homo sapiens chromosome 16 clone RP11-673P17, complete sequence Length = 205399 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 14 aaaacccatacaaaccaat 32 ||||||||||||||||||| Sbjct: 78155 aaaacccatacaaaccaat 78173
>gb|AC026116.26| Homo sapiens 12 BAC RP11-1022B3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 177267 Score = 38.2 bits (19), Expect = 5.4 Identities = 22/23 (95%) Strand = Plus / Plus Query: 91 gttttcttattcctaaaacatgg 113 ||||||||||| ||||||||||| Sbjct: 9243 gttttcttatttctaaaacatgg 9265
>gb|AE003543.4| Drosophila melanogaster chromosome 3L, section 42 of 83 of the complete sequence Length = 276132 Score = 38.2 bits (19), Expect = 5.4 Identities = 28/31 (90%) Strand = Plus / Minus Query: 44 atatttcatgcatgttatgaacctagcaaga 74 |||||||||||| |||||||| |||||||| Sbjct: 123258 atatttcatgcaagttatgaatatagcaaga 123228
>emb|AL833803.8| Mouse DNA sequence from clone RP23-244H7 on chromosome 2, complete sequence Length = 226251 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 93 tttcttattcctaaaacat 111 ||||||||||||||||||| Sbjct: 157188 tttcttattcctaaaacat 157206
>emb|AL117187.7|CNS01DRD Human chromosome 14 DNA sequence BAC R-725G5 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 195835 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 90 tgttttcttattcctaaaa 108 ||||||||||||||||||| Sbjct: 79039 tgttttcttattcctaaaa 79057 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,122,858 Number of Sequences: 3902068 Number of extensions: 1122858 Number of successful extensions: 79943 Number of sequences better than 10.0: 19 Number of HSP's better than 10.0 without gapping: 19 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 79908 Number of HSP's gapped (non-prelim): 35 length of query: 118 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 97 effective length of database: 17,151,101,840 effective search space: 1663656878480 effective search space used: 1663656878480 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)