| Clone Name | rbags9p04 |
|---|---|
| Clone Library Name | barley_pub |
>emb|Z68903.1|SCCPN60 S.cereale cv. Petkus "Halo" encoding cpn60 Length = 1707 Score = 36.2 bits (18), Expect = 2.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 12 aaaacttggttcatgctaccaa 33 |||||||||| ||||||||||| Sbjct: 1564 aaaacttggtccatgctaccaa 1543
>gb|AC022399.15| Homo sapiens chromosome 10 clone RP11-4G18, complete sequence Length = 173064 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 15 acttggttcatgctacca 32 |||||||||||||||||| Sbjct: 88600 acttggttcatgctacca 88617
>gb|AC105925.5| Homo sapiens BAC clone RP11-753I4 from 4, complete sequence Length = 136197 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 15 acttggttcatgctacca 32 |||||||||||||||||| Sbjct: 20364 acttggttcatgctacca 20381
>gb|AC080106.6| Homo sapiens chromosome 11, clone RP11-62J13, complete sequence Length = 157637 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 15 acttggttcatgctacca 32 |||||||||||||||||| Sbjct: 62002 acttggttcatgctacca 62019
>gb|AC007158.10|AC007158 Homo sapiens, clone RP11-90A1, complete sequence Length = 201299 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 12 aaaacttggttcatgcta 29 |||||||||||||||||| Sbjct: 63348 aaaacttggttcatgcta 63331
>gb|AC007092.4| Homo sapiens BAC clone RP11-90D1 from 2, complete sequence Length = 157176 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 12 aaaacttggttcatgcta 29 |||||||||||||||||| Sbjct: 109491 aaaacttggttcatgcta 109508
>dbj|AP000893.5| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-659G9, complete sequence Length = 198024 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 15 acttggttcatgctacca 32 |||||||||||||||||| Sbjct: 88595 acttggttcatgctacca 88612
>dbj|AP001646.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-718B12, complete sequence Length = 182329 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 15 acttggttcatgctacca 32 |||||||||||||||||| Sbjct: 181356 acttggttcatgctacca 181373 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 88,633 Number of Sequences: 3902068 Number of extensions: 88633 Number of successful extensions: 21296 Number of sequences better than 10.0: 8 Number of HSP's better than 10.0 without gapping: 8 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 21286 Number of HSP's gapped (non-prelim): 10 length of query: 33 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 13 effective length of database: 17,155,003,908 effective search space: 223015050804 effective search space used: 223015050804 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)