| Clone Name | rbags9m14 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E03, full insert sequence Length = 1037 Score = 488 bits (246), Expect = e-134 Identities = 368/405 (90%), Gaps = 4/405 (0%) Strand = Plus / Minus Query: 164 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223 |||||||||||||||||||| ||| ||||| | ||||| ||||||||||| |||||||| Sbjct: 854 actctaagtggccttgtcggtcttggcagcggtagcggcggcctggcctctgagacgacc 795 Query: 224 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283 ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || || Sbjct: 794 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 735 Query: 284 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343 ||| || |||||||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 734 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 675 Query: 344 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403 ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| Sbjct: 674 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 615 Query: 404 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463 |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| || Sbjct: 614 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 555 Query: 464 acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcctttgagggtg 523 |||||||||||| ||||| |||||||| ||||||||||| |||||||||| || ||| Sbjct: 554 acggcagctgctggggacaatcttcttggcaccagaggggagcttgatcc--tggatgtg 497 Query: 524 cccgttgtcgggggttgtggctgatgacgatggcgtagtcaccgg 568 ||||| || |||||||||||||||||||||||||||||| |||| Sbjct: 496 -ccgttatc-ggggttgtggctgatgacgatggcgtagtcgccgg 454 Score = 40.1 bits (20), Expect = 7.7 Identities = 41/48 (85%) Strand = Plus / Minus Query: 71 accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 118 |||| |||||| |||||||| || ||| ||||| ||||||||||||| Sbjct: 958 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 911
>dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023063F19, full insert sequence Length = 1072 Score = 488 bits (246), Expect = e-134 Identities = 368/405 (90%), Gaps = 4/405 (0%) Strand = Plus / Minus Query: 164 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223 |||||||||||||||||||||||| ||||| | ||||| ||||||||||| |||||||| Sbjct: 855 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 796 Query: 224 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283 ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || || Sbjct: 795 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 736 Query: 284 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343 ||| || |||||||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 735 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 676 Query: 344 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403 |||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||| Sbjct: 675 ggccacaccacgcaccctaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 616 Query: 404 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463 |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| || Sbjct: 615 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 556 Query: 464 acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcctttgagggtg 523 |||||||||||| ||||| |||||||| ||||||||||| |||||||||| || ||| Sbjct: 555 acggcagctgctggggacaatcttcttggcaccagaggggagcttgatcc--tggatgtg 498 Query: 524 cccgttgtcgggggttgtggctgatgacgatggcgtagtcaccgg 568 ||||| || |||||||||||||||||||||||||||||| |||| Sbjct: 497 -ccgttatc-ggggttgtggctgatgacgatggcgtagtcgccgg 455 Score = 40.1 bits (20), Expect = 7.7 Identities = 41/48 (85%) Strand = Plus / Minus Query: 71 accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 118 |||| |||||| |||||||| || ||| ||||| ||||||||||||| Sbjct: 959 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 912
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 482 bits (243), Expect = e-133 Identities = 324/351 (92%) Strand = Plus / Minus Query: 164 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223 |||||||||||||||||||||||| ||||| | ||||| ||||||||||| |||||||| Sbjct: 23385250 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 23385191 Query: 224 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283 ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || || Sbjct: 23385190 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 23385131 Query: 284 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343 ||| || |||||||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 23385130 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 23385071 Query: 344 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403 ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| Sbjct: 23385070 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 23385011 Query: 404 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463 |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| || Sbjct: 23385010 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 23384951 Query: 464 acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcct 514 |||||||||||| ||||| |||||||| ||||||||||| ||||||||||| Sbjct: 23384950 acggcagctgctggggacaatcttcttggcaccagaggggagcttgatcct 23384900 Score = 61.9 bits (31), Expect = 2e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 534 ggggttgtggctgatgacgatggcgtagtcaccgg 568 |||||||||||||||||||||||||||||| |||| Sbjct: 23384126 ggggttgtggctgatgacgatggcgtagtcgccgg 23384092 Score = 40.1 bits (20), Expect = 7.7 Identities = 41/48 (85%) Strand = Plus / Minus Query: 71 accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 118 |||| |||||| |||||||| || ||| ||||| ||||||||||||| Sbjct: 23385354 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 23385307
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 482 bits (243), Expect = e-133 Identities = 324/351 (92%) Strand = Plus / Minus Query: 164 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223 |||||||||||||||||||||||| ||||| | ||||| ||||||||||| |||||||| Sbjct: 23313441 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 23313382 Query: 224 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283 ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || || Sbjct: 23313381 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 23313322 Query: 284 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343 ||| || |||||||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 23313321 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 23313262 Query: 344 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403 ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| Sbjct: 23313261 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 23313202 Query: 404 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463 |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| || Sbjct: 23313201 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 23313142 Query: 464 acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcct 514 |||||||||||| ||||| |||||||| ||||||||||| ||||||||||| Sbjct: 23313141 acggcagctgctggggacaatcttcttggcaccagaggggagcttgatcct 23313091 Score = 61.9 bits (31), Expect = 2e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 534 ggggttgtggctgatgacgatggcgtagtcaccgg 568 |||||||||||||||||||||||||||||| |||| Sbjct: 23312317 ggggttgtggctgatgacgatggcgtagtcgccgg 23312283 Score = 40.1 bits (20), Expect = 7.7 Identities = 41/48 (85%) Strand = Plus / Minus Query: 71 accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 118 |||| |||||| |||||||| || ||| ||||| ||||||||||||| Sbjct: 23313545 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 23313498
>emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa0016C14 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 162261 Score = 482 bits (243), Expect = e-133 Identities = 324/351 (92%) Strand = Plus / Plus Query: 164 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223 |||||||||||||||||||||||| ||||| | ||||| ||||||||||| |||||||| Sbjct: 116909 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 116968 Query: 224 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283 ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || || Sbjct: 116969 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 117028 Query: 284 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343 ||| || |||||||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 117029 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 117088 Query: 344 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403 ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| Sbjct: 117089 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 117148 Query: 404 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463 |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| || Sbjct: 117149 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 117208 Query: 464 acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcct 514 |||||||||||| ||||| |||||||| ||||||||||| ||||||||||| Sbjct: 117209 acggcagctgctggggacaatcttcttggcaccagaggggagcttgatcct 117259 Score = 61.9 bits (31), Expect = 2e-06 Identities = 34/35 (97%) Strand = Plus / Plus Query: 534 ggggttgtggctgatgacgatggcgtagtcaccgg 568 |||||||||||||||||||||||||||||| |||| Sbjct: 118033 ggggttgtggctgatgacgatggcgtagtcgccgg 118067 Score = 40.1 bits (20), Expect = 7.7 Identities = 41/48 (85%) Strand = Plus / Plus Query: 71 accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 118 |||| |||||| |||||||| || ||| ||||| ||||||||||||| Sbjct: 116805 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 116852
>gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, partial cds Length = 270 Score = 456 bits (230), Expect = e-125 Identities = 260/270 (96%) Strand = Plus / Minus Query: 167 ctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagt 226 ||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| Sbjct: 270 ctaagtggccttgtcggccttggcagcagaggcggcagcctggcctctgagacgaccagt 211 Query: 227 cctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtgga 286 |||||| ||||| |||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 210 cctcctagcagcgatgagaccaaccttctggccaggtggtgcatcacggcggacagtgga 151 Query: 287 agcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggc 346 ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 150 agcgtgaccaatatgctggtggttacctcctccgtggggatgctccacagggttcatggc 91 Query: 347 cacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttacc 406 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 90 cacaccacgcaccttaggccacgagttcctcttcacacggtacttgtggtaggcgttacc 31 Query: 407 agccttcagcattggcttctcagtcctgcc 436 |||||| ||||||||||||||||||||||| Sbjct: 30 agccttgagcattggcttctcagtcctgcc 1
>gb|AY108123.1| Zea mays PCO067267 mRNA sequence Length = 1062 Score = 432 bits (218), Expect = e-118 Identities = 311/342 (90%) Strand = Plus / Minus Query: 173 ggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcct 232 ||||||||| ||||| ||||||| || ||||| ||||| |||||||||||||| ||||| Sbjct: 876 ggccttgtcagccttggcagcagtagcagcagcttggcccctaagacgaccagttctcct 817 Query: 233 ggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatg 292 || ||||| ||||||||||||||||| || || ||||||||||| |||||||| ||||| Sbjct: 816 tgcggcaataagaccaaccttctggccaggaggagcatcacggcggacagtggaggcatg 757 Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||| Sbjct: 756 accaatgtgctggtggttacctcctccatgaggatgctcaacagggttcatggccacacc 697 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412 |||||||||||||||| ||||||||| || ||||||||||||||||| || |||||||| Sbjct: 696 acgcaccttaggccagctgttcctcttgacgcggtacttgtggtaggcattgccagcctt 637 Query: 413 cagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagct 472 ||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||| Sbjct: 636 cagcattggcttctcagtcctgccaccaccagcgacctgcccaatcatggcacggcagct 577 Query: 473 gcttgggacgatcttcttagcaccagagggtagcttgatcct 514 |||||||| |||||||||||||||||||| ||||||||||| Sbjct: 576 acttgggacaatcttcttagcaccagaggggagcttgatcct 535
>gb|AY105581.1| Zea mays PCO150618 mRNA sequence Length = 1102 Score = 353 bits (178), Expect = 4e-94 Identities = 310/354 (87%) Strand = Plus / Minus Query: 161 ataactctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacg 220 ||||||||| ||||||||||| ||||| | || | ||| ||||| || || || || | Sbjct: 863 ataactctaggtggccttgtcagccttggaggctgtggcagcagcttgacccctgagcct 804 Query: 221 accagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaac 280 ||||||||||| || ||||||||||||||||||||||| || || || || ||||| || Sbjct: 803 tccagtcctcctagcggcaatgagaccaaccttctggccagggggagcgtctcggcggac 744 Query: 281 agtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggtt 340 ||| || || ||||| || || ||||||||||||||||||||||||||||| |||||||| Sbjct: 743 agtagaggcgtgaccgatgtgttggtggttacctcctccgtggggatgctccacagggtt 684 Query: 341 catggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 ||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| || Sbjct: 683 catggccacaccacgcaccttgggccagctgttcctcttcacacggtacttgtggtacgc 624 Query: 401 gttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 460 |||||||||||| ||||| ||||||||||||||||| |||||||||||||| |||||||| Sbjct: 623 gttaccagccttgagcatcggcttctcagtcctgcctccaccagcaacctgcccaatcat 564 Query: 461 agcacggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcct 514 ||||||||||||||| ||||| |||||||| || |||||||| ||||| ||||| Sbjct: 563 agcacggcagctgctggggacaatcttcttggcgccagagggcagcttaatcct 510
>gb|AY109618.1| Zea mays CL8996_1 mRNA sequence Length = 1322 Score = 351 bits (177), Expect = 2e-93 Identities = 348/400 (87%), Gaps = 5/400 (1%) Strand = Plus / Minus Query: 164 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223 |||||| ||||||||||| ||||| | || | ||| |||||||||||||| || | || Sbjct: 864 actctaggtggccttgtcagccttggaggctgtggcagcagcctggcctctgagccttcc 805 Query: 224 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283 ||||||||| || ||||| ||||| ||||||||||| ||||| ||||| ||||| Sbjct: 804 agtcctcctagccgcaataagaccgaccttctggccannnnnagcatcgcggcggacagt 745 Query: 284 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343 || |||||||| ||||||||||||||||||||||||||||||||||| || |||||||| Sbjct: 744 agaggcatgaccgatatgctggtggttacctcctccgtggggatgctccacggggttcat 685 Query: 344 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403 |||||||||||| ||||| |||||| |||||||||||||||||||||| |||||||||| Sbjct: 684 ggccacaccacggaccttgggccagctgttcctcttcacacggtacttggggtaggcgtt 625 Query: 404 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463 |||||||||||||| ||||||||||||||||||||||| |||||||| |||||||| || Sbjct: 624 gccagccttcagcatcggcttctcagtcctgccaccaccggcaacctgcccaatcatggc 565 Query: 464 acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcctttgagggtg 523 |||||||||||| ||||| || |||||||| ||||| ||||||||||||| | || |||| Sbjct: 564 acggcagctgctggggacaattttcttagc-ccagatggtagcttgatcc-tcga-ggtg 508 Query: 524 cccgttgtcgggggttgtggctgatgacgatggcgtagtc 563 |||||||| |||||||||||||| |||||||||||||| Sbjct: 507 -ccgttgtc-agggttgtggctgatcacgatggcgtagtc 470
>ref|NM_119780.2| Arabidopsis thaliana structural constituent of ribosome AT4G36130 mRNA, complete cds Length = 1048 Score = 270 bits (136), Expect = 5e-69 Identities = 229/260 (88%) Strand = Plus / Minus Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260 ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| | || Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741 Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320 |||||||||||||| |||||||| ||| ||||||||||| || ||||||||||||||| Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681 Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380 || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| |||||| Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621 Query: 381 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440 ||||||||||||||||| |||||||||||||| ||||| |||||||| || || |||||| Sbjct: 620 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 561 Query: 441 ccagcaacctgaccaatcat 460 || ||||| ||||||||||| Sbjct: 560 cctgcaacttgaccaatcat 541
>emb|AL161588.2|ATCHRIV84 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 84 Length = 195452 Score = 270 bits (136), Expect = 5e-69 Identities = 229/260 (88%) Strand = Plus / Minus Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260 ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| | || Sbjct: 170391 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 170332 Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320 |||||||||||||| |||||||| ||| ||||||||||| || ||||||||||||||| Sbjct: 170331 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 170272 Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380 || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| |||||| Sbjct: 170271 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 170212 Query: 381 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440 ||||||||||||||||| |||||||||||||| ||||| |||||||| || || |||||| Sbjct: 170211 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 170152 Query: 441 ccagcaacctgaccaatcat 460 || ||||| ||||||||||| Sbjct: 170151 cctgcaacttgaccaatcat 170132
>emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, BAC clone F23E13 (ESSAII project) Length = 94695 Score = 270 bits (136), Expect = 5e-69 Identities = 229/260 (88%) Strand = Plus / Minus Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260 ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| | || Sbjct: 3218 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 3159 Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320 |||||||||||||| |||||||| ||| ||||||||||| || ||||||||||||||| Sbjct: 3158 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 3099 Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380 || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| |||||| Sbjct: 3098 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 3039 Query: 381 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440 ||||||||||||||||| |||||||||||||| ||||| |||||||| || || |||||| Sbjct: 3038 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 2979 Query: 441 ccagcaacctgaccaatcat 460 || ||||| ||||||||||| Sbjct: 2978 cctgcaacttgaccaatcat 2959
>emb|AL022373.1|ATT19K4 Arabidopsis thaliana DNA chromosome 4, BAC clone T19K4 (ESSAII project) Length = 106007 Score = 270 bits (136), Expect = 5e-69 Identities = 229/260 (88%) Strand = Plus / Minus Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260 ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| | || Sbjct: 105120 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 105061 Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320 |||||||||||||| |||||||| ||| ||||||||||| || ||||||||||||||| Sbjct: 105060 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 105001 Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380 || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| |||||| Sbjct: 105000 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 104941 Query: 381 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440 ||||||||||||||||| |||||||||||||| ||||| |||||||| || || |||||| Sbjct: 104940 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 104881 Query: 441 ccagcaacctgaccaatcat 460 || ||||| ||||||||||| Sbjct: 104880 cctgcaacttgaccaatcat 104861
>gb|AF361610.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds Length = 1029 Score = 270 bits (136), Expect = 5e-69 Identities = 229/260 (88%) Strand = Plus / Minus Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260 ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| | || Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741 Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320 |||||||||||||| |||||||| ||| ||||||||||| || ||||||||||||||| Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681 Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380 || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| |||||| Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621 Query: 381 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440 ||||||||||||||||| |||||||||||||| ||||| |||||||| || || |||||| Sbjct: 620 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 561 Query: 441 ccagcaacctgaccaatcat 460 || ||||| ||||||||||| Sbjct: 560 cctgcaacttgaccaatcat 541
>gb|AF367335.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds Length = 972 Score = 270 bits (136), Expect = 5e-69 Identities = 229/260 (88%) Strand = Plus / Minus Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260 ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| | || Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741 Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320 |||||||||||||| |||||||| ||| ||||||||||| || ||||||||||||||| Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681 Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380 || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| |||||| Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621 Query: 381 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440 ||||||||||||||||| |||||||||||||| ||||| |||||||| || || |||||| Sbjct: 620 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 561 Query: 441 ccagcaacctgaccaatcat 460 || ||||| ||||||||||| Sbjct: 560 cctgcaacttgaccaatcat 541
>gb|AY058221.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds Length = 777 Score = 270 bits (136), Expect = 5e-69 Identities = 229/260 (88%) Strand = Plus / Minus Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260 ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| | || Sbjct: 752 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 693 Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320 |||||||||||||| |||||||| ||| ||||||||||| || ||||||||||||||| Sbjct: 692 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 633 Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380 || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| |||||| Sbjct: 632 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 573 Query: 381 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440 ||||||||||||||||| |||||||||||||| ||||| |||||||| || || |||||| Sbjct: 572 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 513 Query: 441 ccagcaacctgaccaatcat 460 || ||||| ||||||||||| Sbjct: 512 cctgcaacttgaccaatcat 493
>ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural constituent of ribosome AT2G18020 (EMB2296) mRNA, complete cds Length = 968 Score = 254 bits (128), Expect = 3e-64 Identities = 263/308 (85%) Strand = Plus / Minus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 817 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 758 Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302 |||||||||||||| || || ||||||||||| | |||||| || |||||||| ||| Sbjct: 757 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 698 Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362 || |||||||||||||| || |||||||| || || ||||| ||||||||||| |||||| Sbjct: 697 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 638 Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422 ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||| Sbjct: 637 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 578 Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482 |||||||| || ||||| |||||||| || ||||||||||| | ||| | |||||||| Sbjct: 577 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 518 Query: 483 atcttctt 490 |||||||| Sbjct: 517 atcttctt 510
>gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA, complete cds Length = 944 Score = 254 bits (128), Expect = 3e-64 Identities = 263/308 (85%) Strand = Plus / Minus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 817 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 758 Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302 |||||||||||||| || || ||||||||||| | |||||| || |||||||| ||| Sbjct: 757 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 698 Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362 || |||||||||||||| || |||||||| || || ||||| ||||||||||| |||||| Sbjct: 697 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 638 Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422 ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||| Sbjct: 637 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 578 Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482 |||||||| || ||||| |||||||| || ||||||||||| | ||| | |||||||| Sbjct: 577 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 518 Query: 483 atcttctt 490 |||||||| Sbjct: 517 atcttctt 510
>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete sequence Length = 88149 Score = 254 bits (128), Expect = 3e-64 Identities = 263/308 (85%) Strand = Plus / Plus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 37736 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 37795 Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302 |||||||||||||| || || ||||||||||| | |||||| || |||||||| ||| Sbjct: 37796 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 37855 Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362 || |||||||||||||| || |||||||| || || ||||| ||||||||||| |||||| Sbjct: 37856 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 37915 Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422 ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||| Sbjct: 37916 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 37975 Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482 |||||||| || ||||| |||||||| || ||||||||||| | ||| | |||||||| Sbjct: 37976 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 38035 Query: 483 atcttctt 490 |||||||| Sbjct: 38036 atcttctt 38043
>emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH50ZB11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 254 bits (128), Expect = 3e-64 Identities = 263/308 (85%) Strand = Plus / Minus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 795 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 736 Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302 |||||||||||||| || || ||||||||||| | |||||| || |||||||| ||| Sbjct: 735 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 676 Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362 || |||||||||||||| || |||||||| || || ||||| ||||||||||| |||||| Sbjct: 675 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 616 Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422 ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||| Sbjct: 615 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 556 Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482 |||||||| || ||||| |||||||| || ||||||||||| | ||| | |||||||| Sbjct: 555 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 496 Query: 483 atcttctt 490 |||||||| Sbjct: 495 atcttctt 488
>emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH10ZE05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 881 Score = 254 bits (128), Expect = 3e-64 Identities = 263/308 (85%) Strand = Plus / Minus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 781 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 722 Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302 |||||||||||||| || || ||||||||||| | |||||| || |||||||| ||| Sbjct: 721 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 662 Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362 || |||||||||||||| || |||||||| || || ||||| ||||||||||| |||||| Sbjct: 661 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 602 Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422 ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||| Sbjct: 601 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 542 Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482 |||||||| || ||||| |||||||| || ||||||||||| | ||| | |||||||| Sbjct: 541 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 482 Query: 483 atcttctt 490 |||||||| Sbjct: 481 atcttctt 474
>emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH28ZH04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 946 Score = 254 bits (128), Expect = 3e-64 Identities = 263/308 (85%) Strand = Plus / Minus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 795 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 736 Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302 |||||||||||||| || || ||||||||||| | |||||| || |||||||| ||| Sbjct: 735 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 676 Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362 || |||||||||||||| || |||||||| || || ||||| ||||||||||| |||||| Sbjct: 675 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 616 Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422 ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||| Sbjct: 615 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 556 Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482 |||||||| || ||||| |||||||| || ||||||||||| | ||| | |||||||| Sbjct: 555 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 496 Query: 483 atcttctt 490 |||||||| Sbjct: 495 atcttctt 488
>gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA, complete cds Length = 858 Score = 254 bits (128), Expect = 3e-64 Identities = 263/308 (85%) Strand = Plus / Minus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 770 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 711 Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302 |||||||||||||| || || ||||||||||| | |||||| || |||||||| ||| Sbjct: 710 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 651 Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362 || |||||||||||||| || |||||||| || || ||||| ||||||||||| |||||| Sbjct: 650 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 591 Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422 ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||| Sbjct: 590 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 531 Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482 |||||||| || ||||| |||||||| || ||||||||||| | ||| | |||||||| Sbjct: 530 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 471 Query: 483 atcttctt 490 |||||||| Sbjct: 470 atcttctt 463
>gb|AC135311.13| Medicago truncatula clone mth2-27l9, complete sequence Length = 112635 Score = 244 bits (123), Expect = 3e-61 Identities = 255/299 (85%) Strand = Plus / Plus Query: 216 agacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacgg 275 ||||||||||||||| ||||||||||||||||||||||||| || || || |||||||| Sbjct: 107018 agacgaccagtcctcttggcagcaatgagaccaaccttctgtccaggaggagcatcacgt 107077 Query: 276 cgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaaca 335 | ||||| |||||||||||||| ||||| |||||||||||||||||||||||||| Sbjct: 107078 ctgacagtactcgcatgaccaatatgttggtgattacctcctccgtggggatgctcaact 107137 Query: 336 gggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtgg 395 || ||||| || |||||||| |||||||||||| |||| |||||||| | | |||||||| Sbjct: 107138 ggattcatagcaacaccacgaaccttaggccagcagtttctcttcactctgaacttgtgg 107197 Query: 396 taggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacca 455 || || ||||||||||||| |||||||||||| || || |||||||||||||| || ||| Sbjct: 107198 taagcattaccagccttcaacattggcttctcggttcttccaccaccagcaacttgccca 107257 Query: 456 atcatagcacggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcct 514 ||||| || | ||| ||||| || |||||||| |||||||| || ||||||||||| Sbjct: 107258 atcatggccctgcaatcacttggaacaatcttctttgcaccagatggaagcttgatcct 107316
>emb|BX827983.1|CNS0A32V Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH41ZD03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 965 Score = 244 bits (123), Expect = 3e-61 Identities = 228/262 (87%), Gaps = 2/262 (0%) Strand = Plus / Minus Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260 ||||| || ||||| ||||||||||||||||| ||||| || ||||||||||| | || Sbjct: 787 gcagcttgacctctgagacgaccagtcctccttgcagcgataagaccaaccttttttcct 728 Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320 |||||||||||||| |||||||| ||| ||||||||||| || ||||||||||||||| Sbjct: 727 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 668 Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380 || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| |||||| Sbjct: 667 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 608 Query: 381 acac--ggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccac 438 |||| ||||||||||||| |||||||||||||| ||||| |||||||| || || |||| Sbjct: 607 acaccgggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccac 548 Query: 439 caccagcaacctgaccaatcat 460 |||| ||||| ||||||||||| Sbjct: 547 cacctgcaacttgaccaatcat 526
>emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2 Length = 1002 Score = 240 bits (121), Expect = 4e-60 Identities = 241/281 (85%) Strand = Plus / Minus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 834 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 775 Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302 |||||||||||||| || || ||||||||||| | |||||| | |||||||| ||| Sbjct: 774 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggagtgaccaatgtgc 715 Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362 || |||||||||||||| || |||||||| || || ||||| ||||||||||| |||||| Sbjct: 714 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 655 Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422 ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||| Sbjct: 654 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 595 Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagc 463 |||||||| || ||||| |||||||| || ||||||||||| Sbjct: 594 ttctcagttcttccacctccagcaacttgtccaatcatagc 554
>emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS61ZG10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 887 Score = 240 bits (121), Expect = 4e-60 Identities = 263/309 (85%), Gaps = 1/309 (0%) Strand = Plus / Minus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 788 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 729 Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302 |||||||||||||| || || ||||||||||| | |||||| || |||||||| ||| Sbjct: 728 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 669 Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362 || |||||||||||||| || |||||||| || || ||||| ||||||||||| |||||| Sbjct: 668 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 609 Query: 363 ggccaggagttcctcttcacacgg-tacttgtggtaggcgttaccagccttcagcattgg 421 ||||| |||||||||||||||||| ||||||||||| ||||| || ||||| ||||| || Sbjct: 608 ggccatgagttcctcttcacacggatacttgtggtacgcgtttcctgccttgagcatcgg 549 Query: 422 cttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggac 481 ||||||||| || ||||| |||||||| || ||||||||||| | ||| | |||||||| Sbjct: 548 cttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggac 489 Query: 482 gatcttctt 490 |||||||| Sbjct: 488 aatcttctt 480
>emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH22ZA07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 901 Score = 238 bits (120), Expect = 2e-59 Identities = 261/308 (84%) Strand = Plus / Minus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 766 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 707 Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302 |||||||||||||| || || ||||||||||| | |||||| || | |||||| | | Sbjct: 706 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgttaccaatgttc 647 Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362 || |||||||||||||| || |||||||| || || ||||| ||||||||||| |||||| Sbjct: 646 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 587 Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422 ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||| Sbjct: 586 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 527 Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482 |||||||| || ||||| |||||||| || ||||||||||| | ||| | |||||||| Sbjct: 526 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 467 Query: 483 atcttctt 490 |||||||| Sbjct: 466 atcttctt 459
>emb|AJ404848.1|GMA404848 Glycine max mRNA for ribosomal protein L2 (rpL2 gene) Length = 1000 Score = 236 bits (119), Expect = 6e-59 Identities = 245/287 (85%) Strand = Plus / Minus Query: 174 gccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctg 233 ||||| || ||||| ||||||| || ||||| || ||||||||||||||||||||||| Sbjct: 823 gccttatcagccttggcagcagttgcagcagcttgtcctctaagacgaccagtcctccta 764 Query: 234 gcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatga 293 ||||||||||||||||||||||| || || || |||||||||| ||||| || ||| Sbjct: 763 gcagcaatgagaccaaccttctgtccaggaggagcatcacggctgacagtacttgcgtga 704 Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 |||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||| Sbjct: 703 ccaatatgctggtgattacctcctccgtggggatgctcaacagggttcatagcaacacca 644 Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttc 413 || ||||| |||||| | ||||||||||| | | |||||||||| || || |||||||| Sbjct: 643 cgaaccttgggccagcaattcctcttcactctgaacttgtggtaagcatttccagccttg 584 Query: 414 agcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 460 || | ||||||||||| || || ||||| ||||| ||||||||||| Sbjct: 583 agaagaggcttctcagttctccctccacctgcaacttgaccaatcat 537
>gb|AF156372.1| Nicotiana tabacum clone PR60 60S ribosomal protein L2 mRNA, partial cds Length = 644 Score = 230 bits (116), Expect = 4e-57 Identities = 218/252 (86%) Strand = Plus / Minus Query: 215 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 274 |||||||||||||||||| |||||||| ||||| ||||| || || |||||||||||||| Sbjct: 480 aagacgaccagtcctccttgcagcaataagaccgaccttttgaccaggtggtgcatcacg 421 Query: 275 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 334 || ||||| ||||||||||||||| || |||||||| || || || |||||||| || Sbjct: 420 acggacagtactagcatgaccaatatgttgatggttaccaccaccatgaggatgctccac 361 Query: 335 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 394 |||||||||||| |||||||| ||||| |||||| |||||||||| || ||||||||||| Sbjct: 360 agggttcatggcaacaccacgaaccttgggccagcagttcctctttacccggtacttgtg 301 Query: 395 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 454 ||| |||||||| ||||| |||||||| |||||||| | || || |||||||| ||||| Sbjct: 300 gtatgcgttaccggccttaagcattggtttctcagtacgtcctcctccagcaacttgacc 241 Query: 455 aatcatagcacg 466 |||||||||||| Sbjct: 240 aatcatagcacg 229
>emb|BX820333.1|CNS0A8NS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH23ZG05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 916 Score = 226 bits (114), Expect = 6e-56 Identities = 263/310 (84%), Gaps = 2/310 (0%) Strand = Plus / Minus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 801 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 742 Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302 |||||||||||||| || || ||||||||||| | |||||| || |||||||| ||| Sbjct: 741 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 682 Query: 303 tggtggttacctcctccgtggggatgctc-aacagggttcatggccacaccacgcacctt 361 || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||| Sbjct: 681 tgatggttacctcctccatgaggatgctcgcactggattcatagccacaccacgaacctt 622 Query: 362 aggccaggagttcctcttcacac-ggtacttgtggtaggcgttaccagccttcagcattg 420 |||||| |||||||||||||||| ||||||||||||| ||||| || ||||| ||||| | Sbjct: 621 aggccatgagttcctcttcacacgggtacttgtggtacgcgtttcctgccttgagcatcg 562 Query: 421 gcttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttggga 480 |||||||||| || ||||| |||||||| || ||||||||||| | ||| | ||||||| Sbjct: 561 gcttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttggga 502 Query: 481 cgatcttctt 490 | |||||||| Sbjct: 501 caatcttctt 492
>emb|X64562.1|LERPL2MR L.esculentum mRNA for ribosomal protein L2 Length = 816 Score = 214 bits (108), Expect = 2e-52 Identities = 216/252 (85%) Strand = Plus / Minus Query: 215 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 274 |||||||||||||||||| |||||||| ||||||||||| || || || ||||||||||| Sbjct: 743 aagacgaccagtcctccttgcagcaataagaccaaccttttgtccaggaggtgcatcacg 684 Query: 275 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 334 || || || ||||||||||| || || |||||||| || || ||||||||||| || Sbjct: 683 acggactgtactggcatgaccaatgtgttgatggttaccaccaccatggggatgctccac 624 Query: 335 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 394 || ||||| || |||||||| |||||||||||| |||||||||||||||||||||| || Sbjct: 623 tggattcatagcaacaccacgaaccttaggccagcagttcctcttcacacggtacttatg 564 Query: 395 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 454 ||| || |||||||| || |||||||| |||||||| | || ||||||||||||||||| Sbjct: 563 gtaagcattaccagctttaagcattggtttctcagtacgccctccaccagcaacctgacc 504 Query: 455 aatcatagcacg 466 |||||||||||| Sbjct: 503 aatcatagcacg 492
>gb|DQ252497.1| Solanum tuberosum clone 068C11 ribosomal protein L2-like mRNA, complete cds Length = 899 Score = 214 bits (108), Expect = 2e-52 Identities = 216/252 (85%) Strand = Plus / Minus Query: 215 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 274 |||||||||||||||||| |||||||| ||||||||||| || || || ||||||||||| Sbjct: 789 aagacgaccagtcctccttgcagcaataagaccaaccttttgtccaggaggtgcatcacg 730 Query: 275 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 334 || || || ||||||||||| || || |||||||| || || ||||||||||| || Sbjct: 729 acggactgtactggcatgaccaatgtgttgatggttaccaccaccatggggatgctccac 670 Query: 335 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 394 || ||||| || |||||||| |||||||||||| |||||||||||||||||||||| || Sbjct: 669 gggattcatagcaacaccacgaaccttaggccagcagttcctcttcacacggtacttatg 610 Query: 395 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 454 ||| || |||||||| || |||||||| |||||||| | || ||||||||||||||||| Sbjct: 609 gtaagcattaccagctttaagcattggtttctcagtacgtcctccaccagcaacctgacc 550 Query: 455 aatcatagcacg 466 |||||||||||| Sbjct: 549 aatcatagcacg 538
>gb|BT013866.1| Lycopersicon esculentum clone 132846R, mRNA sequence Length = 983 Score = 210 bits (106), Expect = 4e-51 Identities = 211/246 (85%) Strand = Plus / Minus Query: 215 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 274 |||||||||||||||||| || ||||| ||||||||| | || || |||||||||||||| Sbjct: 756 aagacgaccagtcctccttgctgcaataagaccaaccctttgcccaggtggtgcatcacg 697 Query: 275 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 334 || ||||| |||||||||||||| || |||||||| || || || |||||||| || Sbjct: 696 acgcacagtactggcatgaccaatatgttgatggttaccaccaccatgaggatgctccac 637 Query: 335 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 394 ||| ||||| || |||||||| |||||||||||| |||||||||| || ||||| ||||| Sbjct: 636 aggattcatagcaacaccacgaaccttaggccagcagttcctcttaacgcggtatttgtg 577 Query: 395 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 454 ||| ||||||||||| || |||||||| |||||||| || || ||||||||||||||||| Sbjct: 576 gtatgcgttaccagctttaagcattggtttctcagttcttcctccaccagcaacctgacc 517 Query: 455 aatcat 460 |||||| Sbjct: 516 aatcat 511
>emb|BX818795.1|CNS0A8ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZH09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 878 Score = 200 bits (101), Expect = 4e-48 Identities = 258/309 (83%), Gaps = 1/309 (0%) Strand = Plus / Minus Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaa-t 241 ||||| ||||| || || ||||| || ||||| ||||||||||||||||| ||||||| | Sbjct: 789 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaaat 730 Query: 242 gagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatg 301 |||||||||||||| || || ||||||| ||| | || ||| || |||||||| | Sbjct: 729 aagaccaaccttctgtccaggaggtgcatgacgcctaagagtactggcgtgaccaatgta 670 Query: 302 ctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctt 361 ||| |||||||||||||| || |||||||| || || ||||| |||||| |||| ||||| Sbjct: 669 ctgatggttacctcctccatgaggatgctccactggattcatagccacaacacgaacctt 610 Query: 362 aggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattgg 421 |||||| |||| |||||||||||||||||||||||| ||||| || ||||| ||||| || Sbjct: 609 aggccatgagtgcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcgg 550 Query: 422 cttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggac 481 ||||||||| || ||||| |||||||| || ||||||||||| | ||| | |||||||| Sbjct: 549 cttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggac 490 Query: 482 gatcttctt 490 |||||||| Sbjct: 489 aatcttctt 481
>emb|X62500.1|NTRL2RNA N.tabacum RL2 mRNA for 60S ribosomal protein L2 Length = 917 Score = 182 bits (92), Expect = 8e-43 Identities = 211/248 (85%), Gaps = 2/248 (0%) Strand = Plus / Minus Query: 215 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 274 |||||||||||||||||| | ||||| ||||| ||||| || || ||||||||||| || Sbjct: 745 aagacgaccagtcctccttcctgcaataagaccgaccttttgaccaggtggtgcatcgcg 686 Query: 275 -gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaa 333 |||| |||| ||||||||||||||| || |||||||| || || || |||||||| | Sbjct: 685 agcga-cagtactagcatgaccaatatgttgatggttaccaccaccatgaggatgctcca 627 Query: 334 cagggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgt 393 ||||||||||||| |||||||| ||||| |||||| |||||||||| || |||||||||| Sbjct: 626 cagggttcatggcaacaccacgaaccttgggccagcagttcctctttacccggtacttgt 567 Query: 394 ggtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgac 453 |||| |||||||| ||||| |||||||| |||||||| | || || |||||||| |||| Sbjct: 566 ggtatgcgttaccggccttaagcattggtttctcagtacgtcctcctccagcaacttgac 507 Query: 454 caatcata 461 |||||||| Sbjct: 506 caatcata 499
>gb|DQ316258.1| Litopenaeus vannamei ribosomal protein L8 mRNA, complete cds Length = 871 Score = 153 bits (77), Expect = 7e-34 Identities = 161/189 (85%) Strand = Plus / Minus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||||||||| | ||||||||| || |||||||| || || || |||||||| |||||| Sbjct: 715 acagtggaagccttaccaatatgttgatggttaccaccaccatgaggatgctctacaggg 656 Query: 339 ttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtag 398 |||||||||||||||||||||||||||||| ||||||||||||| | ||||| |||||| Sbjct: 655 ttcatggccacaccacgcaccttaggccagcagttcctcttcaccctatacttatggtag 596 Query: 399 gcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatc 458 || |||||||||||| || ||||| ||| | | |||||||||||||| ||||||| Sbjct: 595 gcacgaccagccttcaggataggcttgtcaatacgtccaccaccagcaacaataccaatc 536 Query: 459 atagcacgg 467 || |||||| Sbjct: 535 atggcacgg 527
>emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1 Length = 878 Score = 113 bits (57), Expect = 6e-22 Identities = 75/81 (92%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||||||||| |||||||| |||||||||||||||||||| |||||||| |||||||| Sbjct: 705 accaatatgctgatggttaccacctccgtggggatgctcaacggggttcatagccacacc 646 Query: 353 acgcaccttaggccaggagtt 373 ||||||||| |||||| |||| Sbjct: 645 acgcaccttgggccagcagtt 625
>emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1 Length = 823 Score = 113 bits (57), Expect = 6e-22 Identities = 75/81 (92%) Strand = Plus / Plus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||||||||| |||||||| |||||||||||||||||||| |||||||| |||||||| Sbjct: 174 accaatatgctgatggttaccacctccgtggggatgctcaacggggttcatagccacacc 233 Query: 353 acgcaccttaggccaggagtt 373 ||||||||| |||||| |||| Sbjct: 234 acgcaccttgggccagcagtt 254
>gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein L8 (rpL8) gene, complete cds Length = 1718 Score = 111 bits (56), Expect = 3e-21 Identities = 95/108 (87%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| ||||| |||||||| || |||||||||||||| || ||||||||||||||||| Sbjct: 1438 accaatgtgctgatggttaccaccaccgtggggatgctccacggggttcatggccacacc 1379 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||||||||||||| ||| | |||||| ||||||||||||||| Sbjct: 1378 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 1331
>gb|AY485337.1| Mamestra brassicae ribosomal protein L8 (rpl8) mRNA, complete cds Length = 877 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||||||||| | ||||||||| || |||||||| || || || ||||||||||||||| Sbjct: 715 acagtggaagccttaccaatatgttgatggttaccaccaccatgaggatgctcaacaggg 656 Query: 339 ttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtag 398 |||||||||||||||||||| | |||||| |||| | ||| || |||||||||||| Sbjct: 655 ttcatggccacaccacgcacatatggccagcagtttcgcttgactttgtacttgtggtat 596 Query: 399 gcgttaccagccttcagcattggctt 424 ||| |||||||||||| || ||||| Sbjct: 595 gcgcgaccagccttcaggatgggctt 570
>emb|CT033650.1| Platynereis dumerilii EST IB0AAA16CH07EM1 Length = 867 Score = 105 bits (53), Expect = 2e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||||||||| |||||||| |||||||| ||||||||||| |||||||| |||||||| Sbjct: 694 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 635 Query: 353 acgcaccttaggccaggagtt 373 ||||||||| |||||| |||| Sbjct: 634 acgcaccttgggccagcagtt 614
>emb|CT033649.1| Platynereis dumerilii EST IB0AAA16CH07FM1 Length = 744 Score = 105 bits (53), Expect = 2e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||||||||| |||||||| |||||||| ||||||||||| |||||||| |||||||| Sbjct: 174 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 233 Query: 353 acgcaccttaggccaggagtt 373 ||||||||| |||||| |||| Sbjct: 234 acgcaccttgggccagcagtt 254
>emb|CT033017.1| Platynereis dumerilii EST IB0AAA27DH06EM1 Length = 868 Score = 105 bits (53), Expect = 2e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||||||||| |||||||| |||||||| ||||||||||| |||||||| |||||||| Sbjct: 696 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 637 Query: 353 acgcaccttaggccaggagtt 373 ||||||||| |||||| |||| Sbjct: 636 acgcaccttgggccagcagtt 616
>emb|CT033016.1| Platynereis dumerilii EST IB0AAA27DH06FM1 Length = 826 Score = 105 bits (53), Expect = 2e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||||||||| |||||||| |||||||| ||||||||||| |||||||| |||||||| Sbjct: 174 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 233 Query: 353 acgcaccttaggccaggagtt 373 ||||||||| |||||| |||| Sbjct: 234 acgcaccttgggccagcagtt 254
>gb|BT014913.1| Drosophila melanogaster RH21963 full insert cDNA Length = 2439 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| ||||| |||||||| || ||||| |||||||| || ||||||||||||||||| Sbjct: 2151 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 2092 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||||||||||||| ||| | |||||| ||||||||||||||| Sbjct: 2091 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 2044
>gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein L2/L8 mRNA, complete cds Length = 786 Score = 103 bits (52), Expect = 6e-19 Identities = 109/128 (85%) Strand = Plus / Minus Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356 |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| Sbjct: 656 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 597 Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 416 ||||| |||||| |||| | |||||| ||||||||||||||| |||||||||||| Sbjct: 596 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 537 Query: 417 attggctt 424 || ||||| Sbjct: 536 ataggctt 529
>emb|CR938630.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 3-prime end of clone KW0AAA1YD12BBM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 701 Score = 103 bits (52), Expect = 6e-19 Identities = 109/128 (85%) Strand = Plus / Plus Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356 |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| Sbjct: 320 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 379 Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 416 ||||| |||||| |||| | |||||| ||||||||||||||| |||||||||||| Sbjct: 380 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 439 Query: 417 attggctt 424 || ||||| Sbjct: 440 ataggctt 447
>emb|CR938124.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YJ17AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 817 Score = 103 bits (52), Expect = 6e-19 Identities = 109/128 (85%) Strand = Plus / Minus Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356 |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| Sbjct: 737 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 678 Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 416 ||||| |||||| |||| | |||||| ||||||||||||||| |||||||||||| Sbjct: 677 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 618 Query: 417 attggctt 424 || ||||| Sbjct: 617 ataggctt 610
>gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 192681 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| ||||| |||||||| || ||||| |||||||| || ||||||||||||||||| Sbjct: 127344 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 127285 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||||||||||||| ||| | |||||| ||||||||||||||| Sbjct: 127284 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 127237
>ref|NM_167955.1| Drosophila melanogaster Ribosomal protein L8 CG1263-RB, transcript variant B (RpL8), mRNA Length = 1264 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| ||||| |||||||| || ||||| |||||||| || ||||||||||||||||| Sbjct: 872 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 813 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||||||||||||| ||| | |||||| ||||||||||||||| Sbjct: 812 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 765
>ref|NM_079987.2| Drosophila melanogaster Ribosomal protein L8 CG1263-RA, transcript variant A (RpL8), mRNA Length = 1118 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| ||||| |||||||| || ||||| |||||||| || ||||||||||||||||| Sbjct: 726 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 667 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||||||||||||| ||| | |||||| ||||||||||||||| Sbjct: 666 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 619
>gb|AY071342.1| Drosophila melanogaster RE37829 full length cDNA Length = 1019 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| ||||| |||||||| || ||||| |||||||| || ||||||||||||||||| Sbjct: 724 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 665 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||||||||||||| ||| | |||||| ||||||||||||||| Sbjct: 664 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 617
>gb|BT022891.1| Drosophila melanogaster IP12501 full insert cDNA Length = 1776 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| ||||| |||||||| || ||||| |||||||| || ||||||||||||||||| Sbjct: 527 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 468 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||||||||||||| ||| | |||||| ||||||||||||||| Sbjct: 467 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 420
>gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 of 83 of the complete sequence Length = 301691 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| ||||| |||||||| || ||||| |||||||| || ||||||||||||||||| Sbjct: 123716 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 123657 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||||||||||||| ||| | |||||| ||||||||||||||| Sbjct: 123656 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 123609
>emb|CR937651.1| Single read from an extremity of a cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAB1YJ18AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 765 Score = 101 bits (51), Expect = 2e-18 Identities = 102/119 (85%) Strand = Plus / Minus Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356 |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| Sbjct: 739 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 680 Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcag 415 ||||| |||||| |||| | |||||| ||||||||||||||| |||||||||||| Sbjct: 679 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcag 621
>emb|CR937650.1| Single read from an extremity of a cDNA clone made from Aedes aegypti total adult females. 3-prime end of clone KW0AAB1YJ18BBM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 616 Score = 101 bits (51), Expect = 2e-18 Identities = 102/119 (85%) Strand = Plus / Plus Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356 |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| Sbjct: 319 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 378 Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcag 415 ||||| |||||| |||| | |||||| ||||||||||||||| |||||||||||| Sbjct: 379 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcag 437
>emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1 Length = 884 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 710 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 651 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 650 ttcatagccacaccacgcaccttgggccagcagtt 616
>emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1 Length = 883 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 724 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 665 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 664 ttcatagccacaccacgcaccttgggccagcagtt 630
>emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1 Length = 814 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Plus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255
>emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1 Length = 834 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 706 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 647 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 646 ttcatagccacaccacgcaccttgggccagcagtt 612
>emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1 Length = 838 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Plus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255
>emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1 Length = 834 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Plus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 174 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 233 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 234 ttcatagccacaccacgcaccttgggccagcagtt 268
>emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1 Length = 854 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 710 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 651 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 650 ttcatagccacaccacgcaccttgggccagcagtt 616
>emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1 Length = 759 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | ||||||||| || |||||||||||||| || ||||||||||| ||| Sbjct: 707 acagttgaagctttaccaatatgatgatggttacctcctccatgaggatgctcaacgggg 648 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 647 ttcatagccacaccacgcaccttgggccagcagtt 613
>emb|CT032321.1| Platynereis dumerilii EST IB0AAA40CH03FM1 Length = 475 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Plus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||| ||||||||||||| ||||||||||| Sbjct: 221 ttcatagcctcaccacgcaccttgggccaggagtt 255
>emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1 Length = 869 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 708 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 649 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 648 ttcatagccacaccacgcaccttgggccagcagtt 614
>emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1 Length = 844 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Plus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255
>emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1 Length = 868 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 708 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 649 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 648 ttcatagccacaccacgcaccttgggccagcagtt 614
>emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1 Length = 822 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Plus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| ||||||||||||||||| |||||| |||| Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255
>ref|NM_114978.1| Arabidopsis thaliana structural constituent of ribosome AT3G51190 mRNA, complete cds Length = 783 Score = 99.6 bits (50), Expect = 1e-17 Identities = 140/170 (82%) Strand = Plus / Minus Query: 291 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 350 |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || ||| Sbjct: 665 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 606 Query: 351 ccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcc 410 ||||| || |||||| ||||||||||| | |||||||||||| || || |||||| Sbjct: 605 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggtatgcatttccagcc 546 Query: 411 ttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 460 || || | ||||||||| || || || ||||| ||||| || |||||||| Sbjct: 545 ttgagaaatggcttctctgttcttcctccacctgcaacttgcccaatcat 496
>emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, BAC clone F24M12 Length = 129516 Score = 99.6 bits (50), Expect = 1e-17 Identities = 140/170 (82%) Strand = Plus / Plus Query: 291 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 350 |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || ||| Sbjct: 76049 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 76108 Query: 351 ccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcc 410 ||||| || |||||| ||||||||||| | |||||||||||| || || |||||| Sbjct: 76109 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggtatgcatttccagcc 76168 Query: 411 ttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 460 || || | ||||||||| || || || ||||| ||||| || |||||||| Sbjct: 76169 ttgagaaatggcttctctgttcttcctccacctgcaacttgcccaatcat 76218
>gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At3g51190) mRNA, complete cds Length = 783 Score = 99.6 bits (50), Expect = 1e-17 Identities = 140/170 (82%) Strand = Plus / Minus Query: 291 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 350 |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || ||| Sbjct: 665 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 606 Query: 351 ccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcc 410 ||||| || |||||| ||||||||||| | |||||||||||| || || |||||| Sbjct: 605 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggtatgcatttccagcc 546 Query: 411 ttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 460 || || | ||||||||| || || || ||||| ||||| || |||||||| Sbjct: 545 ttgagaagtggcttctctgttcttcctccacctgcaacttgcccaatcat 496
>dbj|AU066544.1| Chlamydomonas sp. HS-5 mRNA for 60S ribosomal protein L2, NaCl+paraquat inducible, complete cds, clone:M30 Length = 987 Score = 99.6 bits (50), Expect = 1e-17 Identities = 131/158 (82%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 ||||| |||||||||||||| || |||||||| ||||| || |||||||||||||||||| Sbjct: 672 ccaatgtgctggtggttaccaccaccgtgggggtgctccacggggttcatggccacacca 613 Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttc 413 |||||||| |||||| ||| | ||| | |||||||||||| | | ||||||||| Sbjct: 612 cgcaccttcggccagctgttacgcttggccttgtacttgtggtacgagcggccagccttc 553 Query: 414 agcattggcttctcagtcctgccaccaccagcaacctg 451 ||||| ||||||||||| | ||| || ||||| ||||| Sbjct: 552 agcatcggcttctcagtacggccgccgccagcgacctg 515
>gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribosomal subunit L8 mRNA sequence Length = 1079 Score = 95.6 bits (48), Expect = 2e-16 Identities = 90/104 (86%) Strand = Plus / Minus Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356 |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| Sbjct: 748 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 689 Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggc 400 ||||| |||||| |||| | |||||| ||||||||||||||| Sbjct: 688 acctttggccagcagttacgcttcaccttgtacttgtggtaggc 645
>emb|AM049012.1| Timarcha balearica partial mRNA for ribosomal protein L8e (rpL8e gene) Length = 755 Score = 95.6 bits (48), Expect = 2e-16 Identities = 84/96 (87%) Strand = Plus / Minus Query: 278 aacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagg 337 |||||| ||||| | ||| ||||| || |||||||| |||||||| |||||||| ||||| Sbjct: 675 aacagtagaagctttaccgatatgttgatggttaccacctccgtgaggatgctctacagg 616 Query: 338 gttcatggccacaccacgcaccttaggccaggagtt 373 ||||||||| |||||||| |||||||||||| |||| Sbjct: 615 gttcatggcaacaccacgtaccttaggccagcagtt 580
>gb|AY128671.1| Drosophila virilis daughter of sevenless (dos) gene, complete cds Length = 8311 Score = 95.6 bits (48), Expect = 2e-16 Identities = 69/76 (90%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || |||||||| || |||||||||||||| |||||||||||||| ||||| Sbjct: 298 accaatatgttgatggttaccaccaccgtggggatgctccacagggttcatggcaacacc 239 Query: 353 acgcaccttaggccag 368 ||||||||| |||||| Sbjct: 238 acgcaccttgggccag 223
>gb|AF526214.1| Argopecten irradians isolate iolsaicl63ct83cn90 ribosomal protein L mRNA, complete cds Length = 866 Score = 95.6 bits (48), Expect = 2e-16 Identities = 129/156 (82%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||||||||| |||||||| || || || ||||| ||||| |||||||| |||||||| Sbjct: 694 accaatatgctgatggttaccaccaccatgaggatgttcaactgggttcatagccacacc 635 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412 ||| || ||||||||| |||||||||| || ||||||| ||| || ||||||||| Sbjct: 634 acgaactttaggccagcagttcctcttgaccttgtacttgaagtaagcacgaccagcctt 575 Query: 413 cagcattggcttctcagtcctgccaccaccagcaac 448 |||||| ||||| || |||| ||||| |||||||| Sbjct: 574 cagcatgggcttgtctatccttccacctccagcaac 539
>emb|CR937938.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YP16AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 816 Score = 95.6 bits (48), Expect = 2e-16 Identities = 108/128 (84%) Strand = Plus / Minus Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356 |||||||| |||||||| || ||||||||||||||||| |||||||| || || ||||| Sbjct: 740 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacgccacgt 681 Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 416 ||||| |||||| |||| | |||||| ||||||||||||||| |||||||||||| Sbjct: 680 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 621 Query: 417 attggctt 424 || ||||| Sbjct: 620 ataggctt 613
>emb|CT032253.1| Platynereis dumerilii EST IB0AAA42BC10FM1 Length = 778 Score = 93.7 bits (47), Expect = 6e-16 Identities = 83/95 (87%) Strand = Plus / Plus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| ||| Sbjct: 173 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 232 Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373 ||||| |||||||||||||||| |||||| |||| Sbjct: 233 ttcataaccacaccacgcaccttgggccagcagtt 267
>ref|XM_962890.1| PREDICTED: Tribolium castaneum similar to CG1263-PA, isoform A (LOC656352), mRNA Length = 886 Score = 89.7 bits (45), Expect = 9e-15 Identities = 72/81 (88%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| |||||||| ||||| || ||||||||||||||||| ||||||||||| ||||| Sbjct: 685 accaatgtgctggtgattaccaccaccgtggggatgctcaactgggttcatggcaacacc 626 Query: 353 acgcaccttaggccaggagtt 373 ||| || ||||||||| |||| Sbjct: 625 acgtactttaggccagcagtt 605
>emb|CR938631.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA1YD12AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 724 Score = 89.7 bits (45), Expect = 9e-15 Identities = 99/117 (84%) Strand = Plus / Minus Query: 308 gttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggcca 367 |||||| || ||||||||||||||||| |||||||| || |||||||| ||||| ||||| Sbjct: 724 gttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgtacctttggcca 665 Query: 368 ggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggctt 424 | |||| | |||||| ||||||||||||||| |||||||||||| || ||||| Sbjct: 664 gcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcaggataggctt 608
>gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene exons 1-3, complete cds Length = 2231 Score = 89.7 bits (45), Expect = 9e-15 Identities = 105/125 (84%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || || |||||||||||||| |||||||| ||||||||||| ||| Sbjct: 1937 tgctgatggttaccaccaccatggggatgctcaacggggttcatagccacaccacgtacc 1878 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcatt 419 || |||||| |||| | |||||| ||||||| ||||||| ||| |||||||| ||| Sbjct: 1877 tttggccagcagttacgcttcaccttgtacttgcggtaggcacgaccggccttcaggatt 1818 Query: 420 ggctt 424 ||||| Sbjct: 1817 ggctt 1813
>gb|AY943311.1| Wyeomyia smithii ribosomal protein L8 mRNA, partial cds Length = 331 Score = 87.7 bits (44), Expect = 4e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356 ||||||||||| ||||| || || |||||||||||||| |||||||| || ||||||||| Sbjct: 168 atatgctggtgattaccaccaccatggggatgctcaacggggttcatagcaacaccacgc 109 Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 416 || || |||||| |||| | |||||| |||||||||||| || ||||||| |||| Sbjct: 108 actttcggccagcagttacgcttcaccttgtacttgtggtatgcacgaccagccctcaga 49 Query: 417 attggctt 424 |||||||| Sbjct: 48 attggctt 41
>gb|AF429973.1| Spodoptera frugiperda ribosomal protein L8 mRNA, complete cds Length = 915 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| ||||||||||| |||||||| ||||||||||| |||||||| |||||||| Sbjct: 702 accaatatgttggtggttaccacctccgtgaggatgctcaacggggttcatagccacacc 643 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 ||| || | |||||| |||| | ||| || ||||||||||||||| Sbjct: 642 acgaacgtatggccagcagttacgcttaaccttgtacttgtggtaggc 595
>dbj|AK060350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-F06, full insert sequence Length = 864 Score = 87.7 bits (44), Expect = 4e-14 Identities = 62/68 (91%) Strand = Plus / Minus Query: 291 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 350 |||||||| |||||||||||||| || |||||||| ||||| || ||||||||||||||| Sbjct: 682 tgaccaatgtgctggtggttaccaccaccgtgggggtgctccacggggttcatggccaca 623 Query: 351 ccacgcac 358 |||||||| Sbjct: 622 ccacgcac 615
>ref|XM_447807.1| Candida glabrata CBS138, CAGL0J02354g partial mRNA Length = 765 Score = 85.7 bits (43), Expect = 1e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || |||||||| || ||||| || || ||||||||||||||||| ||||| Sbjct: 660 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 601 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412 ||| ||| ||||| ||||| ||||||| |||||||||| | || ||||||||| Sbjct: 600 acgggtctttggccaagagtttctcttcaacttgtacttgtggaaagcacgaccagcctt 541 Query: 413 cagcattggcttctcagtcctgccaccaccagcaa 447 || || |||||| ||||| || ||||||||||||| Sbjct: 540 caacaatggcttgtcagttctaccaccaccagcaa 506
>emb|CR380956.1| Candida glabrata strain CBS138 chromosome J complete sequence Length = 1192501 Score = 85.7 bits (43), Expect = 1e-13 Identities = 127/155 (81%) Strand = Plus / Plus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || |||||||| || ||||| || || ||||||||||||||||| ||||| Sbjct: 227764 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 227823 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412 ||| ||| ||||| ||||| ||||||| |||||||||| | || ||||||||| Sbjct: 227824 acgggtctttggccaagagtttctcttcaacttgtacttgtggaaagcacgaccagcctt 227883 Query: 413 cagcattggcttctcagtcctgccaccaccagcaa 447 || || |||||| ||||| || ||||||||||||| Sbjct: 227884 caacaatggcttgtcagttctaccaccaccagcaa 227918
>gb|AY957563.1| Oncorhynchus mykiss ribosomal protein L8 mRNA, partial cds Length = 672 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 |||||||||||||||||||| || ||| ||||||||||||||||| ||||||||||||| Sbjct: 625 ccaatatgctggtggttaccaccaccgaagggatgctcaacagggtccatggccacacca 566 Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 || || ||||| ||||||||||| | ||||||||||||||| Sbjct: 565 cggacacgtggccatgagttcctcttggccttgtacttgtggtaggc 519
>ref|XM_582676.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L8 (LOC506251), mRNA Length = 833 Score = 83.8 bits (42), Expect = 6e-13 Identities = 120/146 (82%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||||||||| || |||||| ||||||||| |||||||||||||||||||| |||||| Sbjct: 682 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 623 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcatt 419 |||||| |||||||||| | |||||||||||||| | ||||||||||| || Sbjct: 622 agtggccagcagttcctctttgccttatacttgtggtaggcatggccagccttcagaatg 563 Query: 420 ggcttctcagtcctgccaccaccagc 445 ||||| ||| | | |||||| ||||| Sbjct: 562 ggcttgtcaatgcagccacctccagc 537
>gb|AY919670.1| Pimephales promelas 60S ribosomal protein L8 mRNA, partial cds Length = 709 Score = 83.8 bits (42), Expect = 6e-13 Identities = 75/86 (87%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 ||||||||||| |||||||| || ||| ||||||||||||||||||||| ||||||||| Sbjct: 621 ccaatatgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 562 Query: 354 cgcaccttaggccaggagttcctctt 379 || || ||||||| |||||||||| Sbjct: 561 cggacacgaggccagcagttcctctt 536
>gb|AF164152.1|AF164152 Anopheles gambiae strain M2 ribosomal protein L8 (rpL8) mRNA, complete cds Length = 937 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| ||||||||||||||| Sbjct: 712 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccacgcacc 653 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 652 ttcggccagcagttacgcttcaccttgtacttgtggta 615
>gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal protein L8-like mRNA, complete sequence Length = 903 Score = 81.8 bits (41), Expect = 2e-12 Identities = 86/101 (85%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||| || Sbjct: 725 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 666 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||| |||||||||| | ||||||||||||||| Sbjct: 665 cgtggccagcagttcctcttggccttgtacttgtggtaggc 625
>gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal protein L8-like mRNA, complete sequence Length = 854 Score = 81.8 bits (41), Expect = 2e-12 Identities = 86/101 (85%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||| || Sbjct: 677 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 618 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||| |||||||||| | ||||||||||||||| Sbjct: 617 cgtggccagcagttcctcttggccttgtacttgtggtaggc 577
>emb|AM049010.1| Meladema coriacea partial mRNA for ribosomal protein L8e (rpL8e gene) Length = 711 Score = 81.8 bits (41), Expect = 2e-12 Identities = 68/77 (88%) Strand = Plus / Minus Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356 ||||| || |||||||| || ||||||||||||||||| |||||||| |||||||| ||| Sbjct: 656 atatgttgatggttaccaccaccgtggggatgctcaacggggttcatagccacaccgcgc 597 Query: 357 accttaggccaggagtt 373 ||||| |||||| |||| Sbjct: 596 acctttggccagcagtt 580
>gb|AY190734.1| Pagrus major ribosomal protein L8 mRNA, partial cds Length = 688 Score = 79.8 bits (40), Expect = 9e-12 Identities = 127/156 (81%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 ||||||||||| |||||||| || ||| ||||||||||||||||||||| ||||||||| Sbjct: 686 ccaatatgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 627 Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttc 413 || || |||||| |||||||||| | ||||||||||||||| ||||||||| Sbjct: 626 cggacacgtggccagcagttcctcttggccttgtacttgtggtaggcacgaccagccttt 567 Query: 414 agcattggcttctcagtcctgccaccaccagcaacc 449 || || ||||| ||| | | ||||| ||||||||| Sbjct: 566 aggatgggcttgtcaatacgaccacctccagcaacc 531
>emb|AM049009.1| Georissus sp. APV-2005 mRNA for ribosomal protein L8e (rpL8e gene) Length = 774 Score = 79.8 bits (40), Expect = 9e-12 Identities = 65/74 (87%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 |||||||| ||||| || ||||| ||||| || || ||||||||||| |||||||||||| Sbjct: 653 tgctggtgattaccaccaccgtgaggatgytcsactgggttcatggcgacaccacgcacc 594 Query: 360 ttaggccaggagtt 373 ||||||||| |||| Sbjct: 593 ttaggccagcagtt 580
>gb|BC102277.1| Bos taurus similar to 60S ribosomal protein L8, mRNA (cDNA clone MGC:127227 IMAGE:7945641), complete cds Length = 932 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||||||||| || |||||| ||||||||| |||||||||||||||||||| |||||| Sbjct: 688 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 629 Query: 360 ttaggccaggagttcctctt 379 |||||| |||||||||| Sbjct: 628 cgtggccagcagttcctctt 609
>ref|NM_001034625.1| Bos taurus similar to 60S ribosomal protein L8 (MGC127227), mRNA Length = 932 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||||||||| || |||||| ||||||||| |||||||||||||||||||| |||||| Sbjct: 688 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 629 Query: 360 ttaggccaggagttcctctt 379 |||||| |||||||||| Sbjct: 628 cgtggccagcagttcctctt 609
>gb|DQ213522.1| Taeniopygia guttata clone 0061P0021C08 ribosomal protein L8-like mRNA, complete sequence Length = 878 Score = 77.8 bits (39), Expect = 4e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccac 354 ||||||||||| ||||||||| ||||||||| |||||||||||||||||||||| Sbjct: 702 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccac 648
>emb|AM049011.1| Mycetophagus quadripustulatus mRNA for ribosomal protein L8e (rpL8e gene) Length = 774 Score = 77.8 bits (39), Expect = 4e-11 Identities = 60/67 (89%) Strand = Plus / Minus Query: 307 ggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggcc 366 ||||||| || ||||| ||||||||||| ||||||||||| |||||||||||||| |||| Sbjct: 646 ggttaccaccaccgtgaggatgctcaacggggttcatggcaacaccacgcacctttggcc 587 Query: 367 aggagtt 373 || |||| Sbjct: 586 agcagtt 580
>emb|CR938453.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA1YN07AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 735 Score = 77.8 bits (39), Expect = 4e-11 Identities = 72/83 (86%) Strand = Plus / Minus Query: 318 ccgtggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctc 377 ||||||||||||||||| |||||||| || |||||||| ||||| |||||| |||| | | Sbjct: 728 ccgtggggatgctcaacggggttcatagcaacaccacgtacctttggccagcagttacgc 669 Query: 378 ttcacacggtacttgtggtaggc 400 ||||| ||||||||||||||| Sbjct: 668 ttcaccttgtacttgtggtaggc 646
>dbj|AB242299.1| Asterias amurensis PKA-R mRNA for protein kinase A regulatory subunit, complete cds Length = 2300 Score = 77.8 bits (39), Expect = 4e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||||||||| ||||| || ||||||||||| || ||||||||||| |||||||| Sbjct: 1999 accaatatgctggtgattaccaccaccgtggggatggtccacagggttcattgccacacc 1940 Query: 353 acg 355 ||| Sbjct: 1939 acg 1937
>emb|AL116103.1|CNS01CXB Botrytis cinerea strain T4 cDNA library Length = 660 Score = 77.8 bits (39), Expect = 4e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 652 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 593 Query: 353 acg 355 ||| Sbjct: 592 acg 590
>emb|AL114960.1|CNS01C1K Botrytis cinerea strain T4 cDNA library Length = 480 Score = 77.8 bits (39), Expect = 4e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 214 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 155 Query: 353 acg 355 ||| Sbjct: 154 acg 152
>emb|AL112851.1|CNS01AEZ Botrytis cinerea strain T4 cDNA library Length = 600 Score = 77.8 bits (39), Expect = 4e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 416 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 357 Query: 353 acg 355 ||| Sbjct: 356 acg 354
>emb|AL112838.1|CNS01AEM Botrytis cinerea strain T4 cDNA library Length = 360 Score = 77.8 bits (39), Expect = 4e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 163 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 104 Query: 353 acg 355 ||| Sbjct: 103 acg 101
>emb|AL112486.1|CNS01A4U Botrytis cinerea strain T4 cDNA library Length = 720 Score = 77.8 bits (39), Expect = 4e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| ||||| Sbjct: 587 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 528 Query: 353 acg 355 ||| Sbjct: 527 acg 525
>ref|XM_393671.2| PREDICTED: Apis mellifera similar to ribosomal protein L8 (LOC410188), mRNA Length = 843 Score = 77.8 bits (39), Expect = 4e-11 Identities = 75/87 (86%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || || ||||| || ||||| ||||| |||||||||||||| || ||||| Sbjct: 691 accaatatgttgatgattaccaccaccgtgtggatgttcaacagggttcatagcaacacc 632 Query: 353 acgcaccttaggccaggagttcctctt 379 ||| ||||||||||| |||||||||| Sbjct: 631 acgaaccttaggccaacagttcctctt 605
>emb|AJ563478.1|CGI563478 Crassostrea gigas partial mRNA for ribosomal protein L8 (rpll gene) Length = 305 Score = 77.8 bits (39), Expect = 4e-11 Identities = 75/87 (86%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || |||||||||||||| ||||||||||||||||| |||||||| || || Sbjct: 188 accaatatgttgatggttacctcctccatggggatgctcaacaggattcatggctactcc 129 Query: 353 acgcaccttaggccaggagttcctctt 379 | || || |||||| |||||||||| Sbjct: 128 tctgactttgggccagcagttcctctt 102
>gb|AY533227.1| Chinchilla lanigera ribosomal protein L8 mRNA, partial cds Length = 513 Score = 75.8 bits (38), Expect = 1e-10 Identities = 119/146 (81%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 |||||||||||||| ||||| ||||||||| ||||| ||||||||||||||||| || Sbjct: 335 tgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccacgtaca 276 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcatt 419 |||||| |||||||||| | ||||||||||||||| | |||||||||| || Sbjct: 275 cgtggccagcagttcctctttgccttgtacttgtggtaggctctgccagccttcaagata 216 Query: 420 ggcttctcagtcctgccaccaccagc 445 || || ||| | |||||||||||||| Sbjct: 215 ggtttatcaattctgccaccaccagc 190
>emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1020 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453
>emb|BX071012.1|CNS09QYG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 357 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 416 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 417 ttcggccagcagttgcgcttcaccttgtacttgtggta 454
>emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 469 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438
>emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 775 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 330 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 389 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 390 ttcggccagcagttgcgcttcaccttgtacttgtggta 427
>emb|BX068769.1|CNS09P85 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 993 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457
>emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443
>emb|BX067520.1|CNS09O9G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 525 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445
>emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446
>emb|BX066544.1|CNS09NIC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 350 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 409 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 410 ttcggccagcagttgcgcttcaccttgtacttgtggta 447
>emb|BX065896.1|CNS09N0C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449
>emb|BX064864.1|CNS09M7O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1015 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434
>emb|BX064747.1|CNS09M4F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48BB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 536 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439
>emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 610 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446
>emb|BX063827.1|CNS09LEV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457
>emb|BX063245.1|CNS09KYP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 875 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 400 ttcggccagtagttgcgcttcaccttgtacttgtggta 437
>emb|BX063171.1|CNS09KWN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453
>emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 998 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 398 ttcggccagtagttgcgcttcaccttgtacttgtggta 435
>emb|BX062038.1|CNS09K16 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 626 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 281 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 340 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 341 ttcggccagcagttgcgcttcaccttgtacttgtggta 378
>emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443
>emb|BX061503.1|CNS09JMB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451
>emb|BX061238.1|CNS09JEY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 308 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 367 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 368 ttcggccagcagttgcgcttcaccttgtacttgtggta 405
>emb|BX060724.1|CNS09J0O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41AH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 838 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443
>emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 903 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459
>emb|BX059235.1|CNS09HVB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438
>emb|BX057044.1|CNS09G6G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36DC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 783 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449
>emb|BX056961.1|CNS09G45 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36CG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 831 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459
>emb|BX055189.1|CNS09EQX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33CH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 845 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 350 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 409 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 410 ttcggccagcagttgcgcttcaccttgtacttgtggta 447
>emb|BX054843.1|CNS09EHB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33AG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443
>emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 604 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433
>emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 715 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 656 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 655 ttcggccagcagttgcgcttcaccttgtacttgtggta 618
>emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30BG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 521 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 274 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 333 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 334 ttcggccagcagttgcgcttcaccttgtacttgtggta 371
>emb|BX054430.1|CNS09E5U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 722 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 248 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 307 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 308 ttcggccagcagttgcgcttcaccttgtacttgtggta 345
>emb|BX054417.1|CNS09E5H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32CC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 744 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 685 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 684 ttcggccagcagttgcgcttcaccttgtacttgtggta 647
>emb|BX054379.1|CNS09E4F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 787 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446
>emb|BX053844.1|CNS09DPK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459
>emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31BB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459
>emb|BX052540.1|CNS09CPC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 357 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 416 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 417 ttcggccagcagttgcgcttcaccttgtacttgtggta 454
>emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 521 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 358 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 417 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 418 ttcggccagcagttgcgcttcaccttgtacttgtggta 455
>emb|BX051644.1|CNS09C0G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC29AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 536 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462
>emb|BX051423.1|CNS09BUB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC28DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451
>emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC26BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 536 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441
>emb|BX050810.1|CNS09BDA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449
>emb|BX050569.1|CNS09B6L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27AE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 598 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 334 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 393 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 394 ttcggccagcagttgcgcttcaccttgtacttgtggta 431
>emb|BX049265.1|CNS09A6D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC25AC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457
>emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC24CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 511 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442
>emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC20AD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441
>emb|BX047425.1|CNS098R9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 366 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 425 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 426 ttcggccagcagttgcgcttcaccttgtacttgtggta 463
>emb|BX047145.1|CNS098JH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461
>emb|BX045582.1|CNS097C2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC19DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 567 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453
>emb|BX045137.1|CNS096ZP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC19AF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441
>emb|BX043850.1|CNS095ZY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC16CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 333 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatagccacaccgcgcacc 392 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 393 ttcggccagcagttgcgcttcaccttgtacttgtggta 430
>emb|BX043551.1|CNS095RN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC16BA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 840 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437
>emb|BX041268.1|CNS09408 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12CB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462
>emb|BX041134.1|CNS093WI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438
>emb|BX041072.1|CNS093US Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435
>emb|BX040787.1|CNS093MV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC11DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461
>emb|BX040786.1|CNS093MU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC11DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 716 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 657 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 656 ttcggccagcagttgcgcttcaccttgtacttgtggta 619
>emb|BX039654.1|CNS092RE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10AC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 333 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 392 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 393 ttcggccagcagttgcgcttcaccttgtacttgtggta 430
>emb|BX036687.1|CNS090GZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA8DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 793 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438
>emb|BX037078.1|CNS090RU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9BE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 810 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 726 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 667 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 666 ttcggccagcagttgcgcttcaccttgtacttgtggta 629
>emb|BX035978.1|CNS08ZXA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453
>emb|BX034653.1|CNS08YWH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50CF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435
>emb|BX033967.1|CNS08YDF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445
>emb|BX033761.1|CNS08Y7P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 358 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 417 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 418 ttcggccagcagttgcgcttcaccttgtacttgtggta 455
>emb|BX033234.1|CNS08XT2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435
>emb|BX033107.1|CNS08XPJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 859 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442
>emb|BX032954.1|CNS08XLA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49AF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450
>emb|BX032912.1|CNS08XK4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49AD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1012 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449
>emb|BX032378.1|CNS08X5A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA48BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 640 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437
>emb|BX031877.1|CNS08WRD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47CA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437
>emb|BX031828.1|CNS08WQ0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438
>emb|BX031537.1|CNS08WHX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 827 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433
>emb|BX030749.1|CNS08VW1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA45DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439
>emb|BX031289.1|CNS08WB1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA46CF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433
>emb|BX030002.1|CNS08VBA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1023 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457
>emb|BX029262.1|CNS08UQQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA43DA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439
>emb|BX029602.1|CNS08V06 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44BA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446
>emb|BX028637.1|CNS08U9D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42DB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 882 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445
>emb|BX022357.1|CNS08PEX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 838 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442
>emb|BX026844.1|CNS08SVK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA40BB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 993 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453
>emb|BX026789.1|CNS08SU1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA40AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445
>emb|BX025698.1|CNS08RZQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA39BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450
>emb|BX025349.1|CNS08RQ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451
>emb|BX025079.1|CNS08RIJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437
>emb|BX025073.1|CNS08RID Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434
>emb|BX025038.1|CNS08RHE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38BE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445
>emb|BX025033.1|CNS08RH9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437
>emb|BX024670.1|CNS08R76 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA37DA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 797 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438
>emb|BX024145.1|CNS08QSL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA36DD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 881 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 329 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 388 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 389 ttcggccagcagttgcgcttcaccttgtacttgtggta 426
>emb|BX023815.1|CNS08QJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA36BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 366 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 425 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 426 ttcggccagcagttgcgcttcaccttgtacttgtggta 463
>emb|BX022223.1|CNS08PB7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 376 tgctgatggttaccaccaccgtgcggatgctcgacggggttcattgccacaccgcgcacc 435 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 436 ttcggccagcagttgcgcttcaccttgtacttgtggta 473
>emb|BX021031.1|CNS08OE3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA31AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445
>emb|BX020305.1|CNS08NTX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA3DF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434
>emb|BX018974.1|CNS08MSY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA28DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 859 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439
>emb|BX018003.1|CNS08M1Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA27AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442
>emb|BX017981.1|CNS08M1D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA27AF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438
>emb|BX018524.1|CNS08MGG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA28AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451
>emb|BX018377.1|CNS08MCD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA27DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1034 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457
>emb|BX017737.1|CNS08LUL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA26DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461
>emb|BX017331.1|CNS08LJB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA26AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 850 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434
>emb|BX016524.1|CNS08KWW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24DD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 801 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 627 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 568 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 567 ttcggccagcagttgcgcttcaccttgtacttgtggta 530
>emb|BX016411.1|CNS08KTR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 368 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 427 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 428 ttcggccagcagttgcgcttcaccttgtacttgtggta 465
>emb|BX015958.1|CNS08KH6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA23DG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438
>emb|BX014218.1|CNS08J4U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA21BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 795 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453
>emb|BX013506.1|CNS08IL2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA20BC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 868 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433
>emb|BX013505.1|CNS08IL1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA20BC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 719 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 660 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 659 ttcggccagcagttgcgcttcaccttgtacttgtggta 622
>emb|BX013494.1|CNS08IKQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA20BC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442
>emb|BX012299.1|CNS08HNJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA19CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 765 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450
>emb|BX010378.1|CNS08G66 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA16CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 857 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439
>emb|BX009864.1|CNS08FRW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 854 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441
>emb|BX009834.1|CNS08FR2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449
>emb|BX008448.1|CNS08EOK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA13DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 510 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462
>emb|BX008129.1|CNS08EFP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA13BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 840 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 330 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 389 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 390 ttcggccagcagttgcgcttcaccttgtacttgtggta 427
>emb|BX008128.1|CNS08EFO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA13BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 701 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 642 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 641 ttcggccagcagttgcgcttcaccttgtacttgtggta 604
>emb|BX007575.1|CNS08E0B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA12CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445
>emb|BX006812.1|CNS08DF4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA11BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 483 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 189 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 248 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 249 ttcggccagcagttgcgcttcaccttgtacttgtggta 286
>emb|BX005817.1|CNS08CNH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA10AA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449
>emb|AL112254.1|CNS019YE Botrytis cinerea strain T4 cDNA library Length = 660 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 |||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||| Sbjct: 462 ccaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacca 403 Query: 354 cg 355 || Sbjct: 402 cg 401
>gb|AF401561.1| Ictalurus punctatus ribosomal protein L8 mRNA, complete cds Length = 821 Score = 75.8 bits (38), Expect = 1e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 ||||| ||||| |||||||| || ||| ||||||||||||||||||||| ||||||||| Sbjct: 675 ccaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 616 Query: 354 cgcaccttaggccaggagttcctctt 379 || || ||||||| |||||||||| Sbjct: 615 cggacacgaggccagcagttcctctt 590
>ref|XM_315817.2| Anopheles gambiae str. PEST ENSANGP00000010416 (ENSANGG00000007927), mRNA Length = 1093 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 751 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 692 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397 || |||||| |||| | |||||| |||||||||||| Sbjct: 691 ttcggccagcagttgcgcttcaccttgtacttgtggta 654
>gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal protein L8-like mRNA, complete sequence Length = 881 Score = 73.8 bits (37), Expect = 6e-10 Identities = 85/101 (84%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 |||||||||| ||||||||| ||||||||| ||||||||||||||||||||||| || Sbjct: 703 tgctggtggtcgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 644 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||| |||||||||| | ||||||||||||||| Sbjct: 643 cgtggccagcagttcctcttggccttgtacttgtggtaggc 603
>gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal protein L8-like mRNA, complete sequence Length = 882 Score = 73.8 bits (37), Expect = 6e-10 Identities = 85/101 (84%) Strand = Plus / Minus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 |||||||||| ||||||||| ||||||||| ||||||||||||||||||||||| || Sbjct: 703 tgctggtggtcgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 644 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggc 400 |||||| |||||||||| | ||||||||||||||| Sbjct: 643 cgtggccagcagttcctcttggccttgtacttgtggtaggc 603
>gb|AY769276.1| Bombyx mori ribosomal protein L8 (RpL8) mRNA, complete cds Length = 862 Score = 73.8 bits (37), Expect = 6e-10 Identities = 67/77 (87%) Strand = Plus / Minus Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338 ||||||||||| | ||| ||||| || |||||||| || ||||| |||||||| |||||| Sbjct: 713 acagtggaagccttacctatatgttgatggttaccaccaccgtgaggatgctctacaggg 654 Query: 339 ttcatggccacaccacg 355 |||||||| |||||||| Sbjct: 653 ttcatggcaacaccacg 637
>emb|BX046386.1|CNS097YE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC20AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 868 Score = 73.8 bits (37), Expect = 6e-10 Identities = 82/97 (84%) Strand = Plus / Plus Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359 ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| |||||| Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395 Query: 360 ttaggccaggagttcctcttcacacggtacttgtggt 396 || |||||| |||| | |||||| ||||||||||| Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggt 432
>ref|XM_453766.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D16027g predicted mRNA Length = 765 Score = 71.9 bits (36), Expect = 2e-09 Identities = 108/132 (81%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || |||||||| || ||||| || || ||||||||||||||||| ||||| Sbjct: 660 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 601 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412 ||| ||| ||||| ||||| ||||| || | |||||||||| | || ||||||||| Sbjct: 600 acgagtctttggccaagagtttctcttgactctgtacttgtggaaagcacgaccagcctt 541 Query: 413 cagcattggctt 424 || || |||||| Sbjct: 540 caacaatggctt 529
>emb|AM049008.1| Biphyllus lunatus mRNA for ribosomal protein L8e (rpL8e gene) Length = 774 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| || || |||||||| |||||||| |||||||| || |||||||| || ||||| Sbjct: 660 accaatgtgttgatggttaccacctccgtgaggatgctccacggggttcatagcaacacc 601 Query: 353 acgcaccttaggccag 368 ||| |||||||||||| Sbjct: 600 acgaaccttaggccag 585
>emb|BX054108.1|CNS09DWW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 466 Score = 71.9 bits (36), Expect = 2e-09 Identities = 78/92 (84%) Strand = Plus / Plus Query: 306 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggc 365 |||||||| || ||||| |||||||| || |||||||| |||||||| |||||||| ||| Sbjct: 360 tggttaccgccaccgtgcggatgctcgacggggttcatcgccacaccgcgcaccttcggc 419 Query: 366 caggagttcctcttcacacggtacttgtggta 397 ||| |||| | |||||| |||||||||||| Sbjct: 420 cagcagttgcgcttcaccttgtacttgtggta 451
>emb|BX007182.1|CNS08DPE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA12AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 749 Score = 71.9 bits (36), Expect = 2e-09 Identities = 78/92 (84%) Strand = Plus / Plus Query: 306 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggc 365 |||||||| || ||||| |||||||| || |||||||| |||||||| |||||||| ||| Sbjct: 228 tggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcaccttcggc 287 Query: 366 caggagttcctcttcacacggtacttgtggta 397 ||| |||| | |||||| |||||||||||| Sbjct: 288 cagcagttgcgcttcaccttgtacttgtggta 319
>emb|BX005504.1|CNS08CES Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA1AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 662 Score = 71.9 bits (36), Expect = 2e-09 Identities = 78/92 (84%) Strand = Plus / Plus Query: 306 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggc 365 |||||||| || ||||| |||||||| || |||||||| |||||||| |||||||| ||| Sbjct: 366 tggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcaccttcggc 425 Query: 366 caggagttcctcttcacacggtacttgtggta 397 ||| |||| | |||||| |||||||||||| Sbjct: 426 cagcagttgcgcttcaccttgtacttgtggta 457
>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140 of Kluyveromyces lactis Length = 1715506 Score = 71.9 bits (36), Expect = 2e-09 Identities = 108/132 (81%) Strand = Plus / Plus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 ||||||||| || |||||||| || ||||| || || ||||||||||||||||| ||||| Sbjct: 1350556 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 1350615 Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412 ||| ||| ||||| ||||| ||||| || | |||||||||| | || ||||||||| Sbjct: 1350616 acgagtctttggccaagagtttctcttgactctgtacttgtggaaagcacgaccagcctt 1350675 Query: 413 cagcattggctt 424 || || |||||| Sbjct: 1350676 caacaatggctt 1350687
>gb|BC059473.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:73105 IMAGE:4786513), complete cds Length = 841 Score = 69.9 bits (35), Expect = 9e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| ||||| |||||||| || ||| ||||||||||||||||||||| |||||||| Sbjct: 675 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 616 Query: 353 acg 355 ||| Sbjct: 615 acg 613
>gb|BC043017.1| Mus musculus ribosomal protein L8, mRNA (cDNA clone MGC:57885 IMAGE:5684024), complete cds Length = 861 Score = 69.9 bits (35), Expect = 9e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 ||||| |||||||||||||| ||||| ||||||||| ||||| |||||||||||||| Sbjct: 676 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 617 Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 ||||| |||||| |||||||||| | ||||||||||||||| Sbjct: 616 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 570
>ref|NM_012053.1| Mus musculus ribosomal protein L8 (Rpl8), mRNA Length = 842 Score = 69.9 bits (35), Expect = 9e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 ||||| |||||||||||||| ||||| ||||||||| ||||| |||||||||||||| Sbjct: 680 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 621 Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 ||||| |||||| |||||||||| | ||||||||||||||| Sbjct: 620 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 574
>ref|NM_200713.1| Danio rerio ribosomal protein L8 (rpl8), mRNA Length = 841 Score = 69.9 bits (35), Expect = 9e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| ||||| |||||||| || ||| ||||||||||||||||||||| |||||||| Sbjct: 675 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 616 Query: 353 acg 355 ||| Sbjct: 615 acg 613
>gb|BC065432.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:77641 IMAGE:6996953), complete cds Length = 892 Score = 69.9 bits (35), Expect = 9e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352 |||||| ||||| |||||||| || ||| ||||||||||||||||||||| |||||||| Sbjct: 672 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 613 Query: 353 acg 355 ||| Sbjct: 612 acg 610
>dbj|AK131970.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched library, clone:2510006J21 product:ribosomal protein L8, full insert sequence Length = 848 Score = 69.9 bits (35), Expect = 9e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 ||||| |||||||||||||| ||||| ||||||||| ||||| |||||||||||||| Sbjct: 700 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 641 Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 ||||| |||||| |||||||||| | ||||||||||||||| Sbjct: 640 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 594
>dbj|AK145498.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0007H22 product:ribosomal protein L8, full insert sequence Length = 844 Score = 69.9 bits (35), Expect = 9e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 ||||| |||||||||||||| ||||| ||||||||| ||||| |||||||||||||| Sbjct: 695 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 636 Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 ||||| |||||| |||||||||| | ||||||||||||||| Sbjct: 635 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 589
>dbj|AK146330.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched library, clone:I730056L04 product:ribosomal protein L8, full insert sequence Length = 843 Score = 69.9 bits (35), Expect = 9e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 ||||| |||||||||||||| ||||| ||||||||| ||||| |||||||||||||| Sbjct: 695 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 636 Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 ||||| |||||| |||||||||| | ||||||||||||||| Sbjct: 635 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 589
>dbj|AK152063.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830046M18 product:ribosomal protein L8, full insert sequence Length = 848 Score = 69.9 bits (35), Expect = 9e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353 ||||| |||||||||||||| ||||| ||||||||| ||||| |||||||||||||| Sbjct: 701 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 642 Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400 ||||| |||||| |||||||||| | ||||||||||||||| Sbjct: 641 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 595 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,166,277 Number of Sequences: 3902068 Number of extensions: 4166277 Number of successful extensions: 81678 Number of sequences better than 10.0: 510 Number of HSP's better than 10.0 without gapping: 501 Number of HSP's successfully gapped in prelim test: 9 Number of HSP's that attempted gapping in prelim test: 80527 Number of HSP's gapped (non-prelim): 1113 length of query: 569 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 546 effective length of database: 17,143,297,704 effective search space: 9360240546384 effective search space used: 9360240546384 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)