| Clone Name | rbags9h18 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY846820.1| Triticum aestivum ribosomal protein L6 mRNA, complete cds Length = 686 Score = 848 bits (428), Expect = 0.0 Identities = 522/552 (94%), Gaps = 1/552 (0%) Strand = Plus / Minus Query: 119 taacttagaaggtcatctcatgcggcttgtcgccatccctgagggagaaccgggcaccaa 178 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 683 taacttaaaaggtcatctcatgcggcttgtcgccatccctgagggagaaccgggcaccaa 624 Query: 179 gataacttttaaggtctgggacagcatctatagccttgattaactcagtgtcaatgacct 238 ||||| |||||||||||||||| ||||| ||||||||||| ||||||| ||||||||||| Sbjct: 623 gataatttttaaggtctgggacggcatcgatagccttgatcaactcagcgtcaatgacct 564 Query: 239 tctggtcatccttcttgaagtcgggcagattcttcgttgcctccttctccgactcaaaca 298 |||||||||||||||||||||| |||| |||||| ||||||||||| ||||||||||| | Sbjct: 563 tctggtcatccttcttgaagtctggcaaattcttggttgcctccttatccgactcaaata 504 Query: 299 gctcgccctcagacttctttgccctagtcttcttctccctagcaaagtacttgtcatcaa 358 |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 503 gctcgccctcagtcttctttgccctagtcttcttctccctagcgaagtacttgtcatcaa 444 Query: 359 acttttgcatattaaccttggagatgtcgagccttgtggatgtggaaatgacataagcct 418 |||| |||| ||||||||| |||||||||| | |||||||||||| |||||| ||||||| Sbjct: 443 acttctgcacattaaccttagagatgtcgacctttgtggatgtggcaatgacgtaagcct 384 Query: 419 ggttcactctgcggattggcacgccattgatcttgaaaggtccagtgatgaggagcaggc 478 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 383 ggttcactctgcggattggcacgccattgatcttgaaaggtccagtgatgaggagaaggc 324 Query: 479 cggacttgagctgcttgaggaacacgacgcgcttccccatgtacctccccgcgagcagga 538 |||||| |||||||||||||||||| |||||||| ||||||||||||||||||||||||| Sbjct: 323 cggactggagctgcttgaggaacaccacgcgctttcccatgtacctccccgcgagcagga 264 Query: 539 tcagcaccgtgccccggcgtgatggtcgacctgagcttggtgggatggggcttgcgtgtg 598 ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 263 tcagcaccgtg-cccggtgtgatggtcgacctgagcttggtgggatggggcttgcgtgtg 205 Query: 599 ctgaaggtgcgtggcttgacatcatcggcgggatagaacttgggctcggcgacggcggcc 658 || | ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| Sbjct: 204 ctcacggtgcgtggcttgacatcatcagcgggatagaacttgggctcggcgatggcggcc 145 Query: 659 ggcttctcggcc 670 |||||||||||| Sbjct: 144 ggcttctcggcc 133
>dbj|AK072777.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139B06, full insert sequence Length = 1030 Score = 535 bits (270), Expect = e-149 Identities = 506/582 (86%), Gaps = 2/582 (0%) Strand = Plus / Minus Query: 82 aaaaagactttccacagatcttgaaacttgtaccagataacttagaaggtcatctcatgc 141 |||||||||| || |||| ||||||||||||||| |||||||||| ||||||||||| Sbjct: 770 aaaaagactt-cctcagaacttgaaacttgtaccgactaacttagaatgtcatctcatgg 712 Query: 142 ggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaaggtctgggaca 201 ||||||||||| |||||||| |||||||||||||||||||| ||| |||||||||||| Sbjct: 711 ggcttgtcgccgtccctgagagagaaccgggcaccaagataggatttcaggtctgggaca 652 Query: 202 gcatctatagccttgattaactcagtgtcaatgaccttctggtcatccttcttgaagtcg 261 | || ||||||||||| ||||||| || | |||||||||||||||||||||||||| Sbjct: 651 acctcgatagccttgatcaactcagcatccacagccttctggtcatccttcttgaagtcg 592 Query: 262 ggcagattcttcgttgcctccttctccgactcaaacagctcgccctcagacttctttgcc 321 ||||||||||| |||||||||||||| | |||||| || || ||||| | |||||| ||| Sbjct: 591 ggcagattcttggttgcctccttctctgtctcaaaaagttcaccctcggtcttcttggcc 532 Query: 322 ctagtcttcttctccctagcaaagtacttgtcatcaaacttttgcatattaaccttggag 381 | | |||||| |||| ||||||||||||||||||||||| | || ||||| ||| Sbjct: 531 tttgccttcttgtcccgggcaaagtacttgtcatcaaacttatccaccttaacaccagag 472 Query: 382 atgtcgagccttgtggatgtggaaatgacataagcctggttcactctgcggattggcacg 441 ||||| | | | |||||||||| |||||| || ||||||||||| | |||||| ||||| Sbjct: 471 atgtcaaccttcgtggatgtggcaatgacgtaggcctggttcacacggcggatgggcact 412 Query: 442 ccattgatcttgaaaggtccagtgatgaggagcaggccggacttgagctgcttgaggaac 501 ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 411 ccattgatcttaaaaggtccggtgatgaggagcaggccggacttgagctgcttgaggaac 352 Query: 502 acgacgcgcttccccatgtacctccccgcgagcaggatcagcaccgtgccccggcgtgat 561 |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| Sbjct: 351 acgacgcgcttccccatgtacctcccggcgagcaggatcagcaccgt-ccccggcgtgat 293 Query: 562 ggtcgacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatc 621 |||||||||||||||||| || | || |||||| |||||| || ||| |||||||| || Sbjct: 292 ggtcgacctgagcttggtagggttggccttgcgggtgctgggggcgcggggcttgacgtc 233 Query: 622 atcggcgggatagaacttgggctcggcgacggcggccggctt 663 |||||||| |||||||||||||||||| ||||||| ||||| Sbjct: 232 gtcggcggggtagaacttgggctcggcggcggcggcgggctt 191
>ref|XM_466485.1| Oryza sativa (japonica cultivar-group), mRNA Length = 660 Score = 509 bits (257), Expect = e-141 Identities = 471/541 (87%), Gaps = 1/541 (0%) Strand = Plus / Minus Query: 123 ttagaaggtcatctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagata 182 |||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||| Sbjct: 660 ttagaatgtcatctcatggggcttgtcgccgtccctgagagagaaccgggcaccaagata 601 Query: 183 acttttaaggtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctg 242 ||| |||||||||||| | || ||||||||||| ||||||| || | ||||||| Sbjct: 600 ggatttcaggtctgggacaacctcgatagccttgatcaactcagcatccacagccttctg 541 Query: 243 gtcatccttcttgaagtcgggcagattcttcgttgcctccttctccgactcaaacagctc 302 |||||||||||||||||||||||||||||| |||||||||||||| | |||||| || || Sbjct: 540 gtcatccttcttgaagtcgggcagattcttggttgcctccttctctgtctcaaaaagttc 481 Query: 303 gccctcagacttctttgccctagtcttcttctccctagcaaagtacttgtcatcaaactt 362 ||||| | |||||| ||| | | |||||| |||| ||||||||||||||||||||||| Sbjct: 480 accctcggtcttcttggcctttgccttcttgtcccgggcaaagtacttgtcatcaaactt 421 Query: 363 ttgcatattaaccttggagatgtcgagccttgtggatgtggaaatgacataagcctggtt 422 | || ||||| |||||||| | | | |||||||||| |||||| || |||||||| Sbjct: 420 atccaccttaacaccagagatgtcaaccttcgtggatgtggcaatgacgtaggcctggtt 361 Query: 423 cactctgcggattggcacgccattgatcttgaaaggtccagtgatgaggagcaggccgga 482 ||| | |||||| ||||| ||||||||||| |||||||| |||||||||||||||||||| Sbjct: 360 cacacggcggatgggcactccattgatcttaaaaggtccggtgatgaggagcaggccgga 301 Query: 483 cttgagctgcttgaggaacacgacgcgcttccccatgtacctccccgcgagcaggatcag 542 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 300 cttgagctgcttgaggaacacgacgcgcttccccatgtacctcccggcgagcaggatcag 241 Query: 543 caccgtgccccggcgtgatggtcgacctgagcttggtgggatggggcttgcgtgtgctga 602 |||||| |||||||||||||||||||||||||||||| || | || |||||| |||||| Sbjct: 240 caccgt-ccccggcgtgatggtcgacctgagcttggtagggttggccttgcgggtgctgg 182 Query: 603 aggtgcgtggcttgacatcatcggcgggatagaacttgggctcggcgacggcggccggct 662 || ||| |||||||| || |||||||| |||||||||||||||||| ||||||| |||| Sbjct: 181 gggcgcggggcttgacgtcgtcggcggggtagaacttgggctcggcggcggcggcgggct 122 Query: 663 t 663 | Sbjct: 121 t 121
>ref|XM_472843.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 669 Score = 313 bits (158), Expect = 4e-82 Identities = 435/526 (82%), Gaps = 1/526 (0%) Strand = Plus / Minus Query: 132 catctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaag 191 |||||| || ||||||||||| |||||||| || ||||| |||||||| ||| |||| || Sbjct: 660 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 601 Query: 192 gtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctggtcatcctt 251 || |||||||| || ||||| ||||| ||||| | || | || |||||||| ||||| Sbjct: 600 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 541 Query: 252 cttgaagtcgggcagattcttcgttgcctccttctccgactcaaacagctcgccctcaga 311 ||||| || ||||| ||||| |||||||||||||| | |||||| || || ||||| | Sbjct: 540 tttgaactccggcaggttcttggttgcctccttctcagtctcaaaaagttcaccctcggt 481 Query: 312 cttctttgccctagtcttcttctccctagcaaagtacttgtcatcaaacttttgcatatt 371 |||||| ||| | |||||| ||||||| |||||||||||||||||||| | || ||| Sbjct: 480 cttcttcgccttctgcttcttgtccctagagaagtacttgtcatcaaacttctccacatt 421 Query: 372 aaccttggagatgtcgagccttgtggatgtggaaatgacataagcctggttcactctgcg 431 ||| ||||| || | | ||||||| || | |||||| || | ||||||||| | ||| Sbjct: 420 aacaccagagatatcaacctttgtggacgtagcaatgacgtagggctggttcacacggcg 361 Query: 432 gattggcacgccattgatcttgaaaggtccagtgatgaggagcaggccggacttgagctg 491 ||| || || ||||||||||| |||||||| |||| ||| ||||||||||| |||||||| Sbjct: 360 gatcggaactccattgatcttaaaaggtccggtgacgagaagcaggccggatttgagctg 301 Query: 492 cttgaggaacacgacgcgcttccccatgtacctccccgcgagcaggatcagcaccgtgcc 551 |||||||||||||||||||||||||||| ||||||| ||||||||||||||||| || || Sbjct: 300 cttgaggaacacgacgcgcttccccatgaacctcccggcgagcaggatcagcactgt-cc 242 Query: 552 ccggcgtgatggtcgacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtg 611 | |||||||||| ||||||||||||||| || | ||||||||| |||||| ||| | Sbjct: 241 caggcgtgatggacgacctgagcttggtagggttgggcttgcgggtgctgggctggcggg 182 Query: 612 gcttgacatcatcggcgggatagaacttgggctcggcgacggcggc 657 ||||||| || |||||||| |||||||||||| ||||| ||||||| Sbjct: 181 gcttgacgtcgtcggcggggtagaacttgggcgcggcggcggcggc 136
>dbj|AK067896.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013123D20, full insert sequence Length = 933 Score = 313 bits (158), Expect = 4e-82 Identities = 435/526 (82%), Gaps = 1/526 (0%) Strand = Plus / Minus Query: 132 catctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaag 191 |||||| || ||||||||||| |||||||| || ||||| |||||||| ||| |||| || Sbjct: 714 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 655 Query: 192 gtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctggtcatcctt 251 || |||||||| || ||||| ||||| ||||| | || | || |||||||| ||||| Sbjct: 654 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 595 Query: 252 cttgaagtcgggcagattcttcgttgcctccttctccgactcaaacagctcgccctcaga 311 ||||| || ||||| ||||| |||||||||||||| | |||||| || || ||||| | Sbjct: 594 tttgaactccggcaggttcttggttgcctccttctcagtctcaaaaagttcaccctcggt 535 Query: 312 cttctttgccctagtcttcttctccctagcaaagtacttgtcatcaaacttttgcatatt 371 |||||| ||| | |||||| ||||||| |||||||||||||||||||| | || ||| Sbjct: 534 cttcttcgccttctgcttcttgtccctagagaagtacttgtcatcaaacttctccacatt 475 Query: 372 aaccttggagatgtcgagccttgtggatgtggaaatgacataagcctggttcactctgcg 431 ||| ||||| || | | ||||||| || | |||||| || | ||||||||| | ||| Sbjct: 474 aacaccagagatatcaacctttgtggacgtagcaatgacgtagggctggttcacacggcg 415 Query: 432 gattggcacgccattgatcttgaaaggtccagtgatgaggagcaggccggacttgagctg 491 ||| || || ||||||||||| |||||||| |||| ||| ||||||||||| |||||||| Sbjct: 414 gatcggaactccattgatcttaaaaggtccggtgacgagaagcaggccggatttgagctg 355 Query: 492 cttgaggaacacgacgcgcttccccatgtacctccccgcgagcaggatcagcaccgtgcc 551 |||||||||||||||||||||||||||| ||||||| ||||||||||||||||| || || Sbjct: 354 cttgaggaacacgacgcgcttccccatgaacctcccggcgagcaggatcagcactgt-cc 296 Query: 552 ccggcgtgatggtcgacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtg 611 | |||||||||| ||||||||||||||| || | ||||||||| |||||| ||| | Sbjct: 295 caggcgtgatggacgacctgagcttggtagggttgggcttgcgggtgctgggctggcggg 236 Query: 612 gcttgacatcatcggcgggatagaacttgggctcggcgacggcggc 657 ||||||| || |||||||| |||||||||||| ||||| ||||||| Sbjct: 235 gcttgacgtcgtcggcggggtagaacttgggcgcggcggcggcggc 190
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 192 bits (97), Expect = 1e-45 Identities = 107/109 (98%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 463 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 22903064 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 22903123 Query: 523 ctccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctg 571 ||||| |||||||||||||||||||| |||||||||||||||||||||| Sbjct: 22903124 ctcccggcgagcaggatcagcaccgt-ccccggcgtgatggtcgacctg 22903171 Score = 188 bits (95), Expect = 2e-44 Identities = 174/199 (87%), Gaps = 1/199 (0%) Strand = Plus / Plus Query: 82 aaaaagactttccacagatcttgaaacttgtaccagataacttagaaggtcatctcatgc 141 |||||||||| || |||| ||||||||||||||| |||||||||| ||||||||||| Sbjct: 22901753 aaaaagactt-cctcagaacttgaaacttgtaccgactaacttagaatgtcatctcatgg 22901811 Query: 142 ggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaaggtctgggaca 201 ||||||||||| |||||||| |||||||||||||||||||| ||| |||||||||||| Sbjct: 22901812 ggcttgtcgccgtccctgagagagaaccgggcaccaagataggatttcaggtctgggaca 22901871 Query: 202 gcatctatagccttgattaactcagtgtcaatgaccttctggtcatccttcttgaagtcg 261 | || ||||||||||| ||||||| || | |||||||||||||||||||||||||| Sbjct: 22901872 acctcgatagccttgatcaactcagcatccacagccttctggtcatccttcttgaagtcg 22901931 Query: 262 ggcagattcttcgttgcct 280 ||||||||||| ||||||| Sbjct: 22901932 ggcagattcttggttgcct 22901950 Score = 95.6 bits (48), Expect = 2e-16 Identities = 150/184 (81%) Strand = Plus / Plus Query: 278 cctccttctccgactcaaacagctcgccctcagacttctttgccctagtcttcttctccc 337 |||||||||| | |||||| || || ||||| | |||||| ||| | | |||||| |||| Sbjct: 22902042 cctccttctctgtctcaaaaagttcaccctcggtcttcttggcctttgccttcttgtccc 22902101 Query: 338 tagcaaagtacttgtcatcaaacttttgcatattaaccttggagatgtcgagccttgtgg 397 ||||||||||||||||||||||| | || ||||| |||||||| | | | |||| Sbjct: 22902102 gggcaaagtacttgtcatcaaacttatccaccttaacaccagagatgtcaaccttcgtgg 22902161 Query: 398 atgtggaaatgacataagcctggttcactctgcggattggcacgccattgatcttgaaag 457 |||||| |||||| || ||||||||||| | |||||| ||||| ||||||||||| |||| Sbjct: 22902162 atgtggcaatgacgtaggcctggttcacacggcggatgggcactccattgatcttaaaag 22902221 Query: 458 gtcc 461 |||| Sbjct: 22902222 gtcc 22902225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 84/98 (85%) Strand = Plus / Plus Query: 566 gacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcg 625 |||||||||||||| || | || |||||| |||||| || ||| |||||||| || ||| Sbjct: 22903263 gacctgagcttggtagggttggccttgcgggtgctgggggcgcggggcttgacgtcgtcg 22903322 Query: 626 gcgggatagaacttgggctcggcgacggcggccggctt 663 ||||| |||||||||||||||||| ||||||| ||||| Sbjct: 22903323 gcggggtagaacttgggctcggcggcggcggcgggctt 22903360
>dbj|AP005874.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0016G10 Length = 143211 Score = 192 bits (97), Expect = 1e-45 Identities = 107/109 (98%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 463 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 22866 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 22925 Query: 523 ctccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctg 571 ||||| |||||||||||||||||||| |||||||||||||||||||||| Sbjct: 22926 ctcccggcgagcaggatcagcaccgt-ccccggcgtgatggtcgacctg 22973 Score = 188 bits (95), Expect = 2e-44 Identities = 174/199 (87%), Gaps = 1/199 (0%) Strand = Plus / Plus Query: 82 aaaaagactttccacagatcttgaaacttgtaccagataacttagaaggtcatctcatgc 141 |||||||||| || |||| ||||||||||||||| |||||||||| ||||||||||| Sbjct: 21555 aaaaagactt-cctcagaacttgaaacttgtaccgactaacttagaatgtcatctcatgg 21613 Query: 142 ggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaaggtctgggaca 201 ||||||||||| |||||||| |||||||||||||||||||| ||| |||||||||||| Sbjct: 21614 ggcttgtcgccgtccctgagagagaaccgggcaccaagataggatttcaggtctgggaca 21673 Query: 202 gcatctatagccttgattaactcagtgtcaatgaccttctggtcatccttcttgaagtcg 261 | || ||||||||||| ||||||| || | |||||||||||||||||||||||||| Sbjct: 21674 acctcgatagccttgatcaactcagcatccacagccttctggtcatccttcttgaagtcg 21733 Query: 262 ggcagattcttcgttgcct 280 ||||||||||| ||||||| Sbjct: 21734 ggcagattcttggttgcct 21752 Score = 95.6 bits (48), Expect = 2e-16 Identities = 150/184 (81%) Strand = Plus / Plus Query: 278 cctccttctccgactcaaacagctcgccctcagacttctttgccctagtcttcttctccc 337 |||||||||| | |||||| || || ||||| | |||||| ||| | | |||||| |||| Sbjct: 21844 cctccttctctgtctcaaaaagttcaccctcggtcttcttggcctttgccttcttgtccc 21903 Query: 338 tagcaaagtacttgtcatcaaacttttgcatattaaccttggagatgtcgagccttgtgg 397 ||||||||||||||||||||||| | || ||||| |||||||| | | | |||| Sbjct: 21904 gggcaaagtacttgtcatcaaacttatccaccttaacaccagagatgtcaaccttcgtgg 21963 Query: 398 atgtggaaatgacataagcctggttcactctgcggattggcacgccattgatcttgaaag 457 |||||| |||||| || ||||||||||| | |||||| ||||| ||||||||||| |||| Sbjct: 21964 atgtggcaatgacgtaggcctggttcacacggcggatgggcactccattgatcttaaaag 22023 Query: 458 gtcc 461 |||| Sbjct: 22024 gtcc 22027 Score = 83.8 bits (42), Expect = 7e-13 Identities = 84/98 (85%) Strand = Plus / Plus Query: 566 gacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcg 625 |||||||||||||| || | || |||||| |||||| || ||| |||||||| || ||| Sbjct: 23065 gacctgagcttggtagggttggccttgcgggtgctgggggcgcggggcttgacgtcgtcg 23124 Query: 626 gcgggatagaacttgggctcggcgacggcggccggctt 663 ||||| |||||||||||||||||| ||||||| ||||| Sbjct: 23125 gcggggtagaacttgggctcggcggcggcggcgggctt 23162
>dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0006O15 Length = 139723 Score = 192 bits (97), Expect = 1e-45 Identities = 107/109 (98%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 463 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 136402 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 136461 Query: 523 ctccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctg 571 ||||| |||||||||||||||||||| |||||||||||||||||||||| Sbjct: 136462 ctcccggcgagcaggatcagcaccgt-ccccggcgtgatggtcgacctg 136509 Score = 188 bits (95), Expect = 2e-44 Identities = 174/199 (87%), Gaps = 1/199 (0%) Strand = Plus / Plus Query: 82 aaaaagactttccacagatcttgaaacttgtaccagataacttagaaggtcatctcatgc 141 |||||||||| || |||| ||||||||||||||| |||||||||| ||||||||||| Sbjct: 135091 aaaaagactt-cctcagaacttgaaacttgtaccgactaacttagaatgtcatctcatgg 135149 Query: 142 ggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaaggtctgggaca 201 ||||||||||| |||||||| |||||||||||||||||||| ||| |||||||||||| Sbjct: 135150 ggcttgtcgccgtccctgagagagaaccgggcaccaagataggatttcaggtctgggaca 135209 Query: 202 gcatctatagccttgattaactcagtgtcaatgaccttctggtcatccttcttgaagtcg 261 | || ||||||||||| ||||||| || | |||||||||||||||||||||||||| Sbjct: 135210 acctcgatagccttgatcaactcagcatccacagccttctggtcatccttcttgaagtcg 135269 Query: 262 ggcagattcttcgttgcct 280 ||||||||||| ||||||| Sbjct: 135270 ggcagattcttggttgcct 135288 Score = 95.6 bits (48), Expect = 2e-16 Identities = 150/184 (81%) Strand = Plus / Plus Query: 278 cctccttctccgactcaaacagctcgccctcagacttctttgccctagtcttcttctccc 337 |||||||||| | |||||| || || ||||| | |||||| ||| | | |||||| |||| Sbjct: 135380 cctccttctctgtctcaaaaagttcaccctcggtcttcttggcctttgccttcttgtccc 135439 Query: 338 tagcaaagtacttgtcatcaaacttttgcatattaaccttggagatgtcgagccttgtgg 397 ||||||||||||||||||||||| | || ||||| |||||||| | | | |||| Sbjct: 135440 gggcaaagtacttgtcatcaaacttatccaccttaacaccagagatgtcaaccttcgtgg 135499 Query: 398 atgtggaaatgacataagcctggttcactctgcggattggcacgccattgatcttgaaag 457 |||||| |||||| || ||||||||||| | |||||| ||||| ||||||||||| |||| Sbjct: 135500 atgtggcaatgacgtaggcctggttcacacggcggatgggcactccattgatcttaaaag 135559 Query: 458 gtcc 461 |||| Sbjct: 135560 gtcc 135563 Score = 83.8 bits (42), Expect = 7e-13 Identities = 84/98 (85%) Strand = Plus / Plus Query: 566 gacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcg 625 |||||||||||||| || | || |||||| |||||| || ||| |||||||| || ||| Sbjct: 136601 gacctgagcttggtagggttggccttgcgggtgctgggggcgcggggcttgacgtcgtcg 136660 Query: 626 gcgggatagaacttgggctcggcgacggcggccggctt 663 ||||| |||||||||||||||||| ||||||| ||||| Sbjct: 136661 gcggggtagaacttgggctcggcggcggcggcgggctt 136698
>gb|AY103559.1| Zea mays PCO112591 mRNA sequence Length = 1361 Score = 163 bits (82), Expect = 9e-37 Identities = 200/238 (84%), Gaps = 1/238 (0%) Strand = Plus / Minus Query: 405 aatgacataagcctggttcactctgcggattggcacgccattgatcttgaaaggtccagt 464 ||||||||| | ||||||||| | |||||| || || ||||||||||||||||| |||| Sbjct: 782 aatgacataggtctggttcacacggcggatcggtactccattgatcttgaaaggcccaga 723 Query: 465 gatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtacct 524 ||| ||||||||||| ||||||||||||||||| ||||| || | |||||||||| | | Sbjct: 722 gataaggagcaggccagacttgagctgcttgagaaacaccactctcttccccatgaagcg 663 Query: 525 ccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctgagcttggtgggat 584 ||| ||||| |||||||||||||| ||| ||||||||| |||||||||||||||| || | Sbjct: 662 ccctgcgaggaggatcagcaccgt-cccaggcgtgatgctcgacctgagcttggtaggct 604 Query: 585 ggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcggcgggatagaacttggg 642 |||||||| |||||| ||| |||||||| || ||||| || ||||||||||| Sbjct: 603 taggcttgcgggtgctgggaacgcggggcttgacgtcgtcggcagggtagaacttggg 546 Score = 133 bits (67), Expect = 8e-28 Identities = 190/231 (82%) Strand = Plus / Minus Query: 132 catctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaag 191 ||||||||| |||||||| ||||||||||| ||||||||||| |||||||| |||| || Sbjct: 1055 catctcatggggcttgtcaccatccctgagagagaaccgggcgccaagataggttttcag 996 Query: 192 gtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctggtcatcctt 251 || ||||||| || ||||||||||| | ||| || | |||||||||||||||| Sbjct: 995 ctccaggacagcctcgatagccttgatcagagcagaatccacagccttctggtcatcctt 936 Query: 252 cttgaagtcgggcagattcttcgttgcctccttctccgactcaaacagctcgccctcaga 311 ||||||||| ||||| ||| | ||||||||| || | |||||| ||||||||||| | Sbjct: 935 cttgaagtcaggcagtgacttggatgcctccttttctgtctcaaaaagctcgccctcggt 876 Query: 312 cttctttgccctagtcttcttctccctagcaaagtacttgtcatcaaactt 362 |||||| || | |||||||||||| ||||||||||||||||||||||| Sbjct: 875 cttcttcaccttctgcttcttctccctggcaaagtacttgtcatcaaactt 825
>emb|AL606447.3|OSJN00011 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0022F23, complete sequence Length = 130273 Score = 137 bits (69), Expect = 5e-29 Identities = 100/109 (91%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 463 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 522 |||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||| || Sbjct: 80536 gtgacgagaagcaggccggatttgagctgcttgaggaacacgacgcgcttccccatgaac 80595 Query: 523 ctccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctg 571 ||||| ||||||||||||||||| || ||| |||||||||| ||||||| Sbjct: 80596 ctcccggcgagcaggatcagcactgt-cccaggcgtgatggacgacctg 80643 Score = 73.8 bits (37), Expect = 7e-10 Identities = 121/149 (81%) Strand = Plus / Plus Query: 132 catctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaag 191 |||||| || ||||||||||| |||||||| || ||||| |||||||| ||| |||| || Sbjct: 79067 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 79126 Query: 192 gtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctggtcatcctt 251 || |||||||| || ||||| ||||| ||||| | || | || |||||||| ||||| Sbjct: 79127 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 79186 Query: 252 cttgaagtcgggcagattcttcgttgcct 280 ||||| || ||||| ||||| ||||||| Sbjct: 79187 tttgaactccggcaggttcttggttgcct 79215 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Plus Query: 566 gacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcg 625 |||||||||||||| || | ||||||||| |||||| ||| |||||||| || ||| Sbjct: 80735 gacctgagcttggtagggttgggcttgcgggtgctgggctggcggggcttgacgtcgtcg 80794 Query: 626 gcgggatagaacttgggctcggcgacggcggc 657 ||||| |||||||||||| ||||| ||||||| Sbjct: 80795 gcggggtagaacttgggcgcggcggcggcggc 80826 Score = 63.9 bits (32), Expect = 6e-07 Identities = 146/184 (79%) Strand = Plus / Plus Query: 278 cctccttctccgactcaaacagctcgccctcagacttctttgccctagtcttcttctccc 337 |||||||||| | |||||| || || ||||| | |||||| ||| | |||||| |||| Sbjct: 79304 cctccttctcagtctcaaaaagttcaccctcggtcttcttcgccttctgcttcttgtccc 79363 Query: 338 tagcaaagtacttgtcatcaaacttttgcatattaaccttggagatgtcgagccttgtgg 397 ||| |||||||||||||||||||| | || |||||| ||||| || | | |||||| Sbjct: 79364 tagagaagtacttgtcatcaaacttctccacattaacaccagagatatcaacctttgtgg 79423 Query: 398 atgtggaaatgacataagcctggttcactctgcggattggcacgccattgatcttgaaag 457 | || | |||||| || | ||||||||| | |||||| || || ||||||||||| |||| Sbjct: 79424 acgtagcaatgacgtagggctggttcacacggcggatcggaactccattgatcttaaaag 79483 Query: 458 gtcc 461 |||| Sbjct: 79484 gtcc 79487
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 137 bits (69), Expect = 5e-29 Identities = 100/109 (91%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 463 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 522 |||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||| || Sbjct: 23637855 gtgacgagaagcaggccggatttgagctgcttgaggaacacgacgcgcttccccatgaac 23637914 Query: 523 ctccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctg 571 ||||| ||||||||||||||||| || ||| |||||||||| ||||||| Sbjct: 23637915 ctcccggcgagcaggatcagcactgt-cccaggcgtgatggacgacctg 23637962 Score = 73.8 bits (37), Expect = 7e-10 Identities = 121/149 (81%) Strand = Plus / Plus Query: 132 catctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaag 191 |||||| || ||||||||||| |||||||| || ||||| |||||||| ||| |||| || Sbjct: 23636386 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 23636445 Query: 192 gtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctggtcatcctt 251 || |||||||| || ||||| ||||| ||||| | || | || |||||||| ||||| Sbjct: 23636446 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 23636505 Query: 252 cttgaagtcgggcagattcttcgttgcct 280 ||||| || ||||| ||||| ||||||| Sbjct: 23636506 tttgaactccggcaggttcttggttgcct 23636534 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Plus Query: 566 gacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcg 625 |||||||||||||| || | ||||||||| |||||| ||| |||||||| || ||| Sbjct: 23638054 gacctgagcttggtagggttgggcttgcgggtgctgggctggcggggcttgacgtcgtcg 23638113 Query: 626 gcgggatagaacttgggctcggcgacggcggc 657 ||||| |||||||||||| ||||| ||||||| Sbjct: 23638114 gcggggtagaacttgggcgcggcggcggcggc 23638145 Score = 63.9 bits (32), Expect = 6e-07 Identities = 146/184 (79%) Strand = Plus / Plus Query: 278 cctccttctccgactcaaacagctcgccctcagacttctttgccctagtcttcttctccc 337 |||||||||| | |||||| || || ||||| | |||||| ||| | |||||| |||| Sbjct: 23636623 cctccttctcagtctcaaaaagttcaccctcggtcttcttcgccttctgcttcttgtccc 23636682 Query: 338 tagcaaagtacttgtcatcaaacttttgcatattaaccttggagatgtcgagccttgtgg 397 ||| |||||||||||||||||||| | || |||||| ||||| || | | |||||| Sbjct: 23636683 tagagaagtacttgtcatcaaacttctccacattaacaccagagatatcaacctttgtgg 23636742 Query: 398 atgtggaaatgacataagcctggttcactctgcggattggcacgccattgatcttgaaag 457 | || | |||||| || | ||||||||| | |||||| || || ||||||||||| |||| Sbjct: 23636743 acgtagcaatgacgtagggctggttcacacggcggatcggaactccattgatcttaaaag 23636802 Query: 458 gtcc 461 |||| Sbjct: 23636803 gtcc 23636806
>dbj|AB167080.1| Curculigo latifolia NAS-2 mRNA for neoculin acid subunit, complete cds Length = 655 Score = 91.7 bits (46), Expect = 3e-15 Identities = 92/106 (86%), Gaps = 1/106 (0%) Strand = Plus / Plus Query: 487 agctgcttgaggaacacgacgcgcttccccatgtacctccccgcgagcaggatcagcacc 546 |||||||| ||||| ||||| | |||||||||| ||||||| ||||| |||||||||||| Sbjct: 1 agctgcttcaggaaaacgaccctcttccccatgaacctcccggcgagaaggatcagcacc 60 Query: 547 gtgccccggcgtgatggtcgacctgagcttggtgggatggggcttg 592 || |||||| || ||| ||| ||||||||||||||| | ||||||| Sbjct: 61 gt-ccccggagtaatgctcggcctgagcttggtgggcttgggcttg 105
>dbj|AB035569.1| Chara globularis cgrpl6 mRNA for 60S ribosomal protein L6 CgRPL6, partial cds Length = 609 Score = 48.1 bits (24), Expect = 0.038 Identities = 33/36 (91%) Strand = Plus / Minus Query: 477 gccggacttgagctgcttgaggaacacgacgcgctt 512 |||||||| ||||||||||||||| || |||||||| Sbjct: 228 gccggactcgagctgcttgaggaataccacgcgctt 193
>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete sequence Length = 1507550 Score = 44.1 bits (22), Expect = 0.59 Identities = 43/50 (86%) Strand = Plus / Minus Query: 378 ggagatgtcgagccttgtggatgtggaaatgacataagcctggttcactc 427 ||||||||||| | | ||||| |||| ||||||||| |||||| |||||| Sbjct: 868847 ggagatgtcgaccttggtggaagtggcaatgacataggcctggctcactc 868798
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 44.1 bits (22), Expect = 0.59 Identities = 22/22 (100%) Strand = Plus / Plus Query: 641 ggctcggcgacggcggccggct 662 |||||||||||||||||||||| Sbjct: 546189 ggctcggcgacggcggccggct 546210
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 44.1 bits (22), Expect = 0.59 Identities = 22/22 (100%) Strand = Plus / Minus Query: 641 ggctcggcgacggcggccggct 662 |||||||||||||||||||||| Sbjct: 3228900 ggctcggcgacggcggccggct 3228879
>ref|XM_571207.1| Cryptococcus neoformans var. neoformans JEC21 structural constituent of ribosome (CNE03060) partial mRNA Length = 764 Score = 44.1 bits (22), Expect = 0.59 Identities = 43/50 (86%) Strand = Plus / Minus Query: 378 ggagatgtcgagccttgtggatgtggaaatgacataagcctggttcactc 427 ||||||||||| | | ||||| |||| ||||||||| |||||| |||||| Sbjct: 475 ggagatgtcgaccttggtggaagtggcaatgacataggcctggctcactc 426
>emb|AL121581.41|HS1022E24 Human DNA sequence from clone RP5-1022E24 on chromosome 20 Contains the 3' end of the OPRL1 gene for opiate receptor-like 1 protein, the GPR8 gene encoding a G protein-coupled receptor, the KIAA0835 gene encoding a protein similar to the myelin transcription factor 1 (MYT1), a novel gene, 7 CpG islands, ESTs, STSs and GSSs, complete sequence Length = 179888 Score = 44.1 bits (22), Expect = 0.59 Identities = 25/26 (96%) Strand = Plus / Plus Query: 227 tgtcaatgaccttctggtcatccttc 252 |||||||||||||||||||| ||||| Sbjct: 127616 tgtcaatgaccttctggtcagccttc 127641
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 44.1 bits (22), Expect = 0.59 Identities = 22/22 (100%) Strand = Plus / Minus Query: 641 ggctcggcgacggcggccggct 662 |||||||||||||||||||||| Sbjct: 2958765 ggctcggcgacggcggccggct 2958744
>emb|AJ011715.1|CPA011715 Cyanophora paradoxa mRNA for 60S ribosomal protein L6 (YL 16 like) Length = 806 Score = 44.1 bits (22), Expect = 0.59 Identities = 43/50 (86%) Strand = Plus / Minus Query: 463 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgctt 512 |||| |||||| ||||| ||| ||||||||| ||||| ||||||||||| Sbjct: 361 gtgacgaggaggaggcccgacgcgagctgcttcaggaagacgacgcgctt 312
>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence Length = 1395069 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 525 ccccgcgagcaggatcagcac 545 ||||||||||||||||||||| Sbjct: 1275949 ccccgcgagcaggatcagcac 1275969
>ref|XM_363819.1| Magnaporthe grisea 70-15 hypothetical protein (MG01745.4) partial mRNA Length = 1389 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 336 cctagcaaagtacttgtcatc 356 ||||||||||||||||||||| Sbjct: 798 cctagcaaagtacttgtcatc 778
>gb|AC073073.2| Homo sapiens BAC clone RP11-251G23 from 7, complete sequence Length = 114414 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 222 ctcagtgtcaatgaccttctg 242 ||||||||||||||||||||| Sbjct: 94051 ctcagtgtcaatgaccttctg 94071
>gb|AC074397.7| Homo sapiens BAC clone RP11-598O8 from 7, complete sequence Length = 114576 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 358 aacttttgcatattaaccttg 378 ||||||||||||||||||||| Sbjct: 52941 aacttttgcatattaaccttg 52921
>gb|DQ351275.1| Streptomyces sp. NRRL 30748 meridamycin biosynthetic gene cluster and flanking regions Length = 116831 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 460 ccagtgatgaggagcaggccg 480 ||||||||||||||||||||| Sbjct: 39372 ccagtgatgaggagcaggccg 39352
>gb|AC159883.2| Mus musculus BAC clone RP24-490A17 from chromosome 9, complete sequence Length = 140400 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 397 gatgtggaaatgacataagcc 417 ||||||||||||||||||||| Sbjct: 31574 gatgtggaaatgacataagcc 31594
>gb|AC151614.2| Emiliania huxleyi clone JGIACCU-13K1, complete sequence Length = 42022 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 638 ttgggctcggcgacggcggccggct 662 ||||||||||||| ||||||||||| Sbjct: 28962 ttgggctcggcgagggcggccggct 28938
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 316 tttgccctagtcttcttctccctag 340 |||||||| |||||||||||||||| Sbjct: 24939950 tttgcccttgtcttcttctccctag 24939926
>dbj|AP003541.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0530H05 Length = 145952 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 316 tttgccctagtcttcttctccctag 340 |||||||| |||||||||||||||| Sbjct: 34505 tttgcccttgtcttcttctccctag 34481
>dbj|AP004737.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0072A21 Length = 158287 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 316 tttgccctagtcttcttctccctag 340 |||||||| |||||||||||||||| Sbjct: 151033 tttgcccttgtcttcttctccctag 151009
>gb|AC161256.3| Mus musculus BAC clone RP24-70H20 from chromosome 9, complete sequence Length = 190832 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 397 gatgtggaaatgacataagcc 417 ||||||||||||||||||||| Sbjct: 178331 gatgtggaaatgacataagcc 178351
>gb|AC022675.7| Mus musculus chromosome 1, clone RP23-59N15, complete sequence Length = 181063 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 ccctcagacttctttgccct 323 |||||||||||||||||||| Sbjct: 146509 ccctcagacttctttgccct 146528
>gb|AC098742.4| Mus musculus BAC clone RP23-122N2 from 14, complete sequence Length = 218683 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 324 agtcttcttctccctagcaa 343 |||||||||||||||||||| Sbjct: 217214 agtcttcttctccctagcaa 217195
>gb|AC146748.16| Medicago truncatula clone mth2-65k8, complete sequence Length = 113744 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 343 aagtacttgtcatcaaactt 362 |||||||||||||||||||| Sbjct: 68034 aagtacttgtcatcaaactt 68015
>emb|AL590677.7| Human DNA sequence from clone RP11-214D15 on chromosome 10 Contains the 5' end of the gene for a novel protein (FLJ40283), a novel gene and two CpG islands, complete sequence Length = 127714 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 110712 acttttgcatattaaccttg 110693
>emb|AL355485.9| Human DNA sequence from clone RP11-240M20 on chromosome 13, complete sequence Length = 149684 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 114492 acttttgcatattaaccttg 114473
>gb|AE005744.1| Caulobacter crescentus CB15 section 70 of 359 of the complete genome Length = 11532 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 646 ggcgacggcggccggcttctcggc 669 |||| ||||||||||||||||||| Sbjct: 7720 ggcggcggcggccggcttctcggc 7697
>dbj|AK094601.1| Homo sapiens cDNA FLJ37282 fis, clone BRAMY2013216 Length = 2669 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 2530 acttttgcatattaaccttg 2549
>gb|AC017063.8| Homo sapiens BAC clone RP11-354H17 from 4, complete sequence Length = 193092 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 2 aaatatttaacaggtagaaataaa 25 |||||| ||||||||||||||||| Sbjct: 147063 aaatatgtaacaggtagaaataaa 147040
>gb|AC004671.1| Homo sapiens 12p13.3 PAC RPCI3-340I3 (Roswell Park Cancer Institute Human PAC Library) complete sequence Length = 141266 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 342 aaagtacttgtcatcaaact 361 |||||||||||||||||||| Sbjct: 99726 aaagtacttgtcatcaaact 99707
>gb|AC108157.3| Homo sapiens BAC clone RP11-580P21 from 4, complete sequence Length = 167001 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 50763 acttttgcatattaaccttg 50782
>gb|AC097659.3| Homo sapiens BAC clone RP11-408C24 from 4, complete sequence Length = 131944 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 93 ccacagatcttgaaacttgt 112 |||||||||||||||||||| Sbjct: 10651 ccacagatcttgaaacttgt 10670
>gb|AC074349.6| Homo sapiens BAC clone RP11-703G6 from 4, complete sequence Length = 176467 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 81321 acttttgcatattaaccttg 81340
>gb|AC069200.6| Homo sapiens BAC clone RP11-177J6 from 4, complete sequence Length = 148930 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 146643 acttttgcatattaaccttg 146662
>gb|AC026692.5| Homo sapiens chromosome 5 clone CTC-257L10, complete sequence Length = 139377 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 125269 acttttgcatattaaccttg 125250
>gb|AC035147.4| Homo sapiens chromosome 5 clone CTD-2309M13, complete sequence Length = 104940 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 41370 acttttgcatattaaccttg 41389
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 651 cggcggccggcttctcggcc 670 |||||||||||||||||||| Sbjct: 4104242 cggcggccggcttctcggcc 4104223
>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome Length = 6260361 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 268 ttcttcgttgcctccttctc 287 |||||||||||||||||||| Sbjct: 3692721 ttcttcgttgcctccttctc 3692702
>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V, complete sequence Length = 1519138 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 433 attggcacgccattgatctt 452 |||||||||||||||||||| Sbjct: 995834 attggcacgccattgatctt 995815
>gb|AC068282.8| Homo sapiens BAC clone RP11-314L11 from 2, complete sequence Length = 205342 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 125957 acttttgcatattaaccttg 125976
>gb|AC044787.6|AC044787 Homo sapiens chromosome 15 clone CTD-2270N23 map 15q21, complete sequence Length = 148147 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 96958 acttttgcatattaaccttg 96939
>gb|AC017006.4| Homo sapiens BAC clone RP11-110G2 from 2, complete sequence Length = 191953 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 85108 acttttgcatattaaccttg 85127
>gb|AE004558.1| Pseudomonas aeruginosa PAO1, section 119 of 529 of the complete genome Length = 9917 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 553 cggcgtgatggtcgacctga 572 |||||||||||||||||||| Sbjct: 5781 cggcgtgatggtcgacctga 5762
>emb|X69378.1|MCYL16 M.crystallinum mRNA for ribosomal protein YL16 Length = 1015 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 343 aagtacttgtcatcaaactt 362 |||||||||||||||||||| Sbjct: 541 aagtacttgtcatcaaactt 522
>gb|AC154243.2| Mus musculus BAC clone RP24-173F3 from 14, complete sequence Length = 152254 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 324 agtcttcttctccctagcaa 343 |||||||||||||||||||| Sbjct: 68001 agtcttcttctccctagcaa 67982
>ref|NM_210401.1| Eremothecium gossypii AER190Wp (AER190W), mRNA Length = 3036 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 433 attggcacgccattgatctt 452 |||||||||||||||||||| Sbjct: 1301 attggcacgccattgatctt 1282
>gb|AC004047.1|AC004047 Homo sapiens chromosome 4 clone B150J4 map 4q25, complete sequence Length = 134649 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 59996 acttttgcatattaaccttg 60015
>gb|AC005394.1|AC005394 Homo sapiens chromosome 19, cosmid F8518, complete sequence Length = 44935 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 1571 acttttgcatattaaccttg 1590
>emb|AL354819.15| Human DNA sequence from clone RP11-7B3 on chromosome 13 Contains the 3' end of the gene for a novel calx-beta domain containing protein similar to sea urchin ECM3, a novel gene, a phospholipase A2 group XII (PLA2G12) pseudogene and a novel KIAA0565 KIAA1074 and breast cancer antigen NY-BR-1 containing pseudogene, complete sequence Length = 153149 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 acttttgcatattaaccttg 378 |||||||||||||||||||| Sbjct: 124129 acttttgcatattaaccttg 124110
>gb|AC161427.4| Gallus gallus BAC clone CH261-60M14 from chromosome ul, complete sequence Length = 174770 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 235 accttctggtcatccttctt 254 |||||||||||||||||||| Sbjct: 148480 accttctggtcatccttctt 148499
>emb|AL365314.16| Mouse DNA sequence from clone RP23-106N23 on chromosome 1, complete sequence Length = 182054 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 304 ccctcagacttctttgccct 323 |||||||||||||||||||| Sbjct: 74893 ccctcagacttctttgccct 74874 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,487,260 Number of Sequences: 3902068 Number of extensions: 5487260 Number of successful extensions: 95445 Number of sequences better than 10.0: 61 Number of HSP's better than 10.0 without gapping: 61 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 94747 Number of HSP's gapped (non-prelim): 671 length of query: 670 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 647 effective length of database: 17,143,297,704 effective search space: 11091713614488 effective search space used: 11091713614488 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)