| Clone Name | rbags9d07 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY123418.1| Triticum aestivum putative ribosomal protein S18 mRNA, complete cds Length = 868 Score = 365 bits (184), Expect = 7e-98 Identities = 233/247 (94%), Gaps = 8/247 (3%) Strand = Plus / Minus Query: 137 aggaattcaagatacaatatattaaaggttccagaaccgaaaaacattatctagggcaaa 196 |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 825 aggaattcaagatacaatatattaaaggttccagaacc--aaaacattatctagggcaaa 768 Query: 197 acatcatccaaggtaatcgtctaaacaggaacactccttcagattctggaaatggaccaa 256 ||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| Sbjct: 767 acatcatccaaggtaatcgtctaaacaagaacactccttaagattgtggaaatggaccaa 708 Query: 257 cacagtaatggtagcaaagctatgcgggatcattgagaagc---ttatcgcttcttggag 313 ||||||| ||||||||||||||||||||| ||| ||||| |||||||||||||||| Sbjct: 707 cacagta---gtagcaaagctatgcgggatctttgtgaagcagcttatcgcttcttggag 651 Query: 314 acaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacggacacgcacg 373 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 650 acaccaacagtctttcctctcctgccggtagtctttgtgtgctgaccacggacacgcacg 591 Query: 374 ccccagt 380 ||||||| Sbjct: 590 ccccagt 584
>ref|XM_476794.1| Oryza sativa (japonica cultivar-group), mRNA Length = 438 Score = 111 bits (56), Expect = 2e-21 Identities = 68/72 (94%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 438 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 379 Query: 358 accacggacacg 369 |||||||||||| Sbjct: 378 accacggacacg 367
>ref|XM_476789.1| Oryza sativa (japonica cultivar-group), mRNA Length = 447 Score = 111 bits (56), Expect = 2e-21 Identities = 68/72 (94%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 447 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 388 Query: 358 accacggacacg 369 |||||||||||| Sbjct: 387 accacggacacg 376
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 111 bits (56), Expect = 2e-21 Identities = 68/72 (94%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 3931978 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 3931919 Query: 358 accacggacacg 369 |||||||||||| Sbjct: 3931918 accacggacacg 3931907 Score = 111 bits (56), Expect = 2e-21 Identities = 68/72 (94%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 3917582 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 3917523 Query: 358 accacggacacg 369 |||||||||||| Sbjct: 3917522 accacggacacg 3917511 Score = 103 bits (52), Expect = 4e-19 Identities = 67/72 (93%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 3906977 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 3906918 Query: 358 accacggacacg 369 ||| |||||||| Sbjct: 3906917 accgcggacacg 3906906
>dbj|AP004670.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0496D04 Length = 197358 Score = 111 bits (56), Expect = 2e-21 Identities = 68/72 (94%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 171090 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 171031 Query: 358 accacggacacg 369 |||||||||||| Sbjct: 171030 accacggacacg 171019 Score = 111 bits (56), Expect = 2e-21 Identities = 68/72 (94%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 156694 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 156635 Query: 358 accacggacacg 369 |||||||||||| Sbjct: 156634 accacggacacg 156623 Score = 103 bits (52), Expect = 4e-19 Identities = 67/72 (93%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 146089 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 146030 Query: 358 accacggacacg 369 ||| |||||||| Sbjct: 146029 accgcggacacg 146018
>dbj|AP003843.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1656_E11 Length = 116211 Score = 111 bits (56), Expect = 2e-21 Identities = 68/72 (94%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 34704 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 34645 Query: 358 accacggacacg 369 |||||||||||| Sbjct: 34644 accacggacacg 34633 Score = 111 bits (56), Expect = 2e-21 Identities = 68/72 (94%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 20308 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 20249 Query: 358 accacggacacg 369 |||||||||||| Sbjct: 20248 accacggacacg 20237 Score = 103 bits (52), Expect = 4e-19 Identities = 67/72 (93%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 9703 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 9644 Query: 358 accacggacacg 369 ||| |||||||| Sbjct: 9643 accgcggacacg 9632
>gb|AF400215.1| Spodoptera frugiperda ribosomal protein S18 mRNA, complete cds Length = 604 Score = 105 bits (53), Expect = 1e-19 Identities = 71/77 (92%) Strand = Plus / Minus Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363 |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 553 cttcttagatacaccaacagttcttcctctcctgccggtagtcttggtgtgctgaccacg 494 Query: 364 gacacgcacgccccagt 380 ||||||| |||||||| Sbjct: 493 cacacgcaggccccagt 477
>ref|XM_476787.1| Oryza sativa (japonica cultivar-group), mRNA Length = 459 Score = 103 bits (52), Expect = 4e-19 Identities = 67/72 (93%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 459 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 400 Query: 358 accacggacacg 369 ||| |||||||| Sbjct: 399 accgcggacacg 388
>gb|AY109733.1| Zea mays CL5075_1 mRNA sequence Length = 865 Score = 99.6 bits (50), Expect = 6e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 295 agcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||| |||||||||||||||||||||| |||||||| | |||||| |||||||||||||| Sbjct: 542 agctcatcgcttcttggagacaccaacggtctttccacgcctgccagtagtcttggtgtg 483 Query: 355 ctgaccacggacacgcacgccccagt 380 ||| |||||||| || | |||||||| Sbjct: 482 ctggccacggacgcggaggccccagt 457
>gb|AY496116.1| Capsicum annuum putative ribosomal protein mRNA, complete cds Length = 771 Score = 93.7 bits (47), Expect = 4e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||||||||||||||| || | ||| || ||||| |||||||| Sbjct: 555 ttatctcttcttggagacaccaacagtctttcccctgcggccagtggtctttgtgtgctg 496 Query: 358 accacggacacgcacgccccagt 380 |||||||||||| | |||||||| Sbjct: 495 accacggacacggaggccccagt 473
>ref|XM_469971.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1013 Score = 89.7 bits (45), Expect = 6e-15 Identities = 75/85 (88%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||||||||||||||| ||||| |||||||| || ||||| ||||| |||||||||||| Sbjct: 553 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 494 Query: 356 tgaccacggacacgcacgccccagt 380 || ||||| ||||| | |||||||| Sbjct: 493 tgcccacgcacacggaggccccagt 469
>gb|AC092076.7| Oryza sativa chromosome 3 BAC OSJNBb0021G19 genomic sequence, complete sequence Length = 141582 Score = 89.7 bits (45), Expect = 6e-15 Identities = 75/85 (88%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||||||||||||||| ||||| |||||||| || ||||| ||||| |||||||||||| Sbjct: 137481 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 137422 Query: 356 tgaccacggacacgcacgccccagt 380 || ||||| ||||| | |||||||| Sbjct: 137421 tgcccacgcacacggaggccccagt 137397
>gb|AC090871.11| Oryza sativa chromosome 3 BAC OSJNBb0060J21 genomic sequence, complete sequence Length = 162497 Score = 89.7 bits (45), Expect = 6e-15 Identities = 75/85 (88%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||||||||||||||| ||||| |||||||| || ||||| ||||| |||||||||||| Sbjct: 1847 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 1788 Query: 356 tgaccacggacacgcacgccccagt 380 || ||||| ||||| | |||||||| Sbjct: 1787 tgcccacgcacacggaggccccagt 1763
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 89.7 bits (45), Expect = 6e-15 Identities = 75/85 (88%) Strand = Plus / Plus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||||||||||||||| ||||| |||||||| || ||||| ||||| |||||||||||| Sbjct: 32742060 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 32742119 Query: 356 tgaccacggacacgcacgccccagt 380 || ||||| ||||| | |||||||| Sbjct: 32742120 tgcccacgcacacggaggccccagt 32742144
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 89.7 bits (45), Expect = 6e-15 Identities = 75/85 (88%) Strand = Plus / Plus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||||||||||||||| ||||| |||||||| || ||||| ||||| |||||||||||| Sbjct: 32832570 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 32832629 Query: 356 tgaccacggacacgcacgccccagt 380 || ||||| ||||| | |||||||| Sbjct: 32832630 tgcccacgcacacggaggccccagt 32832654
>dbj|AB180432.1| Plutella xylostella mRNA for Ribosomal protein S18, complete cds Length = 483 Score = 89.7 bits (45), Expect = 6e-15 Identities = 69/77 (89%) Strand = Plus / Minus Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363 ||||||||| |||||||||||| | |||||||||||||| ||||||||||||||||| || Sbjct: 475 cttcttggacacaccaacagtcctgcctctcctgccggtggtcttggtgtgctgaccgcg 416 Query: 364 gacacgcacgccccagt 380 || |||| |||||||| Sbjct: 415 cacgcgcaggccccagt 399
>dbj|AK059548.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-F08, full insert sequence Length = 728 Score = 89.7 bits (45), Expect = 6e-15 Identities = 75/85 (88%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||||||||||||||| ||||| |||||||| || ||||| ||||| |||||||||||| Sbjct: 549 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 490 Query: 356 tgaccacggacacgcacgccccagt 380 || ||||| ||||| | |||||||| Sbjct: 489 tgcccacgcacacggaggccccagt 465
>dbj|AK058881.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-B06, full insert sequence Length = 1013 Score = 89.7 bits (45), Expect = 6e-15 Identities = 75/85 (88%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||||||||||||||| ||||| |||||||| || ||||| ||||| |||||||||||| Sbjct: 553 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 494 Query: 356 tgaccacggacacgcacgccccagt 380 || ||||| ||||| | |||||||| Sbjct: 493 tgcccacgcacacggaggccccagt 469
>gb|AC148397.13| Medicago truncatula clone mth2-22h4, complete sequence Length = 131213 Score = 83.8 bits (42), Expect = 4e-13 Identities = 75/86 (87%) Strand = Plus / Plus Query: 295 agcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||||| |||||||| || |||||||| ||||||||||| | ||| ||||||||||| || Sbjct: 66762 agcttaacgcttctttgacacaccaactgtctttcctctgcggccagtagtcttggtatg 66821 Query: 355 ctgaccacggacacgcacgccccagt 380 ||||||||| ||||| | |||||||| Sbjct: 66822 ctgaccacgaacacgaaggccccagt 66847 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Plus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||| |||||||| ||||||||||| |||||||| || | ||| ||||||||||| ||| Sbjct: 93987 gcttaacgcttctttgagacaccaacggtctttcccctgcggcctgtagtcttggtatgc 94046 Query: 356 tgaccacggacacgcacgccccagt 380 |||||||| ||||| | |||||||| Sbjct: 94047 tgaccacgaacacgaaggccccagt 94071
>ref|XM_789831.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal protein S18 (LOC590220), mRNA Length = 563 Score = 83.8 bits (42), Expect = 4e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||||||| |||||||||||| ||||||||||||| ||||||||||||||||| Sbjct: 525 cttcttggacacaccaacagtccttcctctcctgccagtagtcttggtgtgctg 472
>ref|XM_778977.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal protein S18 (LOC578831), mRNA Length = 516 Score = 83.8 bits (42), Expect = 4e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||||||| |||||||||||| ||||||||||||| ||||||||||||||||| Sbjct: 477 cttcttggacacaccaacagtccttcctctcctgccagtagtcttggtgtgctg 424
>gb|AY769334.1| Bombyx mori ribosomal protein S18 (RpS18) mRNA, complete cds Length = 578 Score = 81.8 bits (41), Expect = 1e-12 Identities = 68/77 (88%) Strand = Plus / Minus Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363 |||||| || ||||||||||| ||||||||||||| |||||||| |||||||||||||| Sbjct: 525 cttctttgatacaccaacagttcttcctctcctgccagtagtcttagtgtgctgaccacg 466 Query: 364 gacacgcacgccccagt 380 ||||| | |||||||| Sbjct: 465 cacacgaaggccccagt 449
>ref|XM_360287.1| Magnaporthe grisea 70-15 hypothetical protein (MG05661.4) partial mRNA Length = 471 Score = 81.8 bits (41), Expect = 1e-12 Identities = 68/77 (88%) Strand = Plus / Minus Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363 ||||||||| ||||| || ||| |||||||| |||||| |||||||||||||||||||| Sbjct: 459 cttcttggacacaccgacggtccgtcctctccggccggtcgtcttggtgtgctgaccacg 400 Query: 364 gacacgcacgccccagt 380 |||||| | |||||||| Sbjct: 399 gacacggaggccccagt 383
>gb|AY849628.1| Magnaporthe grisea 40S ribosomal protein S18-like protein mRNA, complete cds Length = 713 Score = 81.8 bits (41), Expect = 1e-12 Identities = 68/77 (88%) Strand = Plus / Minus Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363 ||||||||| ||||| || ||| |||||||| |||||| |||||||||||||||||||| Sbjct: 510 cttcttggacacaccgacggtccgtcctctccggccggtcgtcttggtgtgctgaccacg 451 Query: 364 gacacgcacgccccagt 380 |||||| | |||||||| Sbjct: 450 gacacggaggccccagt 434
>emb|AM048974.1| Sphaerius sp. APV-2005 mRNA for ribosomal protein S18e (rpS18e gene) Length = 459 Score = 79.8 bits (40), Expect = 6e-12 Identities = 55/60 (91%) Strand = Plus / Minus Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363 ||||||||| ||||||||||| ||||||| |||||||||||||||||||| |||||||| Sbjct: 453 cttcttggacacaccaacagttcttcctcttctgccggtagtcttggtgtgttgaccacg 394
>gb|DQ200372.1| Solanum tuberosum clone 058H04 unknown mRNA Length = 690 Score = 71.9 bits (36), Expect = 1e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||||||||||||||||||||||||||||||||| | || || ||||| || ||||| Sbjct: 512 ttatcgcttcttggagacaccaacagtctttcctcggcgaccagtggtcttagtatgctg 453 Query: 358 accacggacacg 369 |||||| ||||| Sbjct: 452 accacgcacacg 441
>gb|BT013131.1| Lycopersicon esculentum clone 114423F, mRNA sequence Length = 778 Score = 69.9 bits (35), Expect = 6e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357 ||||| ||||||||||||||||||||||||||| || | || || ||||| |||||||| Sbjct: 536 ttatctcttcttggagacaccaacagtctttcccctgcgaccagtggtctttgtgtgctg 477 Query: 358 accacggacacgcacgccccagt 380 ||| || ||||| | |||||||| Sbjct: 476 accgcgaacacggaggccccagt 454
>ref|NM_117048.2| Arabidopsis thaliana RPS18C (S18 RIBOSOMAL PROTEIN); RNA binding / structural constituent of ribosome AT4G09800 (RPS18C) mRNA, complete cds Length = 748 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||| |||||||| ||||||||||||||||||||||| | || |||||||||||||| Sbjct: 563 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 506
>emb|AL161516.2|ATCHRIV28 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 28 Length = 198005 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||| |||||||| ||||||||||||||||||||||| | || |||||||||||||| Sbjct: 187 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 130
>emb|AL161515.2|ATCHRIV27 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 27 Length = 197394 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||| |||||||| ||||||||||||||||||||||| | || |||||||||||||| Sbjct: 192581 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 192524
>emb|AL049482.1|ATF17A8 Arabidopsis thaliana DNA chromosome 4, BAC clone F17A8 (ESSA project) Length = 128071 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||| |||||||| ||||||||||||||||||||||| | || |||||||||||||| Sbjct: 73280 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 73223
>gb|AY064680.1| Arabidopsis thaliana S18.A ribosomal protein (At4g09800; F17A8.150) mRNA, complete cds Length = 478 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||| |||||||| ||||||||||||||||||||||| | || |||||||||||||| Sbjct: 460 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 403
>gb|AF386941.1|AF386941 Arabidopsis thaliana S18.A ribosomal protein (F17A8.150) mRNA, complete cds Length = 738 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||| |||||||| ||||||||||||||||||||||| | || |||||||||||||| Sbjct: 553 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 496
>gb|AF370463.1|AF370463 Arabidopsis thaliana S18.A ribosomal protein (F17A8.150) mRNA, complete cds Length = 687 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||| |||||||| ||||||||||||||||||||||| | || |||||||||||||| Sbjct: 548 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 491
>gb|AY086334.1| Arabidopsis thaliana clone 24071 mRNA, complete sequence Length = 712 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||| |||||||| ||||||||||||||||||||||| | || |||||||||||||| Sbjct: 563 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 506
>emb|Z28962.1|ATS18RP3 A.thaliana (Columbia) gene for S18 ribosomal protein (1471bp) Length = 1471 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||| |||||||| ||||||||||||||||||||||| | || |||||||||||||| Sbjct: 1397 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 1340
>gb|BT006539.1| Arabidopsis thaliana At4g09800 gene, complete cds Length = 459 Score = 65.9 bits (33), Expect = 9e-08 Identities = 48/53 (90%) Strand = Plus / Minus Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||||||| ||||||||||||||||||||||| | || |||||||||||||| Sbjct: 455 cgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 403
>gb|AY342352.1| Ixodes ricinus ribosomal protein S18 mRNA, partial cds Length = 456 Score = 61.9 bits (31), Expect = 1e-06 Identities = 64/75 (85%) Strand = Plus / Minus Query: 305 ttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacgg 364 |||||||| ||||| |||||| |||| ||||| ||||| |||||||||||||| || | Sbjct: 452 ttcttggacacaccgacagtccttcccctccttccggtggtcttggtgtgctgtcccctc 393 Query: 365 acacgcacgccccag 379 ||||||| ||||||| Sbjct: 392 acacgcaggccccag 378
>gb|DQ066248.1| Ixodes scapularis isolate ISN-L-49 ribosomal protein S18 mRNA, partial cds Length = 459 Score = 61.9 bits (31), Expect = 1e-06 Identities = 64/75 (85%) Strand = Plus / Minus Query: 305 ttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacgg 364 |||||||| ||||| |||||| |||| |||||||| || |||||||||||||| || | Sbjct: 452 ttcttggacacaccgacagtccttcccctcctgccagtggtcttggtgtgctgtcccctc 393 Query: 365 acacgcacgccccag 379 ||||||| ||||||| Sbjct: 392 acacgcaggccccag 378
>ref|NM_103125.2| Arabidopsis thaliana RNA binding / structural constituent of ribosome AT1G34030 mRNA, complete cds Length = 754 Score = 60.0 bits (30), Expect = 5e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||| |||||||| || |||||||||||||||||||| | || || ||||||||||| Sbjct: 546 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 487 Query: 356 tgaccacggacacg 369 || ||||| ||||| Sbjct: 486 tgtccacgaacacg 473
>gb|AY070029.1| Arabidopsis thaliana putative ribosomal protein S18 (At1g34030) mRNA, complete cds Length = 490 Score = 60.0 bits (30), Expect = 5e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||| |||||||| || |||||||||||||||||||| | || || ||||||||||| Sbjct: 461 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 402 Query: 356 tgaccacggacacg 369 || ||||| ||||| Sbjct: 401 tgtccacgaacacg 388
>gb|AY034965.1| Arabidopsis thaliana putative ribosomal protein S18 (At1g34030) mRNA, complete cds Length = 759 Score = 60.0 bits (30), Expect = 5e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||| |||||||| || |||||||||||||||||||| | || || ||||||||||| Sbjct: 545 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 486 Query: 356 tgaccacggacacg 369 || ||||| ||||| Sbjct: 485 tgtccacgaacacg 472
>emb|BX816977.1|CNS0ADD2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH79ZE08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 685 Score = 60.0 bits (30), Expect = 5e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||| |||||||| || |||||||||||||||||||| | || || ||||||||||| Sbjct: 530 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 471 Query: 356 tgaccacggacacg 369 || ||||| ||||| Sbjct: 470 tgtccacgaacacg 457
>gb|AC079286.2|AC079286 Arabidopsis thaliana chromosome 1 BAC T15K4 genomic sequence, complete sequence Length = 33513 Score = 60.0 bits (30), Expect = 5e-06 Identities = 63/74 (85%) Strand = Plus / Plus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||| |||||||| || |||||||||||||||||||| | || || ||||||||||| Sbjct: 24671 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 24730 Query: 356 tgaccacggacacg 369 || ||||| ||||| Sbjct: 24731 tgtccacgaacacg 24744
>gb|AC015446.4|AC015446 Arabidopsis thaliana chromosome I BAC F12G12 genomic sequence, complete sequence Length = 125632 Score = 60.0 bits (30), Expect = 5e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||| |||||||| || |||||||||||||||||||| | || || ||||||||||| Sbjct: 87090 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 87031 Query: 356 tgaccacggacacg 369 || ||||| ||||| Sbjct: 87030 tgtccacgaacacg 87017
>gb|AY086800.1| Arabidopsis thaliana clone 27800 mRNA, complete sequence Length = 693 Score = 60.0 bits (30), Expect = 5e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||| |||||||| || |||||||||||||||||||| | || || ||||||||||| Sbjct: 546 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 487 Query: 356 tgaccacggacacg 369 || ||||| ||||| Sbjct: 486 tgtccacgaacacg 473
>emb|Z28702.1|ATS18RP2 A.thaliana (Columbia) mRNA for S18 ribosomal protein (641bp) Length = 647 Score = 60.0 bits (30), Expect = 5e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355 ||||| |||||||| || |||||||||||||||||||| | || || ||||||||||| Sbjct: 494 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 435 Query: 356 tgaccacggacacg 369 || ||||| ||||| Sbjct: 434 tgtccacgaacacg 421
>ref|XM_746138.1| Aspergillus fumigatus Af293 ribosomal protein S13p/S18e (Afu6g13550) partial mRNA Length = 384 Score = 58.0 bits (29), Expect = 2e-05 Identities = 29/29 (100%) Strand = Plus / Minus Query: 341 gtagtcttggtgtgctgaccacggacacg 369 ||||||||||||||||||||||||||||| Sbjct: 338 gtagtcttggtgtgctgaccacggacacg 310
>ref|NM_102125.2| Arabidopsis thaliana PFL (POINTED FIRST LEAVES); RNA binding / structural constituent of ribosome AT1G22780 (PFL) mRNA, complete cds Length = 752 Score = 56.0 bits (28), Expect = 9e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361 ||||||||||| ||||||||||||||||| | | ||||| || ||||||||||| ||| Sbjct: 581 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 522 Query: 362 cggacacg 369 || ||||| Sbjct: 521 cgtacacg 514
>gb|BT020298.1| Arabidopsis thaliana At1g22780 gene, complete cds Length = 474 Score = 56.0 bits (28), Expect = 9e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361 ||||||||||| ||||||||||||||||| | | ||||| || ||||||||||| ||| Sbjct: 470 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 411 Query: 362 cggacacg 369 || ||||| Sbjct: 410 cgtacacg 403
>gb|BT025610.1| Arabidopsis thaliana At1g22780 mRNA, complete cds Length = 459 Score = 56.0 bits (28), Expect = 9e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361 ||||||||||| ||||||||||||||||| | | ||||| || ||||||||||| ||| Sbjct: 455 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 396 Query: 362 cggacacg 369 || ||||| Sbjct: 395 cgtacacg 388
>ref|XM_657953.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5441.2), mRNA Length = 468 Score = 56.0 bits (28), Expect = 9e-05 Identities = 31/32 (96%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacg 369 ||||||||||| |||||||||||||||||||| Sbjct: 425 ccggtagtcttcgtgtgctgaccacggacacg 394
>ref|XM_752114.1| Ustilago maydis 521 hypothetical protein (UM01060.1) partial mRNA Length = 465 Score = 56.0 bits (28), Expect = 9e-05 Identities = 28/28 (100%) Strand = Plus / Minus Query: 344 gtcttggtgtgctgaccacggacacgca 371 |||||||||||||||||||||||||||| Sbjct: 422 gtcttggtgtgctgaccacggacacgca 395
>ref|XM_387069.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG06893.1) partial mRNA Length = 540 Score = 56.0 bits (28), Expect = 9e-05 Identities = 31/32 (96%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacg 369 ||||| |||||||||||||||||||||||||| Sbjct: 494 ccggtggtcttggtgtgctgaccacggacacg 463
>gb|AF548335.1| Branchiostoma belcheri ribosomal protein S18 mRNA, complete cds Length = 558 Score = 56.0 bits (28), Expect = 9e-05 Identities = 40/44 (90%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||| |||||||||||||| ||||| ||||||| |||||||| Sbjct: 454 gccggtggtcttggtgtgctgtccacgcacacgcaggccccagt 411
>emb|Y12227.1|ATY12227 Arabidopsis thaliana DNA, 24 kb surrounding PFL locus Length = 24053 Score = 56.0 bits (28), Expect = 9e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361 ||||||||||| ||||||||||||||||| | | ||||| || ||||||||||| ||| Sbjct: 22237 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 22178 Query: 362 cggacacg 369 || ||||| Sbjct: 22177 cgtacacg 22170
>gb|AF526232.1| Argopecten irradians isolate iolsaicl552ct593cn617 ribosomal protein S18 mRNA, complete cds Length = 532 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363 |||||||| ||||||||||| ||||||||||||| || ||||| |||||||| ||||| Sbjct: 481 cttcttggccacaccaacagttcttcctctcctgccagttgtctttgtgtgctgtccacg 422
>gb|AF411781.1|AF411781 Arabidopsis thaliana At1g22780/T22J18_5 mRNA, complete cds Length = 632 Score = 56.0 bits (28), Expect = 9e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361 ||||||||||| ||||||||||||||||| | | ||||| || ||||||||||| ||| Sbjct: 514 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 455 Query: 362 cggacacg 369 || ||||| Sbjct: 454 cgtacacg 447
>emb|BX813906.1|CNS0ACAK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB47ZA11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 674 Score = 56.0 bits (28), Expect = 9e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361 ||||||||||| ||||||||||||||||| | | ||||| || ||||||||||| ||| Sbjct: 515 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 456 Query: 362 cggacacg 369 || ||||| Sbjct: 455 cgtacacg 448
>gb|AC003979.2|T22J18 Arabidopsis thaliana chromosome 1 BAC T22J18 sequence, complete sequence Length = 84162 Score = 56.0 bits (28), Expect = 9e-05 Identities = 58/68 (85%) Strand = Plus / Plus Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361 ||||||||||| ||||||||||||||||| | | ||||| || ||||||||||| ||| Sbjct: 10133 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 10192 Query: 362 cggacacg 369 || ||||| Sbjct: 10193 cgtacacg 10200
>gb|AY087428.1| Arabidopsis thaliana clone 35333 mRNA, complete sequence Length = 709 Score = 56.0 bits (28), Expect = 9e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361 ||||||||||| ||||||||||||||||| | | ||||| || ||||||||||| ||| Sbjct: 581 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 522 Query: 362 cggacacg 369 || ||||| Sbjct: 521 cgtacacg 514
>emb|Z23165.1|ATRBPS18A A.thaliana ribosomal protein gene S18, complete CDS Length = 2848 Score = 56.0 bits (28), Expect = 9e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361 ||||||||||| ||||||||||||||||| | | ||||| || ||||||||||| ||| Sbjct: 2355 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 2296 Query: 362 cggacacg 369 || ||||| Sbjct: 2295 cgtacacg 2288
>emb|Z28701.1|ATS18RP1 A.thaliana (C24) mRNA for S18 ribosomal protein Length = 683 Score = 56.0 bits (28), Expect = 9e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361 ||||||||||| ||||||||||||||||| | | ||||| || ||||||||||| ||| Sbjct: 526 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 467 Query: 362 cggacacg 369 || ||||| Sbjct: 466 cgtacacg 459
>gb|AY440501.1| Armigeres subalbatus ASAP ID: 41411 cytosolic small ribosomal subunit S18 mRNA sequence Length = 578 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 ||||| ||||||||||||||||| || ||||||| |||||||| Sbjct: 455 ccggtggtcttggtgtgctgaccgcgcacacgcaggccccagt 413
>emb|BX072327.1|CNS09RYZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 721 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 300 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 342
>emb|BX072326.1|CNS09RYY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 653 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 484 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 442
>emb|BX072311.1|CNS09RYJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 658 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 287 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 329
>emb|BX072310.1|CNS09RYI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 595 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 460
>emb|BX072288.1|CNS09RXW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 663 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 309 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 351
>emb|BX072287.1|CNS09RXV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 695 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 460
>emb|BX069062.1|CNS09PGA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 790 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 485 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 443
>emb|BX063555.1|CNS09L7B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45BG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 272 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 314
>emb|BX063554.1|CNS09L7A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 807 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 489 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 447
>emb|BX049522.1|CNS09ADI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 499 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 457
>emb|BX048448.1|CNS099JO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC23CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 806 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 280 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 322
>emb|BX048447.1|CNS099JN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 794 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 478 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 436
>emb|BX043249.1|CNS095J9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 823 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 493 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 451
>emb|BX042743.1|CNS09557 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC14DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 703 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 269 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 311
>emb|BX042742.1|CNS09556 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC14DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 773 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 487 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 445
>emb|BX038898.1|CNS0926E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3CA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 698 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 304 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 346
>emb|BX038897.1|CNS0926D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3CA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 699 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 504 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 462
>emb|BX038809.1|CNS0923X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 701 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 300 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 342
>emb|BX038808.1|CNS0923W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 686 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 503 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 461
>emb|BX038794.1|CNS0923I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 752 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 301 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 343
>emb|BX038793.1|CNS0923H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 758 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 460
>emb|BX038685.1|CNS0920H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3AG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 701 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 304 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 346
>emb|BX038684.1|CNS0920G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3AG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 703 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 442 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 400
>emb|BX038638.1|CNS091Z6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 759 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 298 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 340
>emb|BX038637.1|CNS091Z5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 765 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 504 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 462
>emb|BX038386.1|CNS091S6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 446 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 71 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 113
>emb|BX038260.1|CNS091OO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2CD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 720 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 500 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 458
>emb|BX037931.1|CNS091FJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 692 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 313 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 355
>emb|BX037930.1|CNS091FI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 504 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 462
>emb|BX037628.1|CNS09174 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1AF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 729 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 460
>emb|BX037395.1|CNS0910N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 273 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 315
>emb|BX037394.1|CNS0910M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 491 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 449
>emb|BX036909.1|CNS090N5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 812 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 483 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 441
>emb|BX034354.1|CNS08YO6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50AH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 498 ccggtagttttcgtgtgctgaccacggacacgcaaaccccagt 456
>emb|BX034173.1|CNS08YJ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 790 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 257 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 299
>emb|BX033670.1|CNS08Y56 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5BA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 865 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 266 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 308
>emb|BX033669.1|CNS08Y55 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5BA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 493 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 451
>emb|BX033110.1|CNS08XPM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49BF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 759 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 441 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 399
>emb|BX032956.1|CNS08XLC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49AF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 462 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 267 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 309
>emb|BX032190.1|CNS08X02 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47DH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 786 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 256 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 298
>emb|BX032189.1|CNS08X01 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47DH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 788 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 464 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 422
>emb|BX030688.1|CNS08VUC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 800 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 477 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 435
>emb|BX027156.1|CNS08T48 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA40CH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 826 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 489 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 447
>emb|BX026624.1|CNS08SPG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA4DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 594 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 246 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 288
>emb|BX026623.1|CNS08SPF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 782 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 467 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 425
>emb|BX023324.1|CNS08Q5S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA35CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 827 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 288 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 330
>emb|BX023323.1|CNS08Q5R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 498 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 456
>emb|BX022521.1|CNS08PJH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 683 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 388 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 346
>emb|BX021989.1|CNS08P4P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA32CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 554 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 262 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 304
>emb|BX021988.1|CNS08P4O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA32CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 852 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 524 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 482
>emb|BX021615.1|CNS08OUB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA32AC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 698 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 456 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 414
>emb|BX020788.1|CNS08O7C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA30CF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 496 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 270 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 312
>emb|BX020787.1|CNS08O7B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30CF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 407 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 82 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 40
>emb|BX016687.1|CNS08L1F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA25AD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 795 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 480 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 438
>emb|BX009941.1|CNS08FU1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA16AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 795 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 257 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 299
>emb|BX009940.1|CNS08FU0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA16AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 475 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 433
>emb|BX009870.1|CNS08FS2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 487 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 279 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 321
>emb|BX009869.1|CNS08FS1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA15DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 823 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 498 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 456
>emb|AJ843092.1| Platichthys flesus mRNA for 40S ribosomal protein S18 (rps18 gene) Length = 530 Score = 54.0 bits (27), Expect = 3e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgca 371 |||||| |||||||||||||||||||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctgaccacgcacacgca 411
>gb|AF283268.1|AF283268 Anopheles gambiae strain G3 ribosomal protein S18 (IrpS18) mRNA, partial cds Length = 379 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 101 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 59
>ref|XM_311570.2| Anopheles gambiae str. PEST ENSANGP00000022445 (ENSANGG00000020271), partial mRNA Length = 459 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||||| || |||||||||||||||||||||| ||||||| Sbjct: 419 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 377
>gb|L22959.1|DRORPS18A Drosophila melanogaster ribosomal protein S18 mRNA, complete cds Length = 567 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 ||||| |||||||||||||||||||| ||||| | |||||||| Sbjct: 419 ccggtggtcttggtgtgctgaccacgcacacggaggccccagt 377
>emb|AL845501.9| Mouse DNA sequence from clone RP23-194C12 on chromosome 4 Contains a ribosomal protein S18 (Rps18) pseudogene, complete sequence Length = 156572 Score = 52.0 bits (26), Expect = 0.001 Identities = 35/38 (92%) Strand = Plus / Plus Query: 341 gtagtcttggtgtgctgaccacggacacgcacgcccca 378 |||||||||||||||||||| |||||||| | |||||| Sbjct: 57217 gtagtcttggtgtgctgaccgcggacacgaaggcccca 57254
>emb|BX826567.1|CNS0A3AT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB41ZD05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 646 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354 |||| ||||||| || |||||||||||||||||||| | || |||||||||||||| Sbjct: 544 cttaacgcttctctgacacaccaacagtctttcctctgcgaccagtagtcttggtgtg 487
>dbj|AB182248.1| Antheraea yamamai Antheraea S18 gene mRNA for ribosomal protein S18, complete cds Length = 541 Score = 52.0 bits (26), Expect = 0.001 Identities = 56/66 (84%) Strand = Plus / Minus Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363 ||||||||||||||||||||| | ||||| ||||| || ||||| ||||| ||||| || Sbjct: 491 cttcttggagacaccaacagttctacctcttctgcctgtggtcttagtgtgttgaccgcg 432 Query: 364 gacacg 369 ||||| Sbjct: 431 aacacg 426
>emb|BX050031.1|CNS09ARN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26BA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 798 Score = 50.1 bits (25), Expect = 0.005 Identities = 37/41 (90%) Strand = Plus / Minus Query: 340 ggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 |||||| || |||||||||||||||||||||| ||||||| Sbjct: 466 ggtagttttcgtgtgctgaccacggacacgcagaccccagt 426
>emb|BX006616.1|CNS08D9O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA11AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 803 Score = 50.1 bits (25), Expect = 0.005 Identities = 31/33 (93%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgc 370 |||||||| || ||||||||||||||||||||| Sbjct: 483 ccggtagttttcgtgtgctgaccacggacacgc 451
>emb|BX814653.1|CNS0AC5P Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZC12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 636 Score = 50.1 bits (25), Expect = 0.005 Identities = 28/29 (96%) Strand = Plus / Minus Query: 302 cgcttcttggagacaccaacagtctttcc 330 ||||||||||| ||||||||||||||||| Sbjct: 494 cgcttcttggaaacaccaacagtctttcc 466
>gb|DQ413212.1| Acyrthosiphon pisum isolate WHAP0121 putative ribosomal protein S18 mRNA, complete cds Length = 459 Score = 48.1 bits (24), Expect = 0.021 Identities = 51/60 (85%) Strand = Plus / Minus Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363 |||||| || ||||||||||| ||||||| | |||||||| ||||| ||||||||||| Sbjct: 453 cttcttagatacaccaacagttcttcctctacgtccggtagttttggtatgctgaccacg 394
>dbj|AB226103.1| Aspergillus oryzae cDNA, contig sequence: AoEST2960 Length = 720 Score = 48.1 bits (24), Expect = 0.021 Identities = 30/32 (93%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacg 369 ||||| |||||||||||||| ||||||||||| Sbjct: 469 ccggtggtcttggtgtgctgtccacggacacg 438
>dbj|AP007174.1| Aspergillus oryzae RIB40 genomic DNA, SC103 Length = 1282697 Score = 48.1 bits (24), Expect = 0.021 Identities = 30/32 (93%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacg 369 ||||| |||||||||||||| ||||||||||| Sbjct: 854331 ccggtggtcttggtgtgctgtccacggacacg 854300
>ref|NM_213557.1| Rattus norvegicus ribosomal protein S18 (Rps18), mRNA Length = 548 Score = 46.1 bits (23), Expect = 0.083 Identities = 32/35 (91%) Strand = Plus / Minus Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378 ||||||||||||||||| |||||||| | |||||| Sbjct: 458 gtcttggtgtgctgaccccggacacgaaggcccca 424
>gb|BC081458.1| Mus musculus ribosomal protein S18, mRNA (cDNA clone MGC:102109 IMAGE:5712669), complete cds Length = 530 Score = 46.1 bits (23), Expect = 0.083 Identities = 32/35 (91%) Strand = Plus / Minus Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378 ||||||||||||||||| |||||||| | |||||| Sbjct: 422 gtcttggtgtgctgaccgcggacacgaaggcccca 388
>gb|BC081459.1| Mus musculus ribosomal protein S18, mRNA (cDNA clone MGC:102110 IMAGE:6407328), complete cds Length = 541 Score = 46.1 bits (23), Expect = 0.083 Identities = 32/35 (91%) Strand = Plus / Minus Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378 ||||||||||||||||| |||||||| | |||||| Sbjct: 434 gtcttggtgtgctgaccgcggacacgaaggcccca 400
>gb|AY190738.1| Pagrus major 40S ribosomal protein S18 mRNA, partial cds Length = 477 Score = 46.1 bits (23), Expect = 0.083 Identities = 32/35 (91%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgca 371 |||||| ||||||||||||||||| || ||||||| Sbjct: 385 gccggtggtcttggtgtgctgaccgcgcacacgca 351
>ref|NM_011296.1| Mus musculus ribosomal protein S18 (Rps18), mRNA Length = 525 Score = 46.1 bits (23), Expect = 0.083 Identities = 32/35 (91%) Strand = Plus / Minus Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378 ||||||||||||||||| |||||||| | |||||| Sbjct: 435 gtcttggtgtgctgaccgcggacacgaaggcccca 401
>gb|BC100604.1| Mus musculus ribosomal protein S18, transcript variant 1, mRNA (cDNA clone MGC:118719 IMAGE:30120583), complete cds Length = 560 Score = 46.1 bits (23), Expect = 0.083 Identities = 32/35 (91%) Strand = Plus / Minus Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378 ||||||||||||||||| |||||||| | |||||| Sbjct: 456 gtcttggtgtgctgaccgcggacacgaaggcccca 422
>gb|AC158364.4| Mus musculus BAC clone RP23-187J8 from chromosome 8, complete sequence Length = 208153 Score = 46.1 bits (23), Expect = 0.083 Identities = 32/35 (91%) Strand = Plus / Plus Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378 ||||||||||||||||| |||||||| | |||||| Sbjct: 42385 gtcttggtgtgctgaccgcggacacgaaggcccca 42419
>gb|DQ084044.1| Oxyuranus scutellatus 40S ribosomal protein S18 mRNA, partial cds Length = 285 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| || |||||||| | ||||||| Sbjct: 249 gccggtggtcttggtgtgctggccccggacacggaggccccag 207
>emb|X57529.1|RRRPS18A R.rattus ribosomal protein S18 mRNA Length = 516 Score = 46.1 bits (23), Expect = 0.083 Identities = 32/35 (91%) Strand = Plus / Minus Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378 ||||||||||||||||| |||||||| | |||||| Sbjct: 450 gtcttggtgtgctgaccccggacacgaaggcccca 416
>gb|AC124397.5| Mus musculus BAC clone RP24-348J16 from chromosome 13, complete sequence Length = 191713 Score = 46.1 bits (23), Expect = 0.083 Identities = 32/35 (91%) Strand = Plus / Minus Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378 ||||||||||||||||| |||||||| | |||||| Sbjct: 188285 gtcttggtgtgctgaccgcggacacgaaggcccca 188251
>gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, complete sequence Length = 189936 Score = 46.1 bits (23), Expect = 0.083 Identities = 32/35 (91%) Strand = Plus / Plus Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378 ||||||||||||||||| |||||||| | |||||| Sbjct: 143765 gtcttggtgtgctgaccgcggacacgaaggcccca 143799
>emb|CR734899.2|CNS0GTTU Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR734341.2|CNS0GTEC Tetraodon nigroviridis full-length cDNA Length = 520 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 439 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 397
>emb|CR674974.2|CNS0FJS4 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR734533.2|CNS0GTJO Tetraodon nigroviridis full-length cDNA Length = 516 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR733895.2|CNS0GT1Y Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR733804.2|CNS0GSZF Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR720262.2|CNS0GIP8 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>gb|AY232075.1| Drosophila yakuba clone yak-ad_RpS18 mRNA sequence Length = 456 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 ||||| |||||||||||||| ||||| ||||| | |||||||| Sbjct: 419 ccggtggtcttggtgtgctggccacgaacacggaggccccagt 377
>emb|CR722880.2|CNS0GKPY Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR722776.2|CNS0GKN2 Tetraodon nigroviridis full-length cDNA Length = 499 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 419 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 377
>gb|AY231741.1| Drosophila yakuba clone yak-em_RpS18 mRNA sequence Length = 456 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380 ||||| |||||||||||||| ||||| ||||| | |||||||| Sbjct: 419 ccggtggtcttggtgtgctggccacgaacacggaggccccagt 377
>emb|CR722174.2|CNS0GK6C Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR721952.2|CNS0GK06 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR720455.2|CNS0GIUL Tetraodon nigroviridis full-length cDNA Length = 444 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 363 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 321
>emb|CR704786.2|CNS0G6RI Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR703781.2|CNS0G5ZL Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR703599.2|CNS0G5UJ Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR703505.2|CNS0G5RX Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR703433.2|CNS0G5PX Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR702036.2|CNS0G4N4 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR702025.2|CNS0G4MT Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR702003.2|CNS0G4M7 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR701412.2|CNS0G45S Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR701350.2|CNS0G442 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR701061.2|CNS0G3W1 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR699796.2|CNS0G2WW Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR699943.2|CNS0G30Z Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR699936.2|CNS0G30S Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR699450.2|CNS0G2NA Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR691285.2|CNS0FWCH Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR698404.2|CNS0G1U8 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR697912.2|CNS0G1GK Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR697012.2|CNS0G0RK Tetraodon nigroviridis full-length cDNA Length = 527 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR696669.2|CNS0G0I1 Tetraodon nigroviridis full-length cDNA Length = 525 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402
>emb|CR696546.2|CNS0G0EM Tetraodon nigroviridis full-length cDNA Length = 525 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402
>emb|CR696299.2|CNS0G07R Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR694383.2|CNS0FYQJ Tetraodon nigroviridis full-length cDNA Length = 523 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR694171.2|CNS0FYKN Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR694138.2|CNS0FYJQ Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR694134.2|CNS0FYJM Tetraodon nigroviridis full-length cDNA Length = 525 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402
>emb|CR694030.2|CNS0FYGQ Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR693776.2|CNS0FY9O Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR693694.2|CNS0FY7E Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR693089.2|CNS0FXQL Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR692975.2|CNS0FXNF Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR692013.2|CNS0FWWP Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR690406.2|CNS0FVO2 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR689779.2|CNS0FV6N Tetraodon nigroviridis full-length cDNA Length = 525 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402
>emb|CR688604.2|CNS0FUA0 Tetraodon nigroviridis full-length cDNA Length = 525 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR688046.2|CNS0FTUI Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR687925.2|CNS0FTR5 Tetraodon nigroviridis full-length cDNA Length = 477 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 396 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 354
>emb|CR686387.2|CNS0FSKF Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR686304.2|CNS0FSI4 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR686239.2|CNS0FSGB Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR685614.2|CNS0FRYY Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR684442.2|CNS0FR2E Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR683437.2|CNS0FQAH Tetraodon nigroviridis full-length cDNA Length = 523 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400
>emb|CR683517.2|CNS0FQCP Tetraodon nigroviridis full-length cDNA Length = 523 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400
>emb|CR682886.2|CNS0FPV6 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR682487.2|CNS0FPK3 Tetraodon nigroviridis full-length cDNA Length = 640 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 559 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 517
>emb|CR682175.2|CNS0FPBF Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR681394.2|CNS0FOPQ Tetraodon nigroviridis full-length cDNA Length = 525 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402
>emb|CR680612.2|CNS0FO40 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR679692.2|CNS0FNEG Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR679567.2|CNS0FNAZ Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR678814.2|CNS0FMQ2 Tetraodon nigroviridis full-length cDNA Length = 496 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 415 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 373
>emb|CR679090.2|CNS0FMXQ Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR678273.2|CNS0FMB8 Tetraodon nigroviridis full-length cDNA Length = 1133 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 1079 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 1037
>emb|CR678694.2|CNS0FMMQ Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR677677.2|CNS0FLUU Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR677659.2|CNS0FLUC Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR678402.1|CNS0FMEQ Tetraodon nigroviridis full-length cDNA Length = 1170 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 1098 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 1056
>emb|CR677875.2|CNS0FM0B Tetraodon nigroviridis full-length cDNA Length = 537 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 454 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 412
>emb|CR677055.2|CNS0FLDN Tetraodon nigroviridis full-length cDNA Length = 530 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR676589.2|CNS0FL0P Tetraodon nigroviridis full-length cDNA Length = 1175 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 1101 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 1059
>emb|CR676244.2|CNS0FKR4 Tetraodon nigroviridis full-length cDNA Length = 499 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR675831.2|CNS0FKFX Tetraodon nigroviridis full-length cDNA Length = 499 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 418 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 376
>emb|CR675684.2|CNS0FKBU Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR675638.2|CNS0FKAK Tetraodon nigroviridis full-length cDNA Length = 527 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR675556.2|CNS0FK8A Tetraodon nigroviridis full-length cDNA Length = 525 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402
>emb|CR675521.2|CNS0FK7B Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR674793.2|CNS0FJN3 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR674782.2|CNS0FJMS Tetraodon nigroviridis full-length cDNA Length = 525 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402
>emb|CR672937.2|CNS0FI7J Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR671413.2|CNS0FH17 Tetraodon nigroviridis full-length cDNA Length = 527 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 446 gccggtggtcttggtgtgctggccacgcacgcgcaagccccag 404
>emb|CR670010.2|CNS0FFY8 Tetraodon nigroviridis full-length cDNA Length = 524 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 443 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 401
>emb|CR669727.2|CNS0FFQD Tetraodon nigroviridis full-length cDNA Length = 1171 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 1099 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 1057
>emb|CR668754.2|CNS0FEZC Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcatgccccag 403
>emb|CR668099.2|CNS0FEH5 Tetraodon nigroviridis full-length cDNA Length = 523 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400
>emb|CR666954.2|CNS0FDLC Tetraodon nigroviridis full-length cDNA Length = 527 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 446 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 404
>emb|CR666571.2|CNS0FDAP Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR666558.2|CNS0FDAC Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR666487.2|CNS0FD8D Tetraodon nigroviridis full-length cDNA Length = 527 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 446 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 404
>emb|CR666205.2|CNS0FD0J Tetraodon nigroviridis full-length cDNA Length = 523 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400
>emb|CR666012.2|CNS0FCV6 Tetraodon nigroviridis full-length cDNA Length = 528 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 447 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 405
>emb|CR665971.2|CNS0FCU1 Tetraodon nigroviridis full-length cDNA Length = 523 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400
>emb|CR665553.2|CNS0FCIF Tetraodon nigroviridis full-length cDNA Length = 528 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 446 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 404
>emb|CR665244.2|CNS0FC9U Tetraodon nigroviridis full-length cDNA Length = 530 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR664532.2|CNS0FBQ2 Tetraodon nigroviridis full-length cDNA Length = 486 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 405 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 363
>emb|CR664405.2|CNS0FBMJ Tetraodon nigroviridis full-length cDNA Length = 523 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400
>emb|CR664162.2|CNS0FBFS Tetraodon nigroviridis full-length cDNA Length = 527 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR663985.2|CNS0FBAV Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR663647.2|CNS0FB1H Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403
>emb|CR663135.2|CNS0FAN9 Tetraodon nigroviridis full-length cDNA Length = 526 Score = 46.1 bits (23), Expect = 0.083 Identities = 38/43 (88%) Strand = Plus / Minus Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379 |||||| |||||||||||||| ||||| || |||| ||||||| Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,492,244 Number of Sequences: 3902068 Number of extensions: 3492244 Number of successful extensions: 63468 Number of sequences better than 10.0: 511 Number of HSP's better than 10.0 without gapping: 511 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 62821 Number of HSP's gapped (non-prelim): 630 length of query: 382 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 360 effective length of database: 17,147,199,772 effective search space: 6172991917920 effective search space used: 6172991917920 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)