ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags9d07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY123418.1| Triticum aestivum putative ribosomal protein S18 ... 365 7e-98
2ref|XM_476794.1| Oryza sativa (japonica cultivar-group), mRNA 111 2e-21
3ref|XM_476789.1| Oryza sativa (japonica cultivar-group), mRNA 111 2e-21
4dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
5dbj|AP004670.4| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
6dbj|AP003843.3| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
7gb|AF400215.1| Spodoptera frugiperda ribosomal protein S18 mRNA,... 105 1e-19
8ref|XM_476787.1| Oryza sativa (japonica cultivar-group), mRNA 103 4e-19
9gb|AY109733.1| Zea mays CL5075_1 mRNA sequence 100 6e-18
10gb|AY496116.1| Capsicum annuum putative ribosomal protein mRNA, ... 94 4e-16
11ref|XM_469971.1| Oryza sativa (japonica cultivar-group), mRNA 90 6e-15
12gb|AC092076.7| Oryza sativa chromosome 3 BAC OSJNBb0021G19 genom... 90 6e-15
13gb|AC090871.11| Oryza sativa chromosome 3 BAC OSJNBb0060J21 geno... 90 6e-15
14gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 90 6e-15
15dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 90 6e-15
16dbj|AB180432.1| Plutella xylostella mRNA for Ribosomal protein S... 90 6e-15
17dbj|AK059548.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 6e-15
18dbj|AK058881.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 6e-15
19gb|AC148397.13| Medicago truncatula clone mth2-22h4, complete se... 84 4e-13
20ref|XM_789831.1| PREDICTED: Strongylocentrotus purpuratus simila... 84 4e-13
21ref|XM_778977.1| PREDICTED: Strongylocentrotus purpuratus simila... 84 4e-13
22gb|AY769334.1| Bombyx mori ribosomal protein S18 (RpS18) mRNA, c... 82 1e-12
23ref|XM_360287.1| Magnaporthe grisea 70-15 hypothetical protein (... 82 1e-12
24gb|AY849628.1| Magnaporthe grisea 40S ribosomal protein S18-like... 82 1e-12
25emb|AM048974.1| Sphaerius sp. APV-2005 mRNA for ribosomal protei... 80 6e-12
26gb|DQ200372.1| Solanum tuberosum clone 058H04 unknown mRNA 72 1e-09
27gb|BT013131.1| Lycopersicon esculentum clone 114423F, mRNA sequence 70 6e-09
28ref|NM_117048.2| Arabidopsis thaliana RPS18C (S18 RIBOSOMAL PROT... 68 2e-08
29emb|AL161516.2|ATCHRIV28 Arabidopsis thaliana DNA chromosome 4, ... 68 2e-08
30emb|AL161515.2|ATCHRIV27 Arabidopsis thaliana DNA chromosome 4, ... 68 2e-08
31emb|AL049482.1|ATF17A8 Arabidopsis thaliana DNA chromosome 4, BA... 68 2e-08
32gb|AY064680.1| Arabidopsis thaliana S18.A ribosomal protein (At4... 68 2e-08
33gb|AF386941.1|AF386941 Arabidopsis thaliana S18.A ribosomal prot... 68 2e-08
34gb|AF370463.1|AF370463 Arabidopsis thaliana S18.A ribosomal prot... 68 2e-08
35gb|AY086334.1| Arabidopsis thaliana clone 24071 mRNA, complete s... 68 2e-08
36emb|Z28962.1|ATS18RP3 A.thaliana (Columbia) gene for S18 ribosom... 68 2e-08
37gb|BT006539.1| Arabidopsis thaliana At4g09800 gene, complete cds 66 9e-08
38gb|AY342352.1| Ixodes ricinus ribosomal protein S18 mRNA, partia... 62 1e-06
39gb|DQ066248.1| Ixodes scapularis isolate ISN-L-49 ribosomal prot... 62 1e-06
40ref|NM_103125.2| Arabidopsis thaliana RNA binding / structural c... 60 5e-06
41gb|AY070029.1| Arabidopsis thaliana putative ribosomal protein S... 60 5e-06
42gb|AY034965.1| Arabidopsis thaliana putative ribosomal protein S... 60 5e-06
43emb|BX816977.1|CNS0ADD2 Arabidopsis thaliana Full-length cDNA Co... 60 5e-06
44gb|AC079286.2|AC079286 Arabidopsis thaliana chromosome 1 BAC T15... 60 5e-06
45gb|AC015446.4|AC015446 Arabidopsis thaliana chromosome I BAC F12... 60 5e-06
46gb|AY086800.1| Arabidopsis thaliana clone 27800 mRNA, complete s... 60 5e-06
47emb|Z28702.1|ATS18RP2 A.thaliana (Columbia) mRNA for S18 ribosom... 60 5e-06
48ref|XM_746138.1| Aspergillus fumigatus Af293 ribosomal protein S... 58 2e-05
49ref|NM_102125.2| Arabidopsis thaliana PFL (POINTED FIRST LEAVES)... 56 9e-05
50gb|BT020298.1| Arabidopsis thaliana At1g22780 gene, complete cds 56 9e-05
51gb|BT025610.1| Arabidopsis thaliana At1g22780 mRNA, complete cds 56 9e-05
52ref|XM_657953.1| Aspergillus nidulans FGSC A4 hypothetical prote... 56 9e-05
53ref|XM_752114.1| Ustilago maydis 521 hypothetical protein (UM010... 56 9e-05
54ref|XM_387069.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 56 9e-05
55gb|AF548335.1| Branchiostoma belcheri ribosomal protein S18 mRNA... 56 9e-05
56emb|Y12227.1|ATY12227 Arabidopsis thaliana DNA, 24 kb surroundin... 56 9e-05
57gb|AF526232.1| Argopecten irradians isolate iolsaicl552ct593cn61... 56 9e-05
58gb|AF411781.1|AF411781 Arabidopsis thaliana At1g22780/T22J18_5 m... 56 9e-05
59emb|BX813906.1|CNS0ACAK Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
60gb|AC003979.2|T22J18 Arabidopsis thaliana chromosome 1 BAC T22J1... 56 9e-05
61gb|AY087428.1| Arabidopsis thaliana clone 35333 mRNA, complete s... 56 9e-05
62emb|Z23165.1|ATRBPS18A A.thaliana ribosomal protein gene S18, co... 56 9e-05
63emb|Z28701.1|ATS18RP1 A.thaliana (C24) mRNA for S18 ribosomal pr... 56 9e-05
64gb|AY440501.1| Armigeres subalbatus ASAP ID: 41411 cytosolic sma... 54 3e-04
65emb|BX072327.1|CNS09RYZ Single read from an extremity of a full-... 54 3e-04
66emb|BX072326.1|CNS09RYY Single read from an extremity of a full-... 54 3e-04
67emb|BX072311.1|CNS09RYJ Single read from an extremity of a full-... 54 3e-04
68emb|BX072310.1|CNS09RYI Single read from an extremity of a full-... 54 3e-04
69emb|BX072288.1|CNS09RXW Single read from an extremity of a full-... 54 3e-04
70emb|BX072287.1|CNS09RXV Single read from an extremity of a full-... 54 3e-04
71emb|BX069062.1|CNS09PGA Single read from an extremity of a full-... 54 3e-04
72emb|BX063555.1|CNS09L7B Single read from an extremity of a full-... 54 3e-04
73emb|BX063554.1|CNS09L7A Single read from an extremity of a full-... 54 3e-04
74emb|BX049522.1|CNS09ADI Single read from an extremity of a full-... 54 3e-04
75emb|BX048448.1|CNS099JO Single read from an extremity of a full-... 54 3e-04
76emb|BX048447.1|CNS099JN Single read from an extremity of a full-... 54 3e-04
77emb|BX043249.1|CNS095J9 Single read from an extremity of a full-... 54 3e-04
78emb|BX042743.1|CNS09557 Single read from an extremity of a full-... 54 3e-04
79emb|BX042742.1|CNS09556 Single read from an extremity of a full-... 54 3e-04
80emb|BX038898.1|CNS0926E Single read from an extremity of a full-... 54 3e-04
81emb|BX038897.1|CNS0926D Single read from an extremity of a full-... 54 3e-04
82emb|BX038809.1|CNS0923X Single read from an extremity of a full-... 54 3e-04
83emb|BX038808.1|CNS0923W Single read from an extremity of a full-... 54 3e-04
84emb|BX038794.1|CNS0923I Single read from an extremity of a full-... 54 3e-04
85emb|BX038793.1|CNS0923H Single read from an extremity of a full-... 54 3e-04
86emb|BX038685.1|CNS0920H Single read from an extremity of a full-... 54 3e-04
87emb|BX038684.1|CNS0920G Single read from an extremity of a full-... 54 3e-04
88emb|BX038638.1|CNS091Z6 Single read from an extremity of a full-... 54 3e-04
89emb|BX038637.1|CNS091Z5 Single read from an extremity of a full-... 54 3e-04
90emb|BX038386.1|CNS091S6 Single read from an extremity of a full-... 54 3e-04
91emb|BX038260.1|CNS091OO Single read from an extremity of a full-... 54 3e-04
92emb|BX037931.1|CNS091FJ Single read from an extremity of a full-... 54 3e-04
93emb|BX037930.1|CNS091FI Single read from an extremity of a full-... 54 3e-04
94emb|BX037628.1|CNS09174 Single read from an extremity of a full-... 54 3e-04
95emb|BX037395.1|CNS0910N Single read from an extremity of a full-... 54 3e-04
96emb|BX037394.1|CNS0910M Single read from an extremity of a full-... 54 3e-04
97emb|BX036909.1|CNS090N5 Single read from an extremity of a full-... 54 3e-04
98emb|BX034354.1|CNS08YO6 Single read from an extremity of a full-... 54 3e-04
99emb|BX034173.1|CNS08YJ5 Single read from an extremity of a full-... 54 3e-04
100emb|BX033670.1|CNS08Y56 Single read from an extremity of a full-... 54 3e-04
101emb|BX033669.1|CNS08Y55 Single read from an extremity of a full-... 54 3e-04
102emb|BX033110.1|CNS08XPM Single read from an extremity of a full-... 54 3e-04
103emb|BX032956.1|CNS08XLC Single read from an extremity of a full-... 54 3e-04
104emb|BX032190.1|CNS08X02 Single read from an extremity of a full-... 54 3e-04
105emb|BX032189.1|CNS08X01 Single read from an extremity of a full-... 54 3e-04
106emb|BX030688.1|CNS08VUC Single read from an extremity of a full-... 54 3e-04
107emb|BX027156.1|CNS08T48 Single read from an extremity of a full-... 54 3e-04
108emb|BX026624.1|CNS08SPG Single read from an extremity of a full-... 54 3e-04
109emb|BX026623.1|CNS08SPF Single read from an extremity of a full-... 54 3e-04
110emb|BX023324.1|CNS08Q5S Single read from an extremity of a full-... 54 3e-04
111emb|BX023323.1|CNS08Q5R Single read from an extremity of a full-... 54 3e-04
112emb|BX022521.1|CNS08PJH Single read from an extremity of a full-... 54 3e-04
113emb|BX021989.1|CNS08P4P Single read from an extremity of a full-... 54 3e-04
114emb|BX021988.1|CNS08P4O Single read from an extremity of a full-... 54 3e-04
115emb|BX021615.1|CNS08OUB Single read from an extremity of a full-... 54 3e-04
116emb|BX020788.1|CNS08O7C Single read from an extremity of a full-... 54 3e-04
117emb|BX020787.1|CNS08O7B Single read from an extremity of a full-... 54 3e-04
118emb|BX016687.1|CNS08L1F Single read from an extremity of a full-... 54 3e-04
119emb|BX009941.1|CNS08FU1 Single read from an extremity of a full-... 54 3e-04
120emb|BX009940.1|CNS08FU0 Single read from an extremity of a full-... 54 3e-04
121emb|BX009870.1|CNS08FS2 Single read from an extremity of a full-... 54 3e-04
122emb|BX009869.1|CNS08FS1 Single read from an extremity of a full-... 54 3e-04
123emb|AJ843092.1| Platichthys flesus mRNA for 40S ribosomal protei... 54 3e-04
124gb|AF283268.1|AF283268 Anopheles gambiae strain G3 ribosomal pro... 54 3e-04
125ref|XM_311570.2| Anopheles gambiae str. PEST ENSANGP00000022445 ... 54 3e-04
126gb|L22959.1|DRORPS18A Drosophila melanogaster ribosomal protein ... 54 3e-04
127emb|AL845501.9| Mouse DNA sequence from clone RP23-194C12 on chr... 52 0.001
128emb|BX826567.1|CNS0A3AT Arabidopsis thaliana Full-length cDNA Co... 52 0.001
129dbj|AB182248.1| Antheraea yamamai Antheraea S18 gene mRNA for ri... 52 0.001
130emb|BX050031.1|CNS09ARN Single read from an extremity of a full-... 50 0.005
131emb|BX006616.1|CNS08D9O Single read from an extremity of a full-... 50 0.005
132emb|BX814653.1|CNS0AC5P Arabidopsis thaliana Full-length cDNA Co... 50 0.005
133gb|DQ413212.1| Acyrthosiphon pisum isolate WHAP0121 putative rib... 48 0.021
134dbj|AB226103.1| Aspergillus oryzae cDNA, contig sequence: AoEST2960 48 0.021
135dbj|AP007174.1| Aspergillus oryzae RIB40 genomic DNA, SC103 48 0.021
136ref|NM_213557.1| Rattus norvegicus ribosomal protein S18 (Rps18)... 46 0.083
137gb|BC081458.1| Mus musculus ribosomal protein S18, mRNA (cDNA cl... 46 0.083
138gb|BC081459.1| Mus musculus ribosomal protein S18, mRNA (cDNA cl... 46 0.083
139gb|AY190738.1| Pagrus major 40S ribosomal protein S18 mRNA, part... 46 0.083
140ref|NM_011296.1| Mus musculus ribosomal protein S18 (Rps18), mRNA 46 0.083
141gb|BC100604.1| Mus musculus ribosomal protein S18, transcript va... 46 0.083
142gb|AC158364.4| Mus musculus BAC clone RP23-187J8 from chromosome... 46 0.083
143gb|DQ084044.1| Oxyuranus scutellatus 40S ribosomal protein S18 m... 46 0.083
144emb|X57529.1|RRRPS18A R.rattus ribosomal protein S18 mRNA 46 0.083
145gb|AC124397.5| Mus musculus BAC clone RP24-348J16 from chromosom... 46 0.083
146gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, comple... 46 0.083
147emb|CR734899.2|CNS0GTTU Tetraodon nigroviridis full-length cDNA 46 0.083
148emb|CR734341.2|CNS0GTEC Tetraodon nigroviridis full-length cDNA 46 0.083
149emb|CR674974.2|CNS0FJS4 Tetraodon nigroviridis full-length cDNA 46 0.083
150emb|CR734533.2|CNS0GTJO Tetraodon nigroviridis full-length cDNA 46 0.083
151emb|CR733895.2|CNS0GT1Y Tetraodon nigroviridis full-length cDNA 46 0.083
152emb|CR733804.2|CNS0GSZF Tetraodon nigroviridis full-length cDNA 46 0.083
153emb|CR720262.2|CNS0GIP8 Tetraodon nigroviridis full-length cDNA 46 0.083
154gb|AY232075.1| Drosophila yakuba clone yak-ad_RpS18 mRNA sequence 46 0.083
155emb|CR722880.2|CNS0GKPY Tetraodon nigroviridis full-length cDNA 46 0.083
156emb|CR722776.2|CNS0GKN2 Tetraodon nigroviridis full-length cDNA 46 0.083
157gb|AY231741.1| Drosophila yakuba clone yak-em_RpS18 mRNA sequence 46 0.083
158emb|CR722174.2|CNS0GK6C Tetraodon nigroviridis full-length cDNA 46 0.083
159emb|CR721952.2|CNS0GK06 Tetraodon nigroviridis full-length cDNA 46 0.083
160emb|CR720455.2|CNS0GIUL Tetraodon nigroviridis full-length cDNA 46 0.083
161emb|CR704786.2|CNS0G6RI Tetraodon nigroviridis full-length cDNA 46 0.083
162emb|CR703781.2|CNS0G5ZL Tetraodon nigroviridis full-length cDNA 46 0.083
163emb|CR703599.2|CNS0G5UJ Tetraodon nigroviridis full-length cDNA 46 0.083
164emb|CR703505.2|CNS0G5RX Tetraodon nigroviridis full-length cDNA 46 0.083
165emb|CR703433.2|CNS0G5PX Tetraodon nigroviridis full-length cDNA 46 0.083
166emb|CR702036.2|CNS0G4N4 Tetraodon nigroviridis full-length cDNA 46 0.083
167emb|CR702025.2|CNS0G4MT Tetraodon nigroviridis full-length cDNA 46 0.083
168emb|CR702003.2|CNS0G4M7 Tetraodon nigroviridis full-length cDNA 46 0.083
169emb|CR701412.2|CNS0G45S Tetraodon nigroviridis full-length cDNA 46 0.083
170emb|CR701350.2|CNS0G442 Tetraodon nigroviridis full-length cDNA 46 0.083
171emb|CR701061.2|CNS0G3W1 Tetraodon nigroviridis full-length cDNA 46 0.083
172emb|CR699796.2|CNS0G2WW Tetraodon nigroviridis full-length cDNA 46 0.083
173emb|CR699943.2|CNS0G30Z Tetraodon nigroviridis full-length cDNA 46 0.083
174emb|CR699936.2|CNS0G30S Tetraodon nigroviridis full-length cDNA 46 0.083
175emb|CR699450.2|CNS0G2NA Tetraodon nigroviridis full-length cDNA 46 0.083
176emb|CR691285.2|CNS0FWCH Tetraodon nigroviridis full-length cDNA 46 0.083
177emb|CR698404.2|CNS0G1U8 Tetraodon nigroviridis full-length cDNA 46 0.083
178emb|CR697912.2|CNS0G1GK Tetraodon nigroviridis full-length cDNA 46 0.083
179emb|CR697012.2|CNS0G0RK Tetraodon nigroviridis full-length cDNA 46 0.083
180emb|CR696669.2|CNS0G0I1 Tetraodon nigroviridis full-length cDNA 46 0.083
181emb|CR696546.2|CNS0G0EM Tetraodon nigroviridis full-length cDNA 46 0.083
182emb|CR696299.2|CNS0G07R Tetraodon nigroviridis full-length cDNA 46 0.083
183emb|CR694383.2|CNS0FYQJ Tetraodon nigroviridis full-length cDNA 46 0.083
184emb|CR694171.2|CNS0FYKN Tetraodon nigroviridis full-length cDNA 46 0.083
185emb|CR694138.2|CNS0FYJQ Tetraodon nigroviridis full-length cDNA 46 0.083
186emb|CR694134.2|CNS0FYJM Tetraodon nigroviridis full-length cDNA 46 0.083
187emb|CR694030.2|CNS0FYGQ Tetraodon nigroviridis full-length cDNA 46 0.083
188emb|CR693776.2|CNS0FY9O Tetraodon nigroviridis full-length cDNA 46 0.083
189emb|CR693694.2|CNS0FY7E Tetraodon nigroviridis full-length cDNA 46 0.083
190emb|CR693089.2|CNS0FXQL Tetraodon nigroviridis full-length cDNA 46 0.083
191emb|CR692975.2|CNS0FXNF Tetraodon nigroviridis full-length cDNA 46 0.083
192emb|CR692013.2|CNS0FWWP Tetraodon nigroviridis full-length cDNA 46 0.083
193emb|CR690406.2|CNS0FVO2 Tetraodon nigroviridis full-length cDNA 46 0.083
194emb|CR689779.2|CNS0FV6N Tetraodon nigroviridis full-length cDNA 46 0.083
195emb|CR688604.2|CNS0FUA0 Tetraodon nigroviridis full-length cDNA 46 0.083
196emb|CR688046.2|CNS0FTUI Tetraodon nigroviridis full-length cDNA 46 0.083
197emb|CR687925.2|CNS0FTR5 Tetraodon nigroviridis full-length cDNA 46 0.083
198emb|CR686387.2|CNS0FSKF Tetraodon nigroviridis full-length cDNA 46 0.083
199emb|CR686304.2|CNS0FSI4 Tetraodon nigroviridis full-length cDNA 46 0.083
200emb|CR686239.2|CNS0FSGB Tetraodon nigroviridis full-length cDNA 46 0.083
201emb|CR685614.2|CNS0FRYY Tetraodon nigroviridis full-length cDNA 46 0.083
202emb|CR684442.2|CNS0FR2E Tetraodon nigroviridis full-length cDNA 46 0.083
203emb|CR683437.2|CNS0FQAH Tetraodon nigroviridis full-length cDNA 46 0.083
204emb|CR683517.2|CNS0FQCP Tetraodon nigroviridis full-length cDNA 46 0.083
205emb|CR682886.2|CNS0FPV6 Tetraodon nigroviridis full-length cDNA 46 0.083
206emb|CR682487.2|CNS0FPK3 Tetraodon nigroviridis full-length cDNA 46 0.083
207emb|CR682175.2|CNS0FPBF Tetraodon nigroviridis full-length cDNA 46 0.083
208emb|CR681394.2|CNS0FOPQ Tetraodon nigroviridis full-length cDNA 46 0.083
209emb|CR680612.2|CNS0FO40 Tetraodon nigroviridis full-length cDNA 46 0.083
210emb|CR679692.2|CNS0FNEG Tetraodon nigroviridis full-length cDNA 46 0.083
211emb|CR679567.2|CNS0FNAZ Tetraodon nigroviridis full-length cDNA 46 0.083
212emb|CR678814.2|CNS0FMQ2 Tetraodon nigroviridis full-length cDNA 46 0.083
213emb|CR679090.2|CNS0FMXQ Tetraodon nigroviridis full-length cDNA 46 0.083
214emb|CR678273.2|CNS0FMB8 Tetraodon nigroviridis full-length cDNA 46 0.083
215emb|CR678694.2|CNS0FMMQ Tetraodon nigroviridis full-length cDNA 46 0.083
216emb|CR677677.2|CNS0FLUU Tetraodon nigroviridis full-length cDNA 46 0.083
217emb|CR677659.2|CNS0FLUC Tetraodon nigroviridis full-length cDNA 46 0.083
218emb|CR678402.1|CNS0FMEQ Tetraodon nigroviridis full-length cDNA 46 0.083
219emb|CR677875.2|CNS0FM0B Tetraodon nigroviridis full-length cDNA 46 0.083
220emb|CR677055.2|CNS0FLDN Tetraodon nigroviridis full-length cDNA 46 0.083
221emb|CR676589.2|CNS0FL0P Tetraodon nigroviridis full-length cDNA 46 0.083
222emb|CR676244.2|CNS0FKR4 Tetraodon nigroviridis full-length cDNA 46 0.083
223emb|CR675831.2|CNS0FKFX Tetraodon nigroviridis full-length cDNA 46 0.083
224emb|CR675684.2|CNS0FKBU Tetraodon nigroviridis full-length cDNA 46 0.083
225emb|CR675638.2|CNS0FKAK Tetraodon nigroviridis full-length cDNA 46 0.083
226emb|CR675556.2|CNS0FK8A Tetraodon nigroviridis full-length cDNA 46 0.083
227emb|CR675521.2|CNS0FK7B Tetraodon nigroviridis full-length cDNA 46 0.083
228emb|CR674793.2|CNS0FJN3 Tetraodon nigroviridis full-length cDNA 46 0.083
229emb|CR674782.2|CNS0FJMS Tetraodon nigroviridis full-length cDNA 46 0.083
230emb|CR672937.2|CNS0FI7J Tetraodon nigroviridis full-length cDNA 46 0.083
231emb|CR671413.2|CNS0FH17 Tetraodon nigroviridis full-length cDNA 46 0.083
232emb|CR670010.2|CNS0FFY8 Tetraodon nigroviridis full-length cDNA 46 0.083
233emb|CR669727.2|CNS0FFQD Tetraodon nigroviridis full-length cDNA 46 0.083
234emb|CR668754.2|CNS0FEZC Tetraodon nigroviridis full-length cDNA 46 0.083
235emb|CR668099.2|CNS0FEH5 Tetraodon nigroviridis full-length cDNA 46 0.083
236emb|CR666954.2|CNS0FDLC Tetraodon nigroviridis full-length cDNA 46 0.083
237emb|CR666571.2|CNS0FDAP Tetraodon nigroviridis full-length cDNA 46 0.083
238emb|CR666558.2|CNS0FDAC Tetraodon nigroviridis full-length cDNA 46 0.083
239emb|CR666487.2|CNS0FD8D Tetraodon nigroviridis full-length cDNA 46 0.083
240emb|CR666205.2|CNS0FD0J Tetraodon nigroviridis full-length cDNA 46 0.083
241emb|CR666012.2|CNS0FCV6 Tetraodon nigroviridis full-length cDNA 46 0.083
242emb|CR665971.2|CNS0FCU1 Tetraodon nigroviridis full-length cDNA 46 0.083
243emb|CR665553.2|CNS0FCIF Tetraodon nigroviridis full-length cDNA 46 0.083
244emb|CR665244.2|CNS0FC9U Tetraodon nigroviridis full-length cDNA 46 0.083
245emb|CR664532.2|CNS0FBQ2 Tetraodon nigroviridis full-length cDNA 46 0.083
246emb|CR664405.2|CNS0FBMJ Tetraodon nigroviridis full-length cDNA 46 0.083
247emb|CR664162.2|CNS0FBFS Tetraodon nigroviridis full-length cDNA 46 0.083
248emb|CR663985.2|CNS0FBAV Tetraodon nigroviridis full-length cDNA 46 0.083
249emb|CR663647.2|CNS0FB1H Tetraodon nigroviridis full-length cDNA 46 0.083
250emb|CR663135.2|CNS0FAN9 Tetraodon nigroviridis full-length cDNA 46 0.083
251emb|CR662647.2|CNS0FA9P Tetraodon nigroviridis full-length cDNA 46 0.083
252emb|CR662501.2|CNS0FA5N Tetraodon nigroviridis full-length cDNA 46 0.083
253emb|CR663048.2|CNS0FAKU Tetraodon nigroviridis full-length cDNA 46 0.083
254emb|CR662236.1|CNS0F9YA Tetraodon nigroviridis full-length cDNA 46 0.083
255emb|CR660192.2|CNS0F8DI Tetraodon nigroviridis full-length cDNA 46 0.083
256emb|CR659614.2|CNS0F7XG Tetraodon nigroviridis full-length cDNA 46 0.083
257emb|CR659372.2|CNS0F7QQ Tetraodon nigroviridis full-length cDNA 46 0.083
258emb|CR659053.2|CNS0F7HV Tetraodon nigroviridis full-length cDNA 46 0.083
259emb|CR658943.2|CNS0F7ET Tetraodon nigroviridis full-length cDNA 46 0.083
260emb|CR658458.2|CNS0F71C Tetraodon nigroviridis full-length cDNA 46 0.083
261emb|CR658408.2|CNS0F6ZY Tetraodon nigroviridis full-length cDNA 46 0.083
262emb|CR658256.2|CNS0F6VQ Tetraodon nigroviridis full-length cDNA 46 0.083
263emb|CR657185.2|CNS0F61Z Tetraodon nigroviridis full-length cDNA 46 0.083
264emb|CR657479.2|CNS0F6A5 Tetraodon nigroviridis full-length cDNA 46 0.083
265emb|CR657387.2|CNS0F67L Tetraodon nigroviridis full-length cDNA 46 0.083
266emb|CR656585.2|CNS0F5LB Tetraodon nigroviridis full-length cDNA 46 0.083
267emb|CR656288.2|CNS0F5D2 Tetraodon nigroviridis full-length cDNA 46 0.083
268emb|CR655824.2|CNS0F506 Tetraodon nigroviridis full-length cDNA 46 0.083
269emb|CR655051.2|CNS0F4EP Tetraodon nigroviridis full-length cDNA 46 0.083
270emb|CR654549.2|CNS0F40R Tetraodon nigroviridis full-length cDNA 46 0.083
271emb|CR654507.2|CNS0F3ZL Tetraodon nigroviridis full-length cDNA 46 0.083
272emb|CR653869.2|CNS0F3HV Tetraodon nigroviridis full-length cDNA 46 0.083
273emb|CR651524.2|CNS0F1OQ Tetraodon nigroviridis full-length cDNA 46 0.083
274emb|CR651377.2|CNS0F1KN Tetraodon nigroviridis full-length cDNA 46 0.083
275emb|CR650825.2|CNS0F15B Tetraodon nigroviridis full-length cDNA 46 0.083
276emb|CR650659.2|CNS0F10P Tetraodon nigroviridis full-length cDNA 46 0.083
277emb|CR650612.2|CNS0F0ZE Tetraodon nigroviridis full-length cDNA 46 0.083
278emb|CR648545.2|CNS0EZDZ Tetraodon nigroviridis full-length cDNA 46 0.083
279emb|CR649903.2|CNS0F0FP Tetraodon nigroviridis full-length cDNA 46 0.083
280emb|CR649897.2|CNS0F0FJ Tetraodon nigroviridis full-length cDNA 46 0.083
281emb|CR650082.2|CNS0F0KO Tetraodon nigroviridis full-length cDNA 46 0.083
282emb|CR649301.2|CNS0EZYZ Tetraodon nigroviridis full-length cDNA 46 0.083
283emb|CR649145.2|CNS0EZUN Tetraodon nigroviridis full-length cDNA 46 0.083
284emb|CR649084.2|CNS0EZSY Tetraodon nigroviridis full-length cDNA 46 0.083
285emb|CR648289.2|CNS0EZ6V Tetraodon nigroviridis full-length cDNA 46 0.083
286emb|CR647649.2|CNS0EYP3 Tetraodon nigroviridis full-length cDNA 46 0.083
287emb|CR646928.2|CNS0EY52 Tetraodon nigroviridis full-length cDNA 46 0.083
288emb|CR646852.2|CNS0EY2Y Tetraodon nigroviridis full-length cDNA 46 0.083
289emb|CR643214.2|CNS0EV9W Tetraodon nigroviridis full-length cDNA 46 0.083
290emb|CR646670.2|CNS0EXXW Tetraodon nigroviridis full-length cDNA 46 0.083
291emb|CR646186.2|CNS0EXKG Tetraodon nigroviridis full-length cDNA 46 0.083
292emb|CR645374.2|CNS0EWXW Tetraodon nigroviridis full-length cDNA 46 0.083
293emb|CR645545.2|CNS0EX2N Tetraodon nigroviridis full-length cDNA 46 0.083
294emb|CR644929.2|CNS0EWLJ Tetraodon nigroviridis full-length cDNA 46 0.083
295emb|CR644417.2|CNS0EW7B Tetraodon nigroviridis full-length cDNA 46 0.083
296emb|CR642426.2|CNS0EUO0 Tetraodon nigroviridis full-length cDNA 46 0.083
297emb|CR642359.2|CNS0EUM5 Tetraodon nigroviridis full-length cDNA 46 0.083
298emb|CR642332.2|CNS0EULE Tetraodon nigroviridis full-length cDNA 46 0.083
299emb|CR641930.2|CNS0EUA8 Tetraodon nigroviridis full-length cDNA 46 0.083
300emb|CR641784.2|CNS0EU66 Tetraodon nigroviridis full-length cDNA 46 0.083
301emb|CR639750.2|CNS0ESLO Tetraodon nigroviridis full-length cDNA 46 0.083
302emb|CR639600.2|CNS0ESHI Tetraodon nigroviridis full-length cDNA 46 0.083
303emb|CR639369.2|CNS0ESB3 Tetraodon nigroviridis full-length cDNA 46 0.083
304emb|CR639264.2|CNS0ES86 Tetraodon nigroviridis full-length cDNA 46 0.083
305emb|CR638994.2|CNS0ES0O Tetraodon nigroviridis full-length cDNA 46 0.083
306emb|CR638421.2|CNS0ERKR Tetraodon nigroviridis full-length cDNA 46 0.083
307emb|CR638881.2|CNS0ERXJ Tetraodon nigroviridis full-length cDNA 46 0.083
308emb|CR638732.2|CNS0ERTE Tetraodon nigroviridis full-length cDNA 46 0.083
309emb|CR637163.2|CNS0EQLT Tetraodon nigroviridis full-length cDNA 46 0.083
310emb|CR637549.2|CNS0EQWJ Tetraodon nigroviridis full-length cDNA 46 0.083
311emb|CR635324.2|CNS0EP6Q Tetraodon nigroviridis full-length cDNA 46 0.083
312emb|CR635674.2|CNS0EPGG Tetraodon nigroviridis full-length cDNA 46 0.083
313emb|CR634323.2|CNS0EOEX Tetraodon nigroviridis full-length cDNA 46 0.083
314emb|CR634758.2|CNS0EOR0 Tetraodon nigroviridis full-length cDNA 46 0.083
315emb|CR634222.2|CNS0EOC4 Tetraodon nigroviridis full-length cDNA 46 0.083
316emb|CR633494.2|CNS0ENRW Tetraodon nigroviridis full-length cDNA 46 0.083
317gb|AY829783.1| Lonomia obliqua ribosomal protein 25 mRNA, partia... 46 0.083
318ref|XM_503080.1| Yarrowia lipolytica CLIB122, YALI0D20614g predi... 46 0.083
319emb|BX069063.1|CNS09PGB Single read from an extremity of a full-... 46 0.083
320emb|BX047931.1|CNS0995B Single read from an extremity of a full-... 46 0.083
321emb|BX034355.1|CNS08YO7 Single read from an extremity of a full-... 46 0.083
322emb|BX032955.1|CNS08XLB Single read from an extremity of a full-... 46 0.083
323emb|BX030689.1|CNS08VUD Single read from an extremity of a full-... 46 0.083
324emb|BX016493.1|CNS08KW1 Single read from an extremity of a full-... 46 0.083
325gb|BT024929.1| Drosophila melanogaster IP16603 full insert cDNA 46 0.083
326emb|AL607105.15| Mouse DNA sequence from clone RP23-371K8 on chr... 46 0.083
327gb|AF402827.1| Ictalurus punctatus 40S ribosomal protein S18 mRN... 46 0.083
328gb|AY118434.1| Drosophila melanogaster RH43343 full insert cDNA 46 0.083
329ref|NM_166383.1| Drosophila melanogaster Ribosomal protein S18 C... 46 0.083
330ref|NM_057616.3| Drosophila melanogaster Ribosomal protein S18 C... 46 0.083
331dbj|AK144398.1| Mus musculus 16 days neonate male medulla oblong... 46 0.083
332dbj|AK146354.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 46 0.083
333dbj|AK159437.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 46 0.083
334dbj|AK151580.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.083
335gb|AC099023.1| Drosophila melanogaster, chromosome 2R, region 56... 46 0.083
336dbj|AK159821.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 46 0.083
337dbj|AK169246.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 46 0.083
338dbj|AK050626.1| Mus musculus 2 days neonate thymus thymic cells ... 46 0.083
339dbj|AB162351.1| Drosophila sechellia genes, CG11099 to CG8914 re... 46 0.083
340dbj|AB162349.1| Drosophila simulans genes, CG11099 to CG8900 reg... 46 0.083
341gb|BC093500.1| Mus musculus ribosomal protein S18, mRNA (cDNA cl... 46 0.083
342ref|XM_574920.1| PREDICTED: Rattus norvegicus similar to ribosom... 46 0.083
343gb|AE003792.3| Drosophila melanogaster chromosome 2R, section 58... 46 0.083
344gb|AC004321.1|AC004321 Drosophila melanogaster DNA sequence (P1 ... 46 0.083
345gb|BC091729.1| Mus musculus cDNA clone IMAGE:2650809, containing... 46 0.083
346gb|AC122881.4| Mus musculus BAC clone RP23-79J21 from 13, comple... 46 0.083
347emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 46 0.083
348gb|M76763.1|MUSKE3B Mus musculus ribosomal protein (Ke-3) mRNA, ... 46 0.083
349ref|XM_522161.1| PREDICTED: Pan troglodytes similar to angiopoie... 44 0.33
350gb|AF110520.1|MMHC425O18 Mus musculus major histocompatibility c... 44 0.33
351gb|AY625691.1| Mus musculus UDP-Gal:betaGalNAc beta 1,3-galactos... 44 0.33
352emb|CR974462.5| Mouse DNA sequence from clone RP23-222K15 on chr... 44 0.33
353ref|XM_723327.1| Plasmodium yoelii yoelii str. 17XNL ribosomal p... 44 0.33
354emb|CR681204.2|CNS0FOKG Tetraodon nigroviridis full-length cDNA 44 0.33
355emb|CR677960.2|CNS0FM2O Tetraodon nigroviridis full-length cDNA 44 0.33
356ref|XM_734830.1| Plasmodium chabaudi chabaudi hypothetical prote... 44 0.33
357emb|CR676300.2|CNS0FKSO Tetraodon nigroviridis full-length cDNA 44 0.33
358emb|CR674465.2|CNS0FJDZ Tetraodon nigroviridis full-length cDNA 44 0.33
359emb|CR673747.2|CNS0FIU1 Tetraodon nigroviridis full-length cDNA 44 0.33
360ref|XM_736816.1| Plasmodium chabaudi chabaudi ribosomal protein ... 44 0.33
361emb|CR669926.2|CNS0FFVW Tetraodon nigroviridis full-length cDNA 44 0.33
362emb|CR669065.2|CNS0FF7Z Tetraodon nigroviridis full-length cDNA 44 0.33
363emb|BX033111.1|CNS08XPN Single read from an extremity of a full-... 44 0.33
364emb|BX883042.1| Rattus norvegicus chromosome 20, major histocomp... 44 0.33
365emb|AL122011.2|SPCC825 S.pombe chromosome III cosmid c825 44 0.33
366emb|AL034564.1|SPCC1259 S.pombe chromosome III cosmid c1259 44 0.33
367ref|NM_001023048.1| Schizosaccharomyces pombe 972h- 40S ribosoma... 44 0.33
368dbj|AP002372.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 44 0.33
369gb|AF081143.1|AF081143 Cricetulus sp. ribosomal protein S18 mRNA... 44 0.33
370dbj|AP003383.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 44 0.33
371gb|AF100956.1|AF100956 Mus musculus major histocompatibility loc... 44 0.33
372gb|M76762.1|MUSKE3A Mus musculus ribosomal protein (Ke-3) gene, ... 44 0.33
373gb|AC119911.10| Mus musculus chromosome 1, clone RP24-242P4, com... 42 1.3
374ref|XM_322560.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.3
375ref|XM_951701.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.3
376gb|AC113084.12| Mus musculus chromosome 1, clone RP23-292F19, co... 42 1.3
377ref|XM_977725.1| PREDICTED: Mus musculus similar to ribosomal pr... 42 1.3
378ref|XM_912340.2| PREDICTED: Mus musculus similar to ribosomal pr... 42 1.3
379ref|XM_357690.3| PREDICTED: Mus musculus similar to ribosomal pr... 42 1.3
380ref|XR_004649.1| PREDICTED: Mus musculus hypothetical protein LO... 42 1.3
381emb|CR691485.2|CNS0FWI1 Tetraodon nigroviridis full-length cDNA 42 1.3
382emb|BX957299.8| Zebrafish DNA sequence from clone DKEY-179E8 in ... 42 1.3
383gb|AC012176.8| Homo sapiens chromosome 16 clone RP11-206F18, com... 42 1.3
384gb|AY099517.1| Danio rerio 40S ribosomal protein S18 (rps18) mRN... 42 1.3
385dbj|AK164404.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN ... 42 1.3
386emb|BX817535.1|CNS0ABAG Arabidopsis thaliana Full-length cDNA Co... 42 1.3
387dbj|AB199895.1| Crassostrea gigas mRNA for ribosomal protein S18... 42 1.3
388ref|NM_173234.1| Danio rerio ribosomal protein S18 (rps18), mRNA 42 1.3
389gb|AC117984.2| Homo sapiens chromosome 16 clone CTD-2503H21, com... 42 1.3
390gb|AF210641.1|AF210641 Danio rerio Ke3 mRNA, partial cds 42 1.3
391gb|BC062289.1| Danio rerio ribosomal protein S18, mRNA (cDNA clo... 42 1.3
392gb|AC026949.21| Mus musculus chromosome 7, clone RP23-103E11, co... 42 1.3
393gb|BC101788.1| Homo sapiens ribosomal protein S18, mRNA (cDNA cl... 40 5.1
394gb|BC101786.1| Homo sapiens ribosomal protein S18, mRNA (cDNA cl... 40 5.1
395ref|XM_511822.1| PREDICTED: Pan troglodytes similar to ribosomal... 40 5.1
396ref|XM_518400.1| PREDICTED: Pan troglodytes similar to ribosomal... 40 5.1
397gb|BC106063.1| Homo sapiens ribosomal protein S18, mRNA (cDNA cl... 40 5.1
398ref|NM_022551.2| Homo sapiens ribosomal protein S18 (RPS18), mRNA 40 5.1
399gb|BC071678.1| Homo sapiens cDNA clone MGC:87887 IMAGE:5201620, ... 40 5.1
400gb|U49954.1| Caenorhabditis elegans cosmid Y102E9, complete sequ... 40 5.1
401gb|AC101980.8| Mus musculus chromosome 7, clone RP24-339E15, com... 40 5.1
402ref|XM_989187.1| PREDICTED: Mus musculus similar to ribosomal pr... 40 5.1
403ref|XM_912873.1| PREDICTED: Mus musculus similar to ribosomal pr... 40 5.1
404ref|XM_890398.1| PREDICTED: Mus musculus similar to ribosomal pr... 40 5.1
405emb|CT025215.2| Xenopus tropicalis finished cDNA, clone TEgg028a02 40 5.1
406gb|AC125396.4| Mus musculus BAC clone RP24-69M4 from chromosome ... 40 5.1
407gb|AC129012.4| Mus musculus BAC clone RP24-545L10 from chromosom... 40 5.1
408gb|AC124503.2| Mus musculus BAC clone RP23-417F2 from chromosome... 40 5.1
409gb|AC121891.2| Mus musculus BAC clone RP24-155I9 from 8, complet... 40 5.1
410ref|XM_649589.1| Entamoeba histolytica HM-1:IMSS 40S ribosomal p... 40 5.1
411emb|CR719205.2|CNS0GHVV Tetraodon nigroviridis full-length cDNA 40 5.1
412emb|CR718915.2|CNS0GHNT Tetraodon nigroviridis full-length cDNA 40 5.1
413emb|CR718870.2|CNS0GHMK Tetraodon nigroviridis full-length cDNA 40 5.1
414emb|CR718648.2|CNS0GHGE Tetraodon nigroviridis full-length cDNA 40 5.1
415emb|CR718490.2|CNS0GHC0 Tetraodon nigroviridis full-length cDNA 40 5.1
416emb|CR718379.2|CNS0GH8X Tetraodon nigroviridis full-length cDNA 40 5.1
417emb|CR718245.2|CNS0GH57 Tetraodon nigroviridis full-length cDNA 40 5.1
418emb|CR717975.2|CNS0GGXP Tetraodon nigroviridis full-length cDNA 40 5.1
419emb|CR717842.2|CNS0GGU0 Tetraodon nigroviridis full-length cDNA 40 5.1
420emb|CR717122.2|CNS0GGA3 Tetraodon nigroviridis full-length cDNA 40 5.1
421emb|CR716835.2|CNS0GG24 Tetraodon nigroviridis full-length cDNA 40 5.1
422emb|CR716783.2|CNS0GG0O Tetraodon nigroviridis full-length cDNA 40 5.1
423emb|CR716547.2|CNS0GFU4 Tetraodon nigroviridis full-length cDNA 40 5.1
424emb|CR716188.2|CNS0GFK5 Tetraodon nigroviridis full-length cDNA 40 5.1
425emb|CR716119.2|CNS0GFIB Tetraodon nigroviridis full-length cDNA 40 5.1
426emb|CR713825.2|CNS0GDQL Tetraodon nigroviridis full-length cDNA 40 5.1
427emb|CR713761.2|CNS0GDOT Tetraodon nigroviridis full-length cDNA 40 5.1
428emb|CR713713.2|CNS0GDNH Tetraodon nigroviridis full-length cDNA 40 5.1
429emb|CR713030.2|CNS0GD4I Tetraodon nigroviridis full-length cDNA 40 5.1
430emb|CR712757.2|CNS0GCWX Tetraodon nigroviridis full-length cDNA 40 5.1
431emb|CR711259.2|CNS0GBRB Tetraodon nigroviridis full-length cDNA 40 5.1
432emb|CR710553.2|CNS0GB7P Tetraodon nigroviridis full-length cDNA 40 5.1
433emb|CR710490.2|CNS0GB5Y Tetraodon nigroviridis full-length cDNA 40 5.1
434emb|CR710397.2|CNS0GB3D Tetraodon nigroviridis full-length cDNA 40 5.1
435emb|CR710326.2|CNS0GB1E Tetraodon nigroviridis full-length cDNA 40 5.1
436emb|CR710081.2|CNS0GAUL Tetraodon nigroviridis full-length cDNA 40 5.1
437emb|CR709316.2|CNS0GA9C Tetraodon nigroviridis full-length cDNA 40 5.1
438emb|CR709302.2|CNS0GA8Y Tetraodon nigroviridis full-length cDNA 40 5.1
439emb|CR709622.2|CNS0GAHU Tetraodon nigroviridis full-length cDNA 40 5.1
440emb|CR708879.2|CNS0G9X7 Tetraodon nigroviridis full-length cDNA 40 5.1
441emb|CR708197.2|CNS0G9E9 Tetraodon nigroviridis full-length cDNA 40 5.1
442emb|CR708195.2|CNS0G9E7 Tetraodon nigroviridis full-length cDNA 40 5.1
443emb|CR708147.2|CNS0G9CV Tetraodon nigroviridis full-length cDNA 40 5.1
444emb|CR707833.2|CNS0G945 Tetraodon nigroviridis full-length cDNA 40 5.1
445emb|CR707736.2|CNS0G91G Tetraodon nigroviridis full-length cDNA 40 5.1
446emb|CR707685.2|CNS0G901 Tetraodon nigroviridis full-length cDNA 40 5.1
447emb|CR707525.2|CNS0G8VL Tetraodon nigroviridis full-length cDNA 40 5.1
448emb|CR706946.2|CNS0G8FI Tetraodon nigroviridis full-length cDNA 40 5.1
449emb|CR706890.2|CNS0G8DY Tetraodon nigroviridis full-length cDNA 40 5.1
450emb|CR705389.2|CNS0G789 Tetraodon nigroviridis full-length cDNA 40 5.1
451emb|CR705005.2|CNS0G6XL Tetraodon nigroviridis full-length cDNA 40 5.1
452emb|CR704878.2|CNS0G6U2 Tetraodon nigroviridis full-length cDNA 40 5.1
453emb|CR705234.2|CNS0G73Y Tetraodon nigroviridis full-length cDNA 40 5.1
454emb|CR704207.2|CNS0G6BF Tetraodon nigroviridis full-length cDNA 40 5.1
455emb|CR702707.2|CNS0G55R Tetraodon nigroviridis full-length cDNA 40 5.1
456emb|CR699685.2|CNS0G2TT Tetraodon nigroviridis full-length cDNA 40 5.1
457emb|CR699107.2|CNS0G2DR Tetraodon nigroviridis full-length cDNA 40 5.1
458emb|CR697045.2|CNS0G0SH Tetraodon nigroviridis full-length cDNA 40 5.1
459emb|CR692561.2|CNS0FXBX Tetraodon nigroviridis full-length cDNA 40 5.1
460emb|CR683824.2|CNS0FQL8 Tetraodon nigroviridis full-length cDNA 40 5.1
461emb|CR683804.2|CNS0FQKO Tetraodon nigroviridis full-length cDNA 40 5.1
462emb|CR682446.2|CNS0FPIY Tetraodon nigroviridis full-length cDNA 40 5.1
463emb|CR674533.2|CNS0FJFV Tetraodon nigroviridis full-length cDNA 40 5.1
464emb|CR632266.2|CNS0EMTS Tetraodon nigroviridis full-length cDNA 40 5.1
465emb|CR632183.2|CNS0EMRH Tetraodon nigroviridis full-length cDNA 40 5.1
466emb|CR631987.2|CNS0EMM1 Tetraodon nigroviridis full-length cDNA 40 5.1
467gb|BC012322.1| Homo sapiens mRNA similar to IGF-II mRNA-binding ... 40 5.1
468emb|AL359643.27| Human DNA sequence from clone RP11-428J1 on chr... 40 5.1
469emb|AL136133.14| Human DNA sequence from clone CTA-253N17 on chr... 40 5.1
470emb|AL096701.14|HSA247I13 Human DNA sequence from clone RP11-247... 40 5.1
471emb|AL078581.11|HSDJ12G14 Human DNA sequence from clone RP1-12G1... 40 5.1
472ref|XM_964627.1| PREDICTED: Tribolium castaneum similar to CG153... 40 5.1
473gb|AC162519.4| Mus musculus chromosome 8, clone RP24-146M21, com... 40 5.1
474emb|X69150.1|HSRPS18 Homo sapiens mRNA for ribosomal protein S18 40 5.1
475dbj|AB192511.1| Sus scrofa genomic DNA, chromosome 7, BAC clone:... 40 5.1
476emb|CR621545.1| full-length cDNA clone CS0DI054YA04 of Placenta ... 40 5.1
477gb|AY090769.1| Homo sapiens ribosomal protein S18/S6-like mRNA, ... 40 5.1
478gb|AC161624.4| Pan troglodytes BAC clone CH251-149E7 from chromo... 40 5.1
479emb|CR611667.1| full-length cDNA clone CS0DD003YO07 of Neuroblas... 40 5.1
480emb|CR605901.1| full-length cDNA clone CS0DB009YM10 of Neuroblas... 40 5.1
481emb|CR604146.1| full-length cDNA clone CS0DB003YG14 of Neuroblas... 40 5.1
482emb|CR599079.1| full-length cDNA clone CS0DC015YK18 of Neuroblas... 40 5.1
483emb|CR596186.1| full-length cDNA clone CS0DI042YG15 of Placenta ... 40 5.1
484emb|CR593767.1| full-length cDNA clone CS0DI052YO14 of Placenta ... 40 5.1
485ref|XM_945647.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 5.1
486ref|XM_945646.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 5.1
487ref|XM_942039.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 5.1
488ref|XM_934397.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 5.1
489ref|XM_934395.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 5.1
490ref|XM_371019.4| PREDICTED: Homo sapiens similar to ribosomal pr... 40 5.1
491ref|XM_941412.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 5.1
492ref|XM_928927.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 5.1
493dbj|AB168656.1| Macaca fascicularis testis cDNA clone: QtsA-1388... 40 5.1
494gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 5.1
495ref|NM_001027643.1| Caenorhabditis elegans ODoRant response abno... 40 5.1
496gb|AC068541.7|AC068541 Homo sapiens BAC clone RP11-243P9 from Y,... 40 5.1
497gb|AC007379.2|AC007379 Homo sapiens BAC clone RP11-143C1 from Y,... 40 5.1
498gb|AC073861.29| Homo sapiens 3 BAC RP11-234A1 (Roswell Park Canc... 40 5.1
499ref|NM_213940.1| Sus scrofa ribosomal protein S18 (RPS18), mRNA 40 5.1
500ref|XM_344954.2| PREDICTED: Rattus norvegicus similar to ribosom... 40 5.1

>gb|AY123418.1| Triticum aestivum putative ribosomal protein S18 mRNA, complete cds
          Length = 868

 Score =  365 bits (184), Expect = 7e-98
 Identities = 233/247 (94%), Gaps = 8/247 (3%)
 Strand = Plus / Minus

                                                                       
Query: 137 aggaattcaagatacaatatattaaaggttccagaaccgaaaaacattatctagggcaaa 196
           ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
Sbjct: 825 aggaattcaagatacaatatattaaaggttccagaacc--aaaacattatctagggcaaa 768

                                                                       
Query: 197 acatcatccaaggtaatcgtctaaacaggaacactccttcagattctggaaatggaccaa 256
           ||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||
Sbjct: 767 acatcatccaaggtaatcgtctaaacaagaacactccttaagattgtggaaatggaccaa 708

                                                                       
Query: 257 cacagtaatggtagcaaagctatgcgggatcattgagaagc---ttatcgcttcttggag 313
           |||||||   ||||||||||||||||||||| ||| |||||   ||||||||||||||||
Sbjct: 707 cacagta---gtagcaaagctatgcgggatctttgtgaagcagcttatcgcttcttggag 651

                                                                       
Query: 314 acaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacggacacgcacg 373
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 650 acaccaacagtctttcctctcctgccggtagtctttgtgtgctgaccacggacacgcacg 591

                  
Query: 374 ccccagt 380
           |||||||
Sbjct: 590 ccccagt 584



to top

>ref|XM_476794.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 438

 Score =  111 bits (56), Expect = 2e-21
 Identities = 68/72 (94%)
 Strand = Plus / Minus

                                                                       
Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
           ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 438 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 379

                       
Query: 358 accacggacacg 369
           ||||||||||||
Sbjct: 378 accacggacacg 367



to top

>ref|XM_476789.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 447

 Score =  111 bits (56), Expect = 2e-21
 Identities = 68/72 (94%)
 Strand = Plus / Minus

                                                                       
Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
           ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 447 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 388

                       
Query: 358 accacggacacg 369
           ||||||||||||
Sbjct: 387 accacggacacg 376



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score =  111 bits (56), Expect = 2e-21
 Identities = 68/72 (94%)
 Strand = Plus / Minus

                                                                           
Query: 298     ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
               ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 3931978 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 3931919

                           
Query: 358     accacggacacg 369
               ||||||||||||
Sbjct: 3931918 accacggacacg 3931907



 Score =  111 bits (56), Expect = 2e-21
 Identities = 68/72 (94%)
 Strand = Plus / Minus

                                                                           
Query: 298     ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
               ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 3917582 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 3917523

                           
Query: 358     accacggacacg 369
               ||||||||||||
Sbjct: 3917522 accacggacacg 3917511



 Score =  103 bits (52), Expect = 4e-19
 Identities = 67/72 (93%)
 Strand = Plus / Minus

                                                                           
Query: 298     ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
               ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 3906977 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 3906918

                           
Query: 358     accacggacacg 369
               ||| ||||||||
Sbjct: 3906917 accgcggacacg 3906906



to top

>dbj|AP004670.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0496D04
          Length = 197358

 Score =  111 bits (56), Expect = 2e-21
 Identities = 68/72 (94%)
 Strand = Plus / Minus

                                                                          
Query: 298    ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
              ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 171090 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 171031

                          
Query: 358    accacggacacg 369
              ||||||||||||
Sbjct: 171030 accacggacacg 171019



 Score =  111 bits (56), Expect = 2e-21
 Identities = 68/72 (94%)
 Strand = Plus / Minus

                                                                          
Query: 298    ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
              ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 156694 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 156635

                          
Query: 358    accacggacacg 369
              ||||||||||||
Sbjct: 156634 accacggacacg 156623



 Score =  103 bits (52), Expect = 4e-19
 Identities = 67/72 (93%)
 Strand = Plus / Minus

                                                                          
Query: 298    ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
              ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 146089 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 146030

                          
Query: 358    accacggacacg 369
              ||| ||||||||
Sbjct: 146029 accgcggacacg 146018



to top

>dbj|AP003843.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1656_E11
          Length = 116211

 Score =  111 bits (56), Expect = 2e-21
 Identities = 68/72 (94%)
 Strand = Plus / Minus

                                                                         
Query: 298   ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
             ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 34704 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 34645

                         
Query: 358   accacggacacg 369
             ||||||||||||
Sbjct: 34644 accacggacacg 34633



 Score =  111 bits (56), Expect = 2e-21
 Identities = 68/72 (94%)
 Strand = Plus / Minus

                                                                         
Query: 298   ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
             ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 20308 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 20249

                         
Query: 358   accacggacacg 369
             ||||||||||||
Sbjct: 20248 accacggacacg 20237



 Score =  103 bits (52), Expect = 4e-19
 Identities = 67/72 (93%)
 Strand = Plus / Minus

                                                                        
Query: 298  ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
            ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 9703 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 9644

                        
Query: 358  accacggacacg 369
            ||| ||||||||
Sbjct: 9643 accgcggacacg 9632



to top

>gb|AF400215.1| Spodoptera frugiperda ribosomal protein S18 mRNA, complete cds
          Length = 604

 Score =  105 bits (53), Expect = 1e-19
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                       
Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363
           |||||| || |||||||||||  |||||||||||||||||||||||||||||||||||||
Sbjct: 553 cttcttagatacaccaacagttcttcctctcctgccggtagtcttggtgtgctgaccacg 494

                            
Query: 364 gacacgcacgccccagt 380
            ||||||| ||||||||
Sbjct: 493 cacacgcaggccccagt 477



to top

>ref|XM_476787.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 459

 Score =  103 bits (52), Expect = 4e-19
 Identities = 67/72 (93%)
 Strand = Plus / Minus

                                                                       
Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
           ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 459 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 400

                       
Query: 358 accacggacacg 369
           ||| ||||||||
Sbjct: 399 accgcggacacg 388



to top

>gb|AY109733.1| Zea mays CL5075_1 mRNA sequence
          Length = 865

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 295 agcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
           |||| |||||||||||||||||||||| |||||||| | |||||| ||||||||||||||
Sbjct: 542 agctcatcgcttcttggagacaccaacggtctttccacgcctgccagtagtcttggtgtg 483

                                     
Query: 355 ctgaccacggacacgcacgccccagt 380
           ||| |||||||| || | ||||||||
Sbjct: 482 ctggccacggacgcggaggccccagt 457



to top

>gb|AY496116.1| Capsicum annuum putative ribosomal protein mRNA, complete cds
          Length = 771

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                       
Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
           ||||| ||||||||||||||||||||||||||| || | ||| || ||||| ||||||||
Sbjct: 555 ttatctcttcttggagacaccaacagtctttcccctgcggccagtggtctttgtgtgctg 496

                                  
Query: 358 accacggacacgcacgccccagt 380
           |||||||||||| | ||||||||
Sbjct: 495 accacggacacggaggccccagt 473



to top

>ref|XM_469971.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1013

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                       
Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
           ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 553 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 494

                                    
Query: 356 tgaccacggacacgcacgccccagt 380
           || ||||| ||||| | ||||||||
Sbjct: 493 tgcccacgcacacggaggccccagt 469



to top

>gb|AC092076.7| Oryza sativa chromosome 3 BAC OSJNBb0021G19 genomic sequence, complete
              sequence
          Length = 141582

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                          
Query: 296    gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
              ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 137481 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 137422

                                       
Query: 356    tgaccacggacacgcacgccccagt 380
              || ||||| ||||| | ||||||||
Sbjct: 137421 tgcccacgcacacggaggccccagt 137397



to top

>gb|AC090871.11| Oryza sativa chromosome 3 BAC OSJNBb0060J21 genomic sequence,
            complete sequence
          Length = 162497

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                        
Query: 296  gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
            ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 1847 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 1788

                                     
Query: 356  tgaccacggacacgcacgccccagt 380
            || ||||| ||||| | ||||||||
Sbjct: 1787 tgcccacgcacacggaggccccagt 1763



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                            
Query: 296      gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
                ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 32742060 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 32742119

                                         
Query: 356      tgaccacggacacgcacgccccagt 380
                || ||||| ||||| | ||||||||
Sbjct: 32742120 tgcccacgcacacggaggccccagt 32742144



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                            
Query: 296      gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
                ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 32832570 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 32832629

                                         
Query: 356      tgaccacggacacgcacgccccagt 380
                || ||||| ||||| | ||||||||
Sbjct: 32832630 tgcccacgcacacggaggccccagt 32832654



to top

>dbj|AB180432.1| Plutella xylostella mRNA for Ribosomal protein S18, complete cds
          Length = 483

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 69/77 (89%)
 Strand = Plus / Minus

                                                                       
Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363
           ||||||||| |||||||||||| | |||||||||||||| ||||||||||||||||| ||
Sbjct: 475 cttcttggacacaccaacagtcctgcctctcctgccggtggtcttggtgtgctgaccgcg 416

                            
Query: 364 gacacgcacgccccagt 380
            || |||| ||||||||
Sbjct: 415 cacgcgcaggccccagt 399



to top

>dbj|AK059548.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-F08, full
           insert sequence
          Length = 728

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                       
Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
           ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 549 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 490

                                    
Query: 356 tgaccacggacacgcacgccccagt 380
           || ||||| ||||| | ||||||||
Sbjct: 489 tgcccacgcacacggaggccccagt 465



to top

>dbj|AK058881.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-B06, full
           insert sequence
          Length = 1013

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                       
Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
           ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 553 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 494

                                    
Query: 356 tgaccacggacacgcacgccccagt 380
           || ||||| ||||| | ||||||||
Sbjct: 493 tgcccacgcacacggaggccccagt 469



to top

>gb|AC148397.13| Medicago truncatula clone mth2-22h4, complete sequence
          Length = 131213

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                         
Query: 295   agcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
             |||||| |||||||| || |||||||| ||||||||||| | ||| ||||||||||| ||
Sbjct: 66762 agcttaacgcttctttgacacaccaactgtctttcctctgcggccagtagtcttggtatg 66821

                                       
Query: 355   ctgaccacggacacgcacgccccagt 380
             ||||||||| ||||| | ||||||||
Sbjct: 66822 ctgaccacgaacacgaaggccccagt 66847



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                         
Query: 296   gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
             ||||| |||||||| ||||||||||| |||||||| || | ||| ||||||||||| |||
Sbjct: 93987 gcttaacgcttctttgagacaccaacggtctttcccctgcggcctgtagtcttggtatgc 94046

                                      
Query: 356   tgaccacggacacgcacgccccagt 380
             |||||||| ||||| | ||||||||
Sbjct: 94047 tgaccacgaacacgaaggccccagt 94071



to top

>ref|XM_789831.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S18 (LOC590220), mRNA
          Length = 563

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
           ||||||||| |||||||||||| ||||||||||||| |||||||||||||||||
Sbjct: 525 cttcttggacacaccaacagtccttcctctcctgccagtagtcttggtgtgctg 472



to top

>ref|XM_778977.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S18 (LOC578831), mRNA
          Length = 516

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
           ||||||||| |||||||||||| ||||||||||||| |||||||||||||||||
Sbjct: 477 cttcttggacacaccaacagtccttcctctcctgccagtagtcttggtgtgctg 424



to top

>gb|AY769334.1| Bombyx mori ribosomal protein S18 (RpS18) mRNA, complete cds
          Length = 578

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363
           |||||| || |||||||||||  ||||||||||||| |||||||| ||||||||||||||
Sbjct: 525 cttctttgatacaccaacagttcttcctctcctgccagtagtcttagtgtgctgaccacg 466

                            
Query: 364 gacacgcacgccccagt 380
            ||||| | ||||||||
Sbjct: 465 cacacgaaggccccagt 449



to top

>ref|XM_360287.1| Magnaporthe grisea 70-15 hypothetical protein (MG05661.4) partial
           mRNA
          Length = 471

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363
           ||||||||| ||||| || |||  |||||||| |||||| ||||||||||||||||||||
Sbjct: 459 cttcttggacacaccgacggtccgtcctctccggccggtcgtcttggtgtgctgaccacg 400

                            
Query: 364 gacacgcacgccccagt 380
           |||||| | ||||||||
Sbjct: 399 gacacggaggccccagt 383



to top

>gb|AY849628.1| Magnaporthe grisea 40S ribosomal protein S18-like protein mRNA,
           complete cds
          Length = 713

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363
           ||||||||| ||||| || |||  |||||||| |||||| ||||||||||||||||||||
Sbjct: 510 cttcttggacacaccgacggtccgtcctctccggccggtcgtcttggtgtgctgaccacg 451

                            
Query: 364 gacacgcacgccccagt 380
           |||||| | ||||||||
Sbjct: 450 gacacggaggccccagt 434



to top

>emb|AM048974.1| Sphaerius sp. APV-2005 mRNA for ribosomal protein S18e (rpS18e
           gene)
          Length = 459

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363
           ||||||||| |||||||||||  ||||||| |||||||||||||||||||| ||||||||
Sbjct: 453 cttcttggacacaccaacagttcttcctcttctgccggtagtcttggtgtgttgaccacg 394



to top

>gb|DQ200372.1| Solanum tuberosum clone 058H04 unknown mRNA
          Length = 690

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                       
Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
           |||||||||||||||||||||||||||||||||||  |  || || ||||| || |||||
Sbjct: 512 ttatcgcttcttggagacaccaacagtctttcctcggcgaccagtggtcttagtatgctg 453

                       
Query: 358 accacggacacg 369
           |||||| |||||
Sbjct: 452 accacgcacacg 441



to top

>gb|BT013131.1| Lycopersicon esculentum clone 114423F, mRNA sequence
          Length = 778

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 298 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 357
           ||||| ||||||||||||||||||||||||||| || |  || || ||||| ||||||||
Sbjct: 536 ttatctcttcttggagacaccaacagtctttcccctgcgaccagtggtctttgtgtgctg 477

                                  
Query: 358 accacggacacgcacgccccagt 380
           ||| || ||||| | ||||||||
Sbjct: 476 accgcgaacacggaggccccagt 454



to top

>ref|NM_117048.2| Arabidopsis thaliana RPS18C (S18 RIBOSOMAL PROTEIN); RNA binding /
           structural constituent of ribosome AT4G09800 (RPS18C)
           mRNA, complete cds
          Length = 748

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
           |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 563 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 506



to top

>emb|AL161516.2|ATCHRIV28 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 28
          Length = 198005

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
           |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 187 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 130



to top

>emb|AL161515.2|ATCHRIV27 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 27
          Length = 197394

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                        
Query: 297    cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
              |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 192581 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 192524



to top

>emb|AL049482.1|ATF17A8 Arabidopsis thaliana DNA chromosome 4, BAC clone  F17A8 (ESSA project)
          Length = 128071

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                       
Query: 297   cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
             |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 73280 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 73223



to top

>gb|AY064680.1| Arabidopsis thaliana S18.A ribosomal protein (At4g09800; F17A8.150)
           mRNA, complete cds
          Length = 478

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
           |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 460 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 403



to top

>gb|AF386941.1|AF386941 Arabidopsis thaliana S18.A ribosomal protein (F17A8.150) mRNA,
           complete cds
          Length = 738

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
           |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 553 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 496



to top

>gb|AF370463.1|AF370463 Arabidopsis thaliana S18.A ribosomal protein (F17A8.150) mRNA,
           complete cds
          Length = 687

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
           |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 548 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 491



to top

>gb|AY086334.1| Arabidopsis thaliana clone 24071 mRNA, complete sequence
          Length = 712

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
           |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 563 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 506



to top

>emb|Z28962.1|ATS18RP3 A.thaliana (Columbia) gene for S18 ribosomal protein (1471bp)
          Length = 1471

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 297  cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
            |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 1397 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 1340



to top

>gb|BT006539.1| Arabidopsis thaliana At4g09800 gene, complete cds
          Length = 459

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
           |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 455 cgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 403



to top

>gb|AY342352.1| Ixodes ricinus ribosomal protein S18 mRNA, partial cds
          Length = 456

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 305 ttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacgg 364
           |||||||| ||||| |||||| |||| ||||| ||||| |||||||||||||| || |  
Sbjct: 452 ttcttggacacaccgacagtccttcccctccttccggtggtcttggtgtgctgtcccctc 393

                          
Query: 365 acacgcacgccccag 379
           ||||||| |||||||
Sbjct: 392 acacgcaggccccag 378



to top

>gb|DQ066248.1| Ixodes scapularis isolate ISN-L-49 ribosomal protein S18 mRNA,
           partial cds
          Length = 459

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 305 ttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacgg 364
           |||||||| ||||| |||||| |||| |||||||| || |||||||||||||| || |  
Sbjct: 452 ttcttggacacaccgacagtccttcccctcctgccagtggtcttggtgtgctgtcccctc 393

                          
Query: 365 acacgcacgccccag 379
           ||||||| |||||||
Sbjct: 392 acacgcaggccccag 378



to top

>ref|NM_103125.2| Arabidopsis thaliana RNA binding / structural constituent of
           ribosome AT1G34030 mRNA, complete cds
          Length = 754

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 546 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 487

                         
Query: 356 tgaccacggacacg 369
           || ||||| |||||
Sbjct: 486 tgtccacgaacacg 473



to top

>gb|AY070029.1| Arabidopsis thaliana putative ribosomal protein S18 (At1g34030)
           mRNA, complete cds
          Length = 490

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 461 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 402

                         
Query: 356 tgaccacggacacg 369
           || ||||| |||||
Sbjct: 401 tgtccacgaacacg 388



to top

>gb|AY034965.1| Arabidopsis thaliana putative ribosomal protein S18 (At1g34030)
           mRNA, complete cds
          Length = 759

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 545 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 486

                         
Query: 356 tgaccacggacacg 369
           || ||||| |||||
Sbjct: 485 tgtccacgaacacg 472



to top

>emb|BX816977.1|CNS0ADD2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH79ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 685

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 530 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 471

                         
Query: 356 tgaccacggacacg 369
           || ||||| |||||
Sbjct: 470 tgtccacgaacacg 457



to top

>gb|AC079286.2|AC079286 Arabidopsis thaliana chromosome 1 BAC T15K4 genomic sequence, complete
             sequence
          Length = 33513

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                         
Query: 296   gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
             ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 24671 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 24730

                           
Query: 356   tgaccacggacacg 369
             || ||||| |||||
Sbjct: 24731 tgtccacgaacacg 24744



to top

>gb|AC015446.4|AC015446 Arabidopsis thaliana chromosome I BAC F12G12 genomic sequence, complete
             sequence
          Length = 125632

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                         
Query: 296   gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
             ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 87090 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 87031

                           
Query: 356   tgaccacggacacg 369
             || ||||| |||||
Sbjct: 87030 tgtccacgaacacg 87017



to top

>gb|AY086800.1| Arabidopsis thaliana clone 27800 mRNA, complete sequence
          Length = 693

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 546 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 487

                         
Query: 356 tgaccacggacacg 369
           || ||||| |||||
Sbjct: 486 tgtccacgaacacg 473



to top

>emb|Z28702.1|ATS18RP2 A.thaliana (Columbia) mRNA for S18 ribosomal protein (641bp)
          Length = 647

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 296 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 355
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 494 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 435

                         
Query: 356 tgaccacggacacg 369
           || ||||| |||||
Sbjct: 434 tgtccacgaacacg 421



to top

>ref|XM_746138.1| Aspergillus fumigatus Af293 ribosomal protein S13p/S18e
           (Afu6g13550) partial mRNA
          Length = 384

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 341 gtagtcttggtgtgctgaccacggacacg 369
           |||||||||||||||||||||||||||||
Sbjct: 338 gtagtcttggtgtgctgaccacggacacg 310



to top

>ref|NM_102125.2| Arabidopsis thaliana PFL (POINTED FIRST LEAVES); RNA binding /
           structural constituent of ribosome AT1G22780 (PFL) mRNA,
           complete cds
          Length = 752

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 581 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 522

                   
Query: 362 cggacacg 369
           || |||||
Sbjct: 521 cgtacacg 514



to top

>gb|BT020298.1| Arabidopsis thaliana At1g22780 gene, complete cds
          Length = 474

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 470 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 411

                   
Query: 362 cggacacg 369
           || |||||
Sbjct: 410 cgtacacg 403



to top

>gb|BT025610.1| Arabidopsis thaliana At1g22780 mRNA, complete cds
          Length = 459

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 455 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 396

                   
Query: 362 cggacacg 369
           || |||||
Sbjct: 395 cgtacacg 388



to top

>ref|XM_657953.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5441.2), mRNA
          Length = 468

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 338 ccggtagtcttggtgtgctgaccacggacacg 369
           ||||||||||| ||||||||||||||||||||
Sbjct: 425 ccggtagtcttcgtgtgctgaccacggacacg 394



to top

>ref|XM_752114.1| Ustilago maydis 521 hypothetical protein (UM01060.1) partial mRNA
          Length = 465

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 344 gtcttggtgtgctgaccacggacacgca 371
           ||||||||||||||||||||||||||||
Sbjct: 422 gtcttggtgtgctgaccacggacacgca 395



to top

>ref|XM_387069.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG06893.1)
           partial mRNA
          Length = 540

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 338 ccggtagtcttggtgtgctgaccacggacacg 369
           ||||| ||||||||||||||||||||||||||
Sbjct: 494 ccggtggtcttggtgtgctgaccacggacacg 463



to top

>gb|AF548335.1| Branchiostoma belcheri ribosomal protein S18 mRNA, complete cds
          Length = 558

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||| |||||||||||||| ||||| ||||||| ||||||||
Sbjct: 454 gccggtggtcttggtgtgctgtccacgcacacgcaggccccagt 411



to top

>emb|Y12227.1|ATY12227 Arabidopsis thaliana DNA, 24 kb surrounding PFL locus
          Length = 24053

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                         
Query: 302   cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361
             ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 22237 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 22178

                     
Query: 362   cggacacg 369
             || |||||
Sbjct: 22177 cgtacacg 22170



to top

>gb|AF526232.1| Argopecten irradians isolate iolsaicl552ct593cn617 ribosomal
           protein S18 mRNA, complete cds
          Length = 532

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363
           ||||||||  |||||||||||  ||||||||||||| || ||||| |||||||| |||||
Sbjct: 481 cttcttggccacaccaacagttcttcctctcctgccagttgtctttgtgtgctgtccacg 422



to top

>gb|AF411781.1|AF411781 Arabidopsis thaliana At1g22780/T22J18_5 mRNA, complete cds
          Length = 632

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 514 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 455

                   
Query: 362 cggacacg 369
           || |||||
Sbjct: 454 cgtacacg 447



to top

>emb|BX813906.1|CNS0ACAK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB47ZA11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 674

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 515 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 456

                   
Query: 362 cggacacg 369
           || |||||
Sbjct: 455 cgtacacg 448



to top

>gb|AC003979.2|T22J18 Arabidopsis thaliana chromosome 1 BAC T22J18 sequence, complete
             sequence
          Length = 84162

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                         
Query: 302   cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361
             ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 10133 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 10192

                     
Query: 362   cggacacg 369
             || |||||
Sbjct: 10193 cgtacacg 10200



to top

>gb|AY087428.1| Arabidopsis thaliana clone 35333 mRNA, complete sequence
          Length = 709

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 581 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 522

                   
Query: 362 cggacacg 369
           || |||||
Sbjct: 521 cgtacacg 514



to top

>emb|Z23165.1|ATRBPS18A A.thaliana ribosomal protein gene S18, complete CDS
          Length = 2848

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 302  cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361
            ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 2355 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 2296

                    
Query: 362  cggacacg 369
            || |||||
Sbjct: 2295 cgtacacg 2288



to top

>emb|Z28701.1|ATS18RP1 A.thaliana (C24) mRNA for S18 ribosomal protein
          Length = 683

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 302 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 361
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 526 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 467

                   
Query: 362 cggacacg 369
           || |||||
Sbjct: 466 cgtacacg 459



to top

>gb|AY440501.1| Armigeres subalbatus ASAP ID: 41411 cytosolic small ribosomal
           subunit S18 mRNA sequence
          Length = 578

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           ||||| ||||||||||||||||| || ||||||| ||||||||
Sbjct: 455 ccggtggtcttggtgtgctgaccgcgcacacgcaggccccagt 413



to top

>emb|BX072327.1|CNS09RYZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 300 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 342



to top

>emb|BX072326.1|CNS09RYY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 653

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 484 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 442



to top

>emb|BX072311.1|CNS09RYJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 658

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 287 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 329



to top

>emb|BX072310.1|CNS09RYI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 460



to top

>emb|BX072288.1|CNS09RXW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 663

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 309 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 351



to top

>emb|BX072287.1|CNS09RXV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 695

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 460



to top

>emb|BX069062.1|CNS09PGA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 485 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 443



to top

>emb|BX063555.1|CNS09L7B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 272 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 314



to top

>emb|BX063554.1|CNS09L7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 807

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 489 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 447



to top

>emb|BX049522.1|CNS09ADI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 499 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 457



to top

>emb|BX048448.1|CNS099JO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 280 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 322



to top

>emb|BX048447.1|CNS099JN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 478 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 436



to top

>emb|BX043249.1|CNS095J9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 823

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 493 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 451



to top

>emb|BX042743.1|CNS09557 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 269 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 311



to top

>emb|BX042742.1|CNS09556 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 487 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 445



to top

>emb|BX038898.1|CNS0926E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 304 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 346



to top

>emb|BX038897.1|CNS0926D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 504 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 462



to top

>emb|BX038809.1|CNS0923X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 300 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 342



to top

>emb|BX038808.1|CNS0923W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 686

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 503 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 461



to top

>emb|BX038794.1|CNS0923I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 752

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 301 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 343



to top

>emb|BX038793.1|CNS0923H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 460



to top

>emb|BX038685.1|CNS0920H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 304 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 346



to top

>emb|BX038684.1|CNS0920G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 442 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 400



to top

>emb|BX038638.1|CNS091Z6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 298 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 340



to top

>emb|BX038637.1|CNS091Z5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 504 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 462



to top

>emb|BX038386.1|CNS091S6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 446

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 71  ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 113



to top

>emb|BX038260.1|CNS091OO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 720

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 500 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 458



to top

>emb|BX037931.1|CNS091FJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 313 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 355



to top

>emb|BX037930.1|CNS091FI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 504 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 462



to top

>emb|BX037628.1|CNS09174 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 729

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 460



to top

>emb|BX037395.1|CNS0910N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 273 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 315



to top

>emb|BX037394.1|CNS0910M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 491 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 449



to top

>emb|BX036909.1|CNS090N5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 483 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 441



to top

>emb|BX034354.1|CNS08YO6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 498 ccggtagttttcgtgtgctgaccacggacacgcaaaccccagt 456



to top

>emb|BX034173.1|CNS08YJ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 257 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 299



to top

>emb|BX033670.1|CNS08Y56 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 266 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 308



to top

>emb|BX033669.1|CNS08Y55 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 493 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 451



to top

>emb|BX033110.1|CNS08XPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 441 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 399



to top

>emb|BX032956.1|CNS08XLC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 462

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 267 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 309



to top

>emb|BX032190.1|CNS08X02 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 786

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 256 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 298



to top

>emb|BX032189.1|CNS08X01 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 464 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 422



to top

>emb|BX030688.1|CNS08VUC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 477 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 435



to top

>emb|BX027156.1|CNS08T48 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 489 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 447



to top

>emb|BX026624.1|CNS08SPG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 246 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 288



to top

>emb|BX026623.1|CNS08SPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 782

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 467 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 425



to top

>emb|BX023324.1|CNS08Q5S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 288 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 330



to top

>emb|BX023323.1|CNS08Q5R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 498 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 456



to top

>emb|BX022521.1|CNS08PJH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 683

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 388 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 346



to top

>emb|BX021989.1|CNS08P4P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 554

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 262 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 304



to top

>emb|BX021988.1|CNS08P4O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 524 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 482



to top

>emb|BX021615.1|CNS08OUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 456 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 414



to top

>emb|BX020788.1|CNS08O7C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 270 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 312



to top

>emb|BX020787.1|CNS08O7B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 407

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 82  ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 40



to top

>emb|BX016687.1|CNS08L1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 480 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 438



to top

>emb|BX009941.1|CNS08FU1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 257 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 299



to top

>emb|BX009940.1|CNS08FU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 475 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 433



to top

>emb|BX009870.1|CNS08FS2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 487

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 279 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 321



to top

>emb|BX009869.1|CNS08FS1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 823

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 498 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 456



to top

>emb|AJ843092.1| Platichthys flesus mRNA for 40S ribosomal protein S18 (rps18 gene)
          Length = 530

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 337 gccggtagtcttggtgtgctgaccacggacacgca 371
           |||||| |||||||||||||||||||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctgaccacgcacacgca 411



to top

>gb|AF283268.1|AF283268 Anopheles gambiae strain G3 ribosomal protein S18 (IrpS18) mRNA,
           partial cds
          Length = 379

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 101 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 59



to top

>ref|XM_311570.2| Anopheles gambiae str. PEST ENSANGP00000022445
           (ENSANGG00000020271), partial mRNA
          Length = 459

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||||| || ||||||||||||||||||||||  |||||||
Sbjct: 419 ccggtagttttcgtgtgctgaccacggacacgcagaccccagt 377



to top

>gb|L22959.1|DRORPS18A Drosophila melanogaster ribosomal protein S18 mRNA, complete cds
          Length = 567

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           ||||| |||||||||||||||||||| ||||| | ||||||||
Sbjct: 419 ccggtggtcttggtgtgctgaccacgcacacggaggccccagt 377



to top

>emb|AL845501.9| Mouse DNA sequence from clone RP23-194C12 on chromosome 4 Contains a
             ribosomal protein S18 (Rps18) pseudogene, complete
             sequence
          Length = 156572

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 341   gtagtcttggtgtgctgaccacggacacgcacgcccca 378
             |||||||||||||||||||| |||||||| | ||||||
Sbjct: 57217 gtagtcttggtgtgctgaccgcggacacgaaggcccca 57254



to top

>emb|BX826567.1|CNS0A3AT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 646

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 297 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 354
           |||| |||||||  || |||||||||||||||||||| |  || ||||||||||||||
Sbjct: 544 cttaacgcttctctgacacaccaacagtctttcctctgcgaccagtagtcttggtgtg 487



to top

>dbj|AB182248.1| Antheraea yamamai Antheraea S18 gene mRNA for ribosomal protein
           S18, complete cds
          Length = 541

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363
           |||||||||||||||||||||  | ||||| ||||| || ||||| ||||| ||||| ||
Sbjct: 491 cttcttggagacaccaacagttctacctcttctgcctgtggtcttagtgtgttgaccgcg 432

                 
Query: 364 gacacg 369
            |||||
Sbjct: 431 aacacg 426



to top

>emb|BX050031.1|CNS09ARN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 340 ggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           |||||| || ||||||||||||||||||||||  |||||||
Sbjct: 466 ggtagttttcgtgtgctgaccacggacacgcagaccccagt 426



to top

>emb|BX006616.1|CNS08D9O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 338 ccggtagtcttggtgtgctgaccacggacacgc 370
           |||||||| || |||||||||||||||||||||
Sbjct: 483 ccggtagttttcgtgtgctgaccacggacacgc 451



to top

>emb|BX814653.1|CNS0AC5P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZC12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 636

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 302 cgcttcttggagacaccaacagtctttcc 330
           ||||||||||| |||||||||||||||||
Sbjct: 494 cgcttcttggaaacaccaacagtctttcc 466



to top

>gb|DQ413212.1| Acyrthosiphon pisum isolate WHAP0121 putative ribosomal protein S18
           mRNA, complete cds
          Length = 459

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 363
           |||||| || |||||||||||  ||||||| |  |||||||| ||||| |||||||||||
Sbjct: 453 cttcttagatacaccaacagttcttcctctacgtccggtagttttggtatgctgaccacg 394



to top

>dbj|AB226103.1| Aspergillus oryzae cDNA, contig sequence: AoEST2960
          Length = 720

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 338 ccggtagtcttggtgtgctgaccacggacacg 369
           ||||| |||||||||||||| |||||||||||
Sbjct: 469 ccggtggtcttggtgtgctgtccacggacacg 438



to top

>dbj|AP007174.1| Aspergillus oryzae RIB40 genomic DNA, SC103
          Length = 1282697

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 338    ccggtagtcttggtgtgctgaccacggacacg 369
              ||||| |||||||||||||| |||||||||||
Sbjct: 854331 ccggtggtcttggtgtgctgtccacggacacg 854300



to top

>ref|NM_213557.1| Rattus norvegicus ribosomal protein S18 (Rps18), mRNA
          Length = 548

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378
           ||||||||||||||||| |||||||| | ||||||
Sbjct: 458 gtcttggtgtgctgaccccggacacgaaggcccca 424



to top

>gb|BC081458.1| Mus musculus ribosomal protein S18, mRNA (cDNA clone MGC:102109
           IMAGE:5712669), complete cds
          Length = 530

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378
           ||||||||||||||||| |||||||| | ||||||
Sbjct: 422 gtcttggtgtgctgaccgcggacacgaaggcccca 388



to top

>gb|BC081459.1| Mus musculus ribosomal protein S18, mRNA (cDNA clone MGC:102110
           IMAGE:6407328), complete cds
          Length = 541

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378
           ||||||||||||||||| |||||||| | ||||||
Sbjct: 434 gtcttggtgtgctgaccgcggacacgaaggcccca 400



to top

>gb|AY190738.1| Pagrus major 40S ribosomal protein S18 mRNA, partial cds
          Length = 477

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 337 gccggtagtcttggtgtgctgaccacggacacgca 371
           |||||| ||||||||||||||||| || |||||||
Sbjct: 385 gccggtggtcttggtgtgctgaccgcgcacacgca 351



to top

>ref|NM_011296.1| Mus musculus ribosomal protein S18 (Rps18), mRNA
          Length = 525

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378
           ||||||||||||||||| |||||||| | ||||||
Sbjct: 435 gtcttggtgtgctgaccgcggacacgaaggcccca 401



to top

>gb|BC100604.1| Mus musculus ribosomal protein S18, transcript variant 1, mRNA
           (cDNA clone MGC:118719 IMAGE:30120583), complete cds
          Length = 560

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378
           ||||||||||||||||| |||||||| | ||||||
Sbjct: 456 gtcttggtgtgctgaccgcggacacgaaggcccca 422



to top

>gb|AC158364.4| Mus musculus BAC clone RP23-187J8 from chromosome 8, complete sequence
          Length = 208153

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 344   gtcttggtgtgctgaccacggacacgcacgcccca 378
             ||||||||||||||||| |||||||| | ||||||
Sbjct: 42385 gtcttggtgtgctgaccgcggacacgaaggcccca 42419



to top

>gb|DQ084044.1| Oxyuranus scutellatus 40S ribosomal protein S18 mRNA, partial cds
          Length = 285

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| || |||||||| | |||||||
Sbjct: 249 gccggtggtcttggtgtgctggccccggacacggaggccccag 207



to top

>emb|X57529.1|RRRPS18A R.rattus ribosomal protein S18 mRNA
          Length = 516

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 344 gtcttggtgtgctgaccacggacacgcacgcccca 378
           ||||||||||||||||| |||||||| | ||||||
Sbjct: 450 gtcttggtgtgctgaccccggacacgaaggcccca 416



to top

>gb|AC124397.5| Mus musculus BAC clone RP24-348J16 from chromosome 13, complete sequence
          Length = 191713

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 344    gtcttggtgtgctgaccacggacacgcacgcccca 378
              ||||||||||||||||| |||||||| | ||||||
Sbjct: 188285 gtcttggtgtgctgaccgcggacacgaaggcccca 188251



to top

>gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, complete sequence
          Length = 189936

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 344    gtcttggtgtgctgaccacggacacgcacgcccca 378
              ||||||||||||||||| |||||||| | ||||||
Sbjct: 143765 gtcttggtgtgctgaccgcggacacgaaggcccca 143799



to top

>emb|CR734899.2|CNS0GTTU Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR734341.2|CNS0GTEC Tetraodon nigroviridis full-length cDNA
          Length = 520

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 439 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 397



to top

>emb|CR674974.2|CNS0FJS4 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR734533.2|CNS0GTJO Tetraodon nigroviridis full-length cDNA
          Length = 516

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR733895.2|CNS0GT1Y Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR733804.2|CNS0GSZF Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR720262.2|CNS0GIP8 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>gb|AY232075.1| Drosophila yakuba clone yak-ad_RpS18 mRNA sequence
          Length = 456

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           ||||| |||||||||||||| ||||| ||||| | ||||||||
Sbjct: 419 ccggtggtcttggtgtgctggccacgaacacggaggccccagt 377



to top

>emb|CR722880.2|CNS0GKPY Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR722776.2|CNS0GKN2 Tetraodon nigroviridis full-length cDNA
          Length = 499

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 419 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 377



to top

>gb|AY231741.1| Drosophila yakuba clone yak-em_RpS18 mRNA sequence
          Length = 456

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 338 ccggtagtcttggtgtgctgaccacggacacgcacgccccagt 380
           ||||| |||||||||||||| ||||| ||||| | ||||||||
Sbjct: 419 ccggtggtcttggtgtgctggccacgaacacggaggccccagt 377



to top

>emb|CR722174.2|CNS0GK6C Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR721952.2|CNS0GK06 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR720455.2|CNS0GIUL Tetraodon nigroviridis full-length cDNA
          Length = 444

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 363 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 321



to top

>emb|CR704786.2|CNS0G6RI Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR703781.2|CNS0G5ZL Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR703599.2|CNS0G5UJ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR703505.2|CNS0G5RX Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR703433.2|CNS0G5PX Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR702036.2|CNS0G4N4 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR702025.2|CNS0G4MT Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR702003.2|CNS0G4M7 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR701412.2|CNS0G45S Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR701350.2|CNS0G442 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR701061.2|CNS0G3W1 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR699796.2|CNS0G2WW Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR699943.2|CNS0G30Z Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR699936.2|CNS0G30S Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR699450.2|CNS0G2NA Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR691285.2|CNS0FWCH Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR698404.2|CNS0G1U8 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR697912.2|CNS0G1GK Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR697012.2|CNS0G0RK Tetraodon nigroviridis full-length cDNA
          Length = 527

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR696669.2|CNS0G0I1 Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402



to top

>emb|CR696546.2|CNS0G0EM Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402



to top

>emb|CR696299.2|CNS0G07R Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR694383.2|CNS0FYQJ Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR694171.2|CNS0FYKN Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR694138.2|CNS0FYJQ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR694134.2|CNS0FYJM Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402



to top

>emb|CR694030.2|CNS0FYGQ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR693776.2|CNS0FY9O Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR693694.2|CNS0FY7E Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR693089.2|CNS0FXQL Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR692975.2|CNS0FXNF Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR692013.2|CNS0FWWP Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR690406.2|CNS0FVO2 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR689779.2|CNS0FV6N Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402



to top

>emb|CR688604.2|CNS0FUA0 Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR688046.2|CNS0FTUI Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR687925.2|CNS0FTR5 Tetraodon nigroviridis full-length cDNA
          Length = 477

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 396 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 354



to top

>emb|CR686387.2|CNS0FSKF Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR686304.2|CNS0FSI4 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR686239.2|CNS0FSGB Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR685614.2|CNS0FRYY Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR684442.2|CNS0FR2E Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR683437.2|CNS0FQAH Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400



to top

>emb|CR683517.2|CNS0FQCP Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400



to top

>emb|CR682886.2|CNS0FPV6 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR682487.2|CNS0FPK3 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 559 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 517



to top

>emb|CR682175.2|CNS0FPBF Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR681394.2|CNS0FOPQ Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402



to top

>emb|CR680612.2|CNS0FO40 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR679692.2|CNS0FNEG Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR679567.2|CNS0FNAZ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR678814.2|CNS0FMQ2 Tetraodon nigroviridis full-length cDNA
          Length = 496

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 415 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 373



to top

>emb|CR679090.2|CNS0FMXQ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR678273.2|CNS0FMB8 Tetraodon nigroviridis full-length cDNA
          Length = 1133

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 337  gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
            |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 1079 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 1037



to top

>emb|CR678694.2|CNS0FMMQ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR677677.2|CNS0FLUU Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR677659.2|CNS0FLUC Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR678402.1|CNS0FMEQ Tetraodon nigroviridis full-length cDNA
          Length = 1170

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 337  gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
            |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 1098 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 1056



to top

>emb|CR677875.2|CNS0FM0B Tetraodon nigroviridis full-length cDNA
          Length = 537

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 454 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 412



to top

>emb|CR677055.2|CNS0FLDN Tetraodon nigroviridis full-length cDNA
          Length = 530

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR676589.2|CNS0FL0P Tetraodon nigroviridis full-length cDNA
          Length = 1175

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 337  gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
            |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 1101 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 1059



to top

>emb|CR676244.2|CNS0FKR4 Tetraodon nigroviridis full-length cDNA
          Length = 499

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR675831.2|CNS0FKFX Tetraodon nigroviridis full-length cDNA
          Length = 499

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 418 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 376



to top

>emb|CR675684.2|CNS0FKBU Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR675638.2|CNS0FKAK Tetraodon nigroviridis full-length cDNA
          Length = 527

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR675556.2|CNS0FK8A Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402



to top

>emb|CR675521.2|CNS0FK7B Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR674793.2|CNS0FJN3 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR674782.2|CNS0FJMS Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 402



to top

>emb|CR672937.2|CNS0FI7J Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR671413.2|CNS0FH17 Tetraodon nigroviridis full-length cDNA
          Length = 527

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 446 gccggtggtcttggtgtgctggccacgcacgcgcaagccccag 404



to top

>emb|CR670010.2|CNS0FFY8 Tetraodon nigroviridis full-length cDNA
          Length = 524

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 443 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 401



to top

>emb|CR669727.2|CNS0FFQD Tetraodon nigroviridis full-length cDNA
          Length = 1171

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 337  gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
            |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 1099 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 1057



to top

>emb|CR668754.2|CNS0FEZC Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcatgccccag 403



to top

>emb|CR668099.2|CNS0FEH5 Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400



to top

>emb|CR666954.2|CNS0FDLC Tetraodon nigroviridis full-length cDNA
          Length = 527

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 446 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 404



to top

>emb|CR666571.2|CNS0FDAP Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR666558.2|CNS0FDAC Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR666487.2|CNS0FD8D Tetraodon nigroviridis full-length cDNA
          Length = 527

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 446 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 404



to top

>emb|CR666205.2|CNS0FD0J Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400



to top

>emb|CR666012.2|CNS0FCV6 Tetraodon nigroviridis full-length cDNA
          Length = 528

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 447 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 405



to top

>emb|CR665971.2|CNS0FCU1 Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400



to top

>emb|CR665553.2|CNS0FCIF Tetraodon nigroviridis full-length cDNA
          Length = 528

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 446 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 404



to top

>emb|CR665244.2|CNS0FC9U Tetraodon nigroviridis full-length cDNA
          Length = 530

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR664532.2|CNS0FBQ2 Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 405 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 363



to top

>emb|CR664405.2|CNS0FBMJ Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 400



to top

>emb|CR664162.2|CNS0FBFS Tetraodon nigroviridis full-length cDNA
          Length = 527

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR663985.2|CNS0FBAV Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR663647.2|CNS0FB1H Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403



to top

>emb|CR663135.2|CNS0FAN9 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 337 gccggtagtcttggtgtgctgaccacggacacgcacgccccag 379
           |||||| |||||||||||||| ||||| || |||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccag 403


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,492,244
Number of Sequences: 3902068
Number of extensions: 3492244
Number of successful extensions: 63468
Number of sequences better than 10.0: 511
Number of HSP's better than 10.0 without gapping: 511
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62821
Number of HSP's gapped (non-prelim): 630
length of query: 382
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 360
effective length of database: 17,147,199,772
effective search space: 6172991917920
effective search space used: 6172991917920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top