ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags9d05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK121233.1| Oryza sativa (japonica cultivar-group) cDNA clon... 509 e-141
2dbj|AK105044.1| Oryza sativa (japonica cultivar-group) cDNA clon... 509 e-141
3gb|U27098.1|OSU27098 Oryza sativa vacuolar H+-ATPase (vatp-P1) m... 509 e-141
4gb|AF416606.1| Pennisetum glaucum vacuolar H+-ATPase 16 kDa prot... 492 e-136
5dbj|AK119725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 486 e-134
6gb|AY106139.1| Zea mays PCO154307 mRNA sequence 480 e-132
7dbj|AK104011.1| Oryza sativa (japonica cultivar-group) cDNA clon... 478 e-131
8dbj|AK071641.1| Oryza sativa (japonica cultivar-group) cDNA clon... 478 e-131
9gb|M73232.1|ASTATPASEH Avena sativa vacuolar H+-ATPase 16 kDa pr... 476 e-131
10ref|XM_466150.1| Oryza sativa (japonica cultivar-group), mRNA 440 e-120
11gb|AF286464.1|AF286464 Porteresia coarctata V-ATPase subunit c (... 440 e-120
12gb|AY106384.1| Zea mays PCO086002 mRNA sequence 436 e-119
13gb|BT017938.1| Zea mays clone EL01N0520G10.c mRNA sequence 434 e-118
14dbj|AK099459.1| Oryza sativa (japonica cultivar-group) cDNA clon... 432 e-118
15gb|BT017156.1| Zea mays clone EL01N0367F12.c mRNA sequence 408 e-110
16dbj|AK063178.1| Oryza sativa (japonica cultivar-group) cDNA clon... 402 e-109
17gb|BT017861.1| Zea mays clone EL01N0511G07.c mRNA sequence 392 e-106
18dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 377 e-101
19dbj|AP004775.3| Oryza sativa (japonica cultivar-group) genomic D... 377 e-101
20dbj|AP005469.3| Oryza sativa (japonica cultivar-group) genomic D... 377 e-101
21gb|AC147812.2| Oryza sativa (japonica cultivar-group) chromosome... 327 3e-86
22gb|AY620961.1| Pennisetum glaucum vacuolar ATPase subunit c isof... 327 3e-86
23dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 327 3e-86
24dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 327 3e-86
25gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 327 3e-86
26gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 327 3e-86
27emb|AL954825.3|CNS08CD1 Oryza sativa chromosome 12, . BAC OJ2007... 327 3e-86
28gb|AC104285.2| Oryza sativa (japonica cultivar-group) chromosome... 325 1e-85
29dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 325 1e-85
30emb|AL713902.2|CNS07YQ2 Oryza sativa chromosome 12, . BAC OJ1494... 313 4e-82
31ref|NM_189368.1| Oryza sativa (japonica cultivar-group), predic... 283 4e-73
32gb|BT017996.1| Zea mays clone EL01N0526E06.c mRNA sequence 258 2e-65
33dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 250 6e-63
34dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic D... 250 6e-63
35gb|U16244.1|KDU16244 Kalanchoe daigremontiana V-type H+-ATPase 1... 246 9e-62
36gb|AY620960.1| Pennisetum glaucum truncated vacuolar ATPase subu... 214 3e-52
37gb|AY389658.1| Hyacinthus orientalis vacuolar H+-ATPase proteoli... 206 8e-50
38emb|X92374.1|ZMATP162 Z.mays mRNA for V-type H+-ATPase, clone 16-2 192 1e-45
39emb|X92375.1|ZMATP164 Z.mays mRNA for V-type H+-ATPase, clone 16-4 176 7e-41
40gb|AF193814.1|AF193814 Dendrobium crumenatum vacuolar H+-ATP syn... 172 1e-39
41dbj|AB024276.1| Citrus unshiu (CitVATP c-3) mRNA for vacuolar H+... 155 2e-34
42gb|AF022925.1|AF022925 Vigna radiata adenosine triphosphatase mR... 151 4e-33
43gb|AF303372.1| Tortula ruralis vacuolar-type H(+)-ATPase subunit... 145 2e-31
44ref|NM_106215.2| Arabidopsis thaliana AVA-P; ATPase AT1G75630 (A... 135 2e-28
45gb|AY098985.1| Arabidopsis thaliana At1g75630/F10A5_17 mRNA, com... 135 2e-28
46gb|AF424574.1|AF424574 Arabidopsis thaliana At1g75630/F10A5_17 m... 135 2e-28
47gb|L44584.1|ATHAVAPC Arabidopsis thaliana vacuolar H+-pumping AT... 135 2e-28
48gb|M95063.1|MZEORFD Zea mays putative proteolipid subunit of vac... 133 9e-28
49ref|NM_101846.2| Arabidopsis thaliana AVA-P2; ATPase AT1G19910 (... 129 1e-26
50gb|BT024867.1| Arabidopsis thaliana At1g19910 gene, complete cds 129 1e-26
51gb|L44585.1|ATHAVAPD Arabidopsis thaliana vacuolar H+-pumping AT... 129 1e-26
52gb|L44582.1|ATHAVAPA Arabidopsis thaliana vacuolar H+-pumping AT... 129 1e-26
53ref|NM_120052.2| Arabidopsis thaliana ATPase AT4G38920 mRNA, com... 121 3e-24
54gb|AY093249.1| Arabidopsis thaliana H+-transporting ATPase 16K c... 121 3e-24
55gb|AY090271.1| Arabidopsis thaliana AT4g38920/F19H22_20 mRNA, co... 121 3e-24
56gb|AY059836.1| Arabidopsis thaliana H+-transporting ATPase 16K c... 121 3e-24
57gb|AF412097.1|AF412097 Arabidopsis thaliana AT4g38920/F19H22_20 ... 121 3e-24
58gb|AY049249.1| Arabidopsis thaliana AT4g38920/F19H22_20 mRNA, co... 121 3e-24
59emb|BX828233.1|CNS0A338 Arabidopsis thaliana Full-length cDNA Co... 121 3e-24
60gb|AY087112.1| Arabidopsis thaliana clone 31833 mRNA, complete s... 121 3e-24
61emb|AJ843122.1| Plantago major mRNA for vacuolar H+-ATPase C sub... 117 5e-23
62gb|AF022926.1|AF022926 Vigna radiata adenosine triphosphatase mR... 115 2e-22
63dbj|D21104.1|RICAK23 Oryza sativa mRNA for H+-ATPase, partial se... 109 1e-20
64dbj|AB036924.1| Citrus unshiu Cit-VATP c-3 gene for vacuolar H+-... 107 5e-20
65dbj|AB024275.1| Citrus unshiu (CitVATP c-2) mRNA for vacuolar H+... 103 8e-19
66emb|BX841550.1|CNS09YFN Arabidopsis thaliana Full-length cDNA Co... 100 1e-17
67ref|NM_119638.2| Arabidopsis thaliana ATPase/ hydrogen-transport... 98 5e-17
68gb|AY127950.1| Arabidopsis thaliana AT4g34720/T4L20_300 mRNA, co... 98 5e-17
69gb|AF372872.1|AF372872 Arabidopsis thaliana AT4g34720/T4L20_300 ... 98 5e-17
70gb|AY086410.1| Arabidopsis thaliana clone 24998 mRNA, complete s... 98 5e-17
71gb|L44581.1|ATHAVAP Arabidopsis thaliana vacuolar H+-pumping ATP... 98 5e-17
72gb|DQ235180.1| Solanum tuberosum clone 160C10 vacuolar proton AT... 92 3e-15
73gb|DQ191632.1| Solanum tuberosum vacuolar proton ATPase proteoli... 92 3e-15
74gb|BT012782.1| Lycopersicon esculentum clone 113772R, mRNA sequence 92 3e-15
75gb|AF010228.1|AF010228 Lycopersicon esculentum vacuolar proton A... 92 3e-15
76dbj|AB024274.1| Citrus unshiu (CitVATP c-1) mRNA for vacuolar H+... 88 5e-14
77emb|X95752.1|NTPROTATP N.tabacum mRNA for c subunit of V-type AT... 86 2e-13
78gb|AC152103.2| Ostreococcus sp. CCE9901 clone JGIACFB-9A1, compl... 84 7e-13
79emb|X98851.1|BVSUBCATP B.vulgaris mRNA for subunit c of V-type A... 84 7e-13
80gb|AC006434.5|AC006434 Genomic sequence for Arabidopsis thaliana... 82 3e-12
81gb|AF153677.1|AF153677 Arabidopsis thaliana vacuolar H+-pumping ... 82 3e-12
82dbj|AB036923.1| Citrus unshiu Cit-VATP c-2 gene for vacuolar H+-... 82 3e-12
83emb|AJ002061.1|BVSCVTATP Beta vulgaris mRNA for subunit c of V-t... 80 1e-11
84emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, ... 78 5e-11
85emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, B... 78 5e-11
86gb|L44583.1|ATHAVAPB Arabidopsis thaliana vacuolar H+-pumping AT... 78 5e-11
87dbj|AB028204.1| Porphyra yezoensis mRNA for vacuolar-ATPase c su... 78 5e-11
88gb|AY261522.1| Suaeda maritima subsp. salsa vacuolar H(+)-ATPase... 76 2e-10
89gb|BT014562.1| Lycopersicon esculentum clone 134016F, mRNA sequence 74 7e-10
90gb|AY610014.1| Sus scrofa clone Clu_560.scr.msk.p1.Contig3, mRNA... 74 7e-10
91emb|X94999.1|MCVTATPC M.crystallinum mRNA for V-type ATPase c su... 72 3e-09
92gb|U13670.1|GHU13670 Gossypium hirsutum vacuolar H+-ATPase prote... 72 3e-09
93gb|U13669.1|GHU13669 Gossypium hirsutum vacuolar H+-ATPase prote... 70 1e-08
94gb|AY826922.1| Heterocapsa triquetra clone HTVATP1 vacuolar ATP ... 68 4e-08
95gb|AC007797.7|AC007797 Arabidopsis thaliana chromosome I BAC F6F... 68 4e-08
96gb|U59737.1|ATU59737 Arabidopsis thaliana ATP sulfurylase (APS2)... 68 4e-08
97gb|L16884.1|HELATPASEV Heliothis virescens 17kDa H+-ATPase V-typ... 68 4e-08
98dbj|AB028205.1| Porphyra yezoensis gene for vacuolar-ATPase c su... 68 4e-08
99gb|BC007759.2| Homo sapiens ATPase, H+ transporting, lysosomal 1... 66 2e-07
100gb|BC007389.2| Homo sapiens ATPase, H+ transporting, lysosomal 1... 66 2e-07
101gb|BT007459.1| Synthetic construct Homo sapiens ATPase, H+ trans... 66 2e-07
102gb|BT007155.1| Homo sapiens ATPase, H+ transporting, lysosomal 1... 66 2e-07
103emb|CR622720.1| full-length cDNA clone CS0DM012YP05 of Fetal liv... 66 2e-07
104emb|CR616665.1| full-length cDNA clone CS0DF036YP04 of Fetal bra... 66 2e-07
105emb|CR616464.1| full-length cDNA clone CS0DC002YJ21 of Neuroblas... 66 2e-07
106emb|CR613683.1| full-length cDNA clone CS0DD001YD19 of Neuroblas... 66 2e-07
107emb|CR608280.1| full-length cDNA clone CS0DC018YA15 of Neuroblas... 66 2e-07
108emb|CR603009.1| full-length cDNA clone CS0DK007YM15 of HeLa cell... 66 2e-07
109emb|CR601237.1| full-length cDNA clone CS0DC029YE21 of Neuroblas... 66 2e-07
110emb|CR600796.1| full-length cDNA clone CS0DI019YH17 of Placenta ... 66 2e-07
111emb|CR599331.1| full-length cDNA clone CS0DH005YC07 of T cells (... 66 2e-07
112emb|CR599309.1| full-length cDNA clone CS0DI067YF17 of Placenta ... 66 2e-07
113emb|CR597229.1| full-length cDNA clone CS0DN004YA02 of Adult bra... 66 2e-07
114emb|CR592409.1| full-length cDNA clone CS0DI067YN17 of Placenta ... 66 2e-07
115emb|CR592150.1| full-length cDNA clone CS0DF014YE05 of Fetal bra... 66 2e-07
116emb|CR590083.1| full-length cDNA clone CS0DJ004YP02 of T cells (... 66 2e-07
117ref|NM_001694.2| Homo sapiens ATPase, H+ transporting, lysosomal... 66 2e-07
118emb|CR541951.1| Homo sapiens full open reading frame cDNA clone ... 66 2e-07
119emb|CR541930.1| Homo sapiens full open reading frame cDNA clone ... 66 2e-07
120gb|BC004537.2| Homo sapiens ATPase, H+ transporting, lysosomal 1... 66 2e-07
121gb|AC093525.3| Homo sapiens chromosome 16 clone RP11-20I23, comp... 66 2e-07
122gb|AY892471.1| Synthetic construct Homo sapiens clone FLH014562.... 66 2e-07
123gb|AY889986.1| Synthetic construct Homo sapiens clone FLH014566.... 66 2e-07
124gb|BC009290.2| Homo sapiens ATPase, H+ transporting, lysosomal 1... 66 2e-07
125gb|M62762.1|HUMPCHSUCA Human vacuolar H+ ATPase proton channel s... 66 2e-07
126emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 64 7e-07
127emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BA... 64 7e-07
128dbj|AP006639.1| Lotus japonicus genomic DNA, chromosome 3, clone... 64 7e-07
129gb|AY190685.1| Pagrus major ATPase H+ transporting lysosomal vac... 60 1e-05
130emb|X65051.1|MSVATP16S M.sexta mRNA for vacuolar ATPase 16 kD pr... 60 1e-05
131gb|BC102659.1| Bos taurus proteolipid protein, mRNA (cDNA clone ... 60 1e-05
132emb|BX816345.1|CNS0ABM3 Arabidopsis thaliana Full-length cDNA Co... 60 1e-05
133ref|NM_001017954.1| Bos taurus ATPase, H+ transporting, lysosoma... 60 1e-05
134gb|AY246555.1| Spodoptera littoralis H(+)-ATPase C subunit mRNA,... 60 1e-05
135gb|J03835.1|BOVATPPLC Bovine proteolipid protein of the H+ -ATPa... 60 1e-05
136emb|CR728680.2|CNS0GP72 Tetraodon nigroviridis full-length cDNA 58 4e-05
137emb|CR723295.2|CNS0GL1H Tetraodon nigroviridis full-length cDNA 58 4e-05
138emb|CR719662.2|CNS0GI8K Tetraodon nigroviridis full-length cDNA 58 4e-05
139emb|CR703907.2|CNS0G633 Tetraodon nigroviridis full-length cDNA 58 4e-05
140emb|CR649696.2|CNS0F09Y Tetraodon nigroviridis full-length cDNA 58 4e-05
141emb|CR648948.2|CNS0EZP6 Tetraodon nigroviridis full-length cDNA 58 4e-05
142gb|AC148293.6| Medicago truncatula clone mth2-16c13, complete se... 56 2e-04
143emb|AJ879499.1| Phaseolus vulgaris SCAR-RADP fragment SG14 56 2e-04
144emb|BX817547.1|CNS0AB6O Arabidopsis thaliana Full-length cDNA Co... 56 2e-04
145ref|XM_859597.1| PREDICTED: Canis familiaris similar to Vacuolar... 54 7e-04
146ref|XM_537002.2| PREDICTED: Canis familiaris similar to Vacuolar... 54 7e-04
147ref|XM_947896.1| Theileria annulata strain Ankara vacuolar H+-AT... 54 7e-04
148ref|XM_510748.1| PREDICTED: Pan troglodytes similar to Vacuolar ... 52 0.003
149gb|AY617308.1| Sterkiella histriomuscorum clone UGC1O0001_L09_R ... 52 0.003
150gb|BC067156.1| Danio rerio ATPase, H+ transporting, lysosomal, V... 52 0.003
151gb|BC063154.1| Rattus norvegicus ATPase, H transporting, lysosom... 52 0.003
152ref|NM_130823.2| Rattus norvegicus ATPase, H transporting, lysos... 52 0.003
153emb|BX908778.5| Zebrafish DNA sequence from clone CH211-193E17 i... 52 0.003
154gb|AY099523.1| Danio rerio vacuolar ATP synthase 16 kDa proteoli... 52 0.003
155ref|NM_173255.1| Danio rerio ATPase, H+ transporting, lysosomal,... 52 0.003
156emb|CR387933.10| Zebrafish DNA sequence from clone DKEY-81L17 in... 52 0.003
157dbj|AB003942.1| Acetabularia acetabulum mRNA for vacuolar type H... 52 0.003
158ref|XM_530928.1| PREDICTED: Pan troglodytes LOC462697 (LOC462697... 50 0.010
159gb|AC149546.14| Medicago truncatula clone mth2-70o13, complete s... 50 0.010
160emb|AL049843.18|HSJ392M17 Human DNA sequence from clone RP3-392M... 50 0.010
161gb|AC174351.5| Medicago truncatula clone mth2-7h5, complete sequ... 50 0.010
162ref|NM_001009195.1| Ovis aries vacuolar ATPase 16kDa subunit c (... 50 0.010
163gb|AF027705.1|AF027705 Ovis aries vacuolar ATPase 16kDa subunit ... 50 0.010
164dbj|AB036922.1| Citrus unshiu Cit-VATP c-1 gene for vacuolar H+-... 50 0.010
165gb|AC166573.2| Mus musculus BAC clone RP23-153H18 from chromosom... 48 0.041
166ref|XM_460869.1| Debaryomyces hansenii CBS767 hypothetical prote... 48 0.041
167gb|AC117577.16| Mus musculus chromosome 17, clone RP23-35F19, co... 48 0.041
168gb|BT012440.1| Drosophila melanogaster RH30178 full insert cDNA 48 0.041
169gb|AY232009.1| Drosophila yakuba clone yak-ad_Vha16 mRNA sequence 48 0.041
170gb|AC153623.8| Mus musculus 6 BAC RP23-459F14 (Roswell Park Canc... 48 0.041
171gb|BC099475.1| Mus musculus ATPase, H+ transporting, lysosomal V... 48 0.041
172gb|BC083129.1| Mus musculus ATPase, H+ transporting, lysosomal V... 48 0.041
173gb|BC057084.1| Mus musculus ATPase, H+ transporting, lysosomal V... 48 0.041
174emb|BX035037.1|CNS08Z75 Single read from an extremity of a full-... 48 0.041
175emb|BX023184.1|CNS08Q1W Single read from an extremity of a full-... 48 0.041
176emb|BX023183.1|CNS08Q1V Single read from an extremity of a full-... 48 0.041
177emb|BX022537.1|CNS08PJX Single read from an extremity of a full-... 48 0.041
178emb|BX022536.1|CNS08PJW Single read from an extremity of a full-... 48 0.041
179emb|BX020878.1|CNS08O9U Single read from an extremity of a full-... 48 0.041
180emb|BX016528.1|CNS08KX0 Single read from an extremity of a full-... 48 0.041
181emb|BX011628.1|CNS08H4W Single read from an extremity of a full-... 48 0.041
182emb|BX011627.1|CNS08H4V Single read from an extremity of a full-... 48 0.041
183emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS... 48 0.041
184emb|X77936.1|DMCSDUC D.melanogaster (Canton S) ductin, subunit C... 48 0.041
185ref|NM_009729.1| Mus musculus ATPase, H+ transporting, lysosomal... 48 0.041
186ref|NM_165476.1| Drosophila melanogaster Vacuolar H+ ATPase 16kD... 48 0.041
187ref|NM_165475.1| Drosophila melanogaster Vacuolar H+ ATPase 16kD... 48 0.041
188ref|NM_165474.1| Drosophila melanogaster Vacuolar H+ ATPase 16kD... 48 0.041
189ref|NM_057453.3| Drosophila melanogaster Vacuolar H+ ATPase 16kD... 48 0.041
190dbj|AK146159.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 48 0.041
191dbj|AK170346.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 48 0.041
192gb|AF356008.1|AF356008 Mus musculus vacuolar proton-translocatin... 48 0.041
193dbj|AK002871.1| Mus musculus adult male kidney cDNA, RIKEN full-... 48 0.041
194dbj|AK002570.1| Mus musculus adult male kidney cDNA, RIKEN full-... 48 0.041
195dbj|AK028239.1| Mus musculus adult male hippocampus cDNA, RIKEN ... 48 0.041
196gb|AC007593.5|AC007593 Drosophila melanogaster, chromosome 2R, r... 48 0.041
197ref|XM_559193.1| Anopheles gambiae str. PEST ENSANGP00000027550 ... 48 0.041
198ref|XM_311406.2| Anopheles gambiae str. PEST ENSANGP00000025336 ... 48 0.041
199gb|AE003789.5| Drosophila melanogaster chromosome 2R, section 6 ... 48 0.041
200gb|U13842.1|MMU13842 Mus musculus vacuolar adenosine triphosphat... 48 0.041
201emb|CT010502.13| Mouse DNA sequence from clone RP23-27H19 on chr... 48 0.041
202emb|X55979.1|DMVHATP Drosophila mRNA for vacuolar H+-ATPase 48 0.041
203gb|M64298.1|MUSMVP Mouse vacuolar H(+)-ATPase (mvp) mRNA, comple... 48 0.041
204dbj|D10874.1|RATSDHATP Rattus norvegicus mRNA for H(+)-transport... 48 0.041
205dbj|AB059662.1| Mus musculus mvp gene for vacuolar H+-ATPase 16-... 48 0.041
206dbj|AB003938.1| Acetabularia acetabulum mRNA for vacuolar type H... 48 0.041
207ref|NM_205554.1| Danio rerio zgc:77708 (zgc:77708), mRNA 46 0.16
208ref|XM_956325.1| Neurospora crassa OR74A VACUOLAR ATP SYNTHASE 1... 46 0.16
209ref|XM_326824.1| Neurospora crassa OR74A VACUOLAR ATP SYNTHASE 1... 46 0.16
210ref|XM_567918.1| Cryptococcus neoformans var. neoformans JEC21 h... 46 0.16
211ref|XM_758859.1| Theileria parva strain Muguga chromosome 4 vacu... 46 0.16
212gb|BC050939.1| Mus musculus ATPase, H+ transporting, lysosomal V... 46 0.16
213emb|AL590075.8| Human DNA sequence from clone RP11-462L13 on chr... 46 0.16
214emb|AL451017.1|NC12F11 Neurospora crassa DNA linkage group V Cos... 46 0.16
215gb|BC065849.1| Danio rerio zgc:77708, mRNA (cDNA clone MGC:77708... 46 0.16
216gb|BC093130.1| Danio rerio zgc:77708, mRNA (cDNA clone MGC:11190... 46 0.16
217gb|AC009430.2|AC009430 Homo sapiens, clone RP11-45O17, complete ... 46 0.16
218gb|L07105.1|NEUVMA3A Neurospora crassa proteolipid subunit of va... 46 0.16
219gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chr... 44 0.64
220ref|XM_718009.1| Candida albicans SC5314 vacuolar ATPase subunit... 44 0.64
221ref|XM_717862.1| Candida albicans SC5314 vacuolar ATPase subunit... 44 0.64
222gb|AY488488.1| Capsicum annuum V-type ATPase c subunit mRNA, com... 44 0.64
223ref|XM_390178.1| Gibberella zeae PH-1 chromosome 1 VATL_NEUCR Va... 44 0.64
224ref|XM_385030.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 44 0.64
225gb|AF008924.1| Aedes aegypti V-ATPase C-subunit mRNA, complete cds 44 0.64
226gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 44 0.64
227gb|AC021001.5|AC021001 Homo sapiens chromosome 8, clone RP11-419... 44 0.64
228gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 44 0.64
229dbj|AB003940.1| Acetabularia acetabulum mRNA for vacuolar type H... 44 0.64
230gb|AF331918.1| Homo sapiens 19 19q13.3 carnitine acyltransferase... 42 2.5
231ref|XM_471460.1| Oryza sativa (japonica cultivar-group), predic... 42 2.5
232ref|XM_655600.1| Aspergillus nidulans FGSC A4 vacuolar ATP synth... 42 2.5
233gb|AF480884.1| Chimpanzee cytomegalovirus, complete genome 42 2.5
234ref|XM_505831.1| Yarrowia lipolytica CLIB122, YALI0F24475g predi... 42 2.5
235ref|XM_962866.1| PREDICTED: Tribolium castaneum similar to Vacuo... 42 2.5
236emb|AJ312686.1|HSA312686 Homo sapiens partial LIMD1 gene for LIM... 42 2.5
237gb|AC011495.8| Homo sapiens chromosome 19 clone CTB-33G10, compl... 42 2.5
238gb|AC111399.4| Rattus norvegicus Mcs BAC CH230-138L13 (Children'... 42 2.5
239ref|XM_627909.1| Cryptosporidium parvum Iowa II vacuolar ATP syn... 42 2.5
240gb|AC096975.5| Rattus norvegicus 2 BAC CH230-203P11 (Children's ... 42 2.5
241ref|NM_070587.2| Caenorhabditis elegans Y43D4A.5 (Y43D4A.5) mRNA... 42 2.5
242dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.5
243gb|AF222689.1|AF222689 Homo sapiens protein arginine N-methyltra... 42 2.5
244gb|BC068333.1| Danio rerio isocitrate dehydrogenase 3 (NAD+) alp... 42 2.5
245ref|NM_200951.2| Danio rerio isocitrate dehydrogenase 3 (NAD+) a... 42 2.5
246emb|X52002.1|TM15KDAM T.marmorata 15 kDa mRNA from a mediatophore 42 2.5
247emb|AL132846.1|CEY43D4A Caenorhabditis elegans YAC Y43D4A, compl... 42 2.5
248emb|AL731637.2|OSJN00278 Oryza sativa genomic DNA, chromosome 4,... 42 2.5
249gb|U53182.1|PCU53182 Pleurochrysis carterae V-type ATPase 16 kD ... 42 2.5
250gb|U48365.1|PCU48365 Pleurochrysis carterae V-type ATPase 16 kDa... 42 2.5
251gb|U81519.1|PCU81519 Pleurochrysis carterae vacuolar-type H(+)-A... 42 2.5
252emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 42 2.5

>dbj|AK121233.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093E21, full
           insert sequence
          Length = 935

 Score =  509 bits (257), Expect = e-141
 Identities = 395/440 (89%), Gaps = 1/440 (0%)
 Strand = Plus / Minus

                                                                       
Query: 289 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
           |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 602 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 543

                                                                       
Query: 349 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
           || ||||| |||||||||||||||||||| ||||||||||| |||||||| |||||||||
Sbjct: 542 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 483

                                                                       
Query: 409 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 468
           || || ||||| |||||||| |||||||||||||| ||||| |||||||| ||||| |||
Sbjct: 482 tgctgtgcatttgccctgacaccagcatcaccgacgatgccgatggccattccggcagcg 423

                                                                       
Query: 469 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 528
           || || ||||||||||||||||||||||| || ||||| ||||||||||| |||||| ||
Sbjct: 422 agaccggcgaggccacaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtag 363

                                                                       
Query: 529 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 588
           || ||||| |||||||| |||||||| || ||||||||||||||||||||||||||||||
Sbjct: 362 tacggcttagccttggggttgatccctgtactgatgatgacggcgatgatgaggccgtag 303

                                                                       
Query: 589 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 648
           || |||||||| || |||||||| |||||||||||||||||||| ||||||||||| |||
Sbjct: 302 ataccgagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 243

                                                                       
Query: 649 atgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccat 708
           || || |||||||||||||| |||||||||||||| |||| ||||||| ||||| |||||
Sbjct: 242 atcacgcccatggacgccacgccgacgccgctcttcgccg-tcccgtacgccgcacccat 184

                               
Query: 709 gcatgagaagacgagggcgg 728
           ||||||||||| ||||||||
Sbjct: 183 gcatgagaagatgagggcgg 164



to top

>dbj|AK105044.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-H05, full
           insert sequence
          Length = 1025

 Score =  509 bits (257), Expect = e-141
 Identities = 395/440 (89%), Gaps = 1/440 (0%)
 Strand = Plus / Minus

                                                                       
Query: 289 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
           |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 671 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 612

                                                                       
Query: 349 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
           || ||||| |||||||||||||||||||| ||||||||||| |||||||| |||||||||
Sbjct: 611 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 552

                                                                       
Query: 409 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 468
           || || ||||| |||||||| |||||||||||||| ||||| |||||||| ||||| |||
Sbjct: 551 tgctgtgcatttgccctgacaccagcatcaccgacgatgccgatggccattccggcagcg 492

                                                                       
Query: 469 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 528
           || || ||||||||||||||||||||||| || ||||| ||||||||||| |||||| ||
Sbjct: 491 agaccggcgaggccacaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtag 432

                                                                       
Query: 529 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 588
           || ||||| |||||||| |||||||| || ||||||||||||||||||||||||||||||
Sbjct: 431 tacggcttagccttggggttgatccctgtactgatgatgacggcgatgatgaggccgtag 372

                                                                       
Query: 589 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 648
           || |||||||| || |||||||| |||||||||||||||||||| ||||||||||| |||
Sbjct: 371 ataccgagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 312

                                                                       
Query: 649 atgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccat 708
           || || |||||||||||||| |||||||||||||| |||| ||||||| ||||| |||||
Sbjct: 311 atcacgcccatggacgccacgccgacgccgctcttcgccg-tcccgtacgccgcacccat 253

                               
Query: 709 gcatgagaagacgagggcgg 728
           ||||||||||| ||||||||
Sbjct: 252 gcatgagaagatgagggcgg 233



to top

>gb|U27098.1|OSU27098 Oryza sativa vacuolar H+-ATPase (vatp-P1) mRNA, complete cds
          Length = 915

 Score =  509 bits (257), Expect = e-141
 Identities = 395/440 (89%), Gaps = 1/440 (0%)
 Strand = Plus / Minus

                                                                       
Query: 289 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
           |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 612 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 553

                                                                       
Query: 349 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
           || ||||| |||||||||||||||||||| ||||||||||| |||||||| |||||||||
Sbjct: 552 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 493

                                                                       
Query: 409 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 468
           || || ||||| |||||||| |||||||||||||| ||||| |||||||| ||||| |||
Sbjct: 492 tgctgtgcatttgccctgacaccagcatcaccgacgatgccgatggccattccggcagcg 433

                                                                       
Query: 469 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 528
           || || ||||||||||||||||||||||| || ||||| ||||||||||| |||||| ||
Sbjct: 432 agaccggcgaggccacaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtag 373

                                                                       
Query: 529 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 588
           || ||||| |||||||| |||||||| || ||||||||||||||||||||||||||||||
Sbjct: 372 tacggcttagccttggggttgatccctgtactgatgatgacggcgatgatgaggccgtag 313

                                                                       
Query: 589 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 648
           || |||||||| || |||||||| |||||||||||||||||||| ||||||||||| |||
Sbjct: 312 ataccgagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 253

                                                                       
Query: 649 atgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccat 708
           || || |||||||||||||| |||||||||||||| |||| ||||||| ||||| |||||
Sbjct: 252 atcacgcccatggacgccacgccgacgccgctcttcgccg-tcccgtacgccgcacccat 194

                               
Query: 709 gcatgagaagacgagggcgg 728
           ||||||||||| ||||||||
Sbjct: 193 gcatgagaagatgagggcgg 174



to top

>gb|AF416606.1| Pennisetum glaucum vacuolar H+-ATPase 16 kDa proteolipid subunit c
           (VATPc) mRNA, complete cds
          Length = 833

 Score =  492 bits (248), Expect = e-136
 Identities = 395/443 (89%), Gaps = 1/443 (0%)
 Strand = Plus / Minus

                                                                       
Query: 287 gcgcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagac 346
           |||||||||| || ||||| ||||| |||||||| |||||||||||||||||||||||||
Sbjct: 540 gcgcctaatcggcacgggattggccagcacgggacgagaggatgatgcccacgatgagac 481

                                                                       
Query: 347 cgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttg 406
           |||| || || ||||| |||||||||||||||||||| ||||| ||||| || ||||| |
Sbjct: 480 cgtagagagcaagcgcctctgcgaaaatgagaatgagaatcattcccacaaatagcttcg 421

                                                                       
Query: 407 gttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcgg 466
           | ||||| || || |||||||||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 420 gctgttgtgcgtttgccctgactccagcgtcaccgacgatgccgatggccatgccagcgg 361

                                                                       
Query: 467 cgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagga 526
           | ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||| 
Sbjct: 360 caagccccgcgagaccacaagcgagcccagacgagaggtgcgcgtagccatcgaagaggt 301

                                                                       
Query: 527 agtagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgt 586
           |||| |||||||||||||| ||||||||||| |||||||||||||| |||||||| ||||
Sbjct: 300 agtatggcttggccttggggttgatcccggtactgatgatgacggcaatgatgagtccgt 241

                                                                       
Query: 587 agattccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggcc 646
           |||| |||||||| || |||||||| |||||||||||||||||||| |||||||||||||
Sbjct: 240 agataccgagcacaccagccatgaccacgggcacgatggacttcatcacgagctccggcc 181

                                                                       
Query: 647 gcatgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgccccc 706
           |||| || |||||||||||||| ||||| ||||||||||||| ||||||| ||||| |||
Sbjct: 180 gcatcacacccatggacgccacgccgacaccgctcttggccg-tcccgtaggccgcgccc 122

                                  
Query: 707 atgcatgagaagacgagggcggc 729
           |||||||||||||||||||||||
Sbjct: 121 atgcatgagaagacgagggcggc 99



to top

>dbj|AK119725.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-H04, full
           insert sequence
          Length = 1000

 Score =  486 bits (245), Expect = e-134
 Identities = 392/440 (89%), Gaps = 1/440 (0%)
 Strand = Plus / Minus

                                                                       
Query: 289 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
           ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || 
Sbjct: 699 gcctaatccgcacgagattggcctgcgcgggatgacaggatgatgccgacgatgagccca 640

                                                                       
Query: 349 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
           || || || |||||||| || |||||||| ||||||||||||||||||||||||||||||
Sbjct: 639 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 580

                                                                       
Query: 409 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 468
           || || || || ||||||||||| || ||||| || |||||||||||||| ||||| |||
Sbjct: 579 tgctgggcgttcgccctgactccggcgtcaccaacgatgccaatggccattccggcagcg 520

                                                                       
Query: 469 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 528
           || || ||||||||||||||||| || || ||||| || |||||||||||||||||| ||
Sbjct: 519 agaccggcgaggccacaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtag 460

                                                                       
Query: 529 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 588
           ||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 459 tagggcttggccttggggttgatccccgtgctgatgatgactgcgatgatgaggccgtag 400

                                                                       
Query: 589 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 648
           || || ||||| || |||||||| |||||||||||||||||||| ||||||||||| |||
Sbjct: 399 atacccagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 340

                                                                       
Query: 649 atgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccat 708
           || |||||||| ||||||||||||||||||||||| |||| ||||||| |||||||||||
Sbjct: 339 atcacccccatcgacgccaccccgacgccgctcttcgccg-tcccgtacgccgcccccat 281

                               
Query: 709 gcatgagaagacgagggcgg 728
           ||||||||||||||||||||
Sbjct: 280 gcatgagaagacgagggcgg 261



to top

>gb|AY106139.1| Zea mays PCO154307 mRNA sequence
          Length = 1097

 Score =  480 bits (242), Expect = e-132
 Identities = 392/441 (88%), Gaps = 1/441 (0%)
 Strand = Plus / Minus

                                                                       
Query: 289 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
           ||||| ||||| || ||||||||||| |||||||||||||||||||| ||||||||||||
Sbjct: 732 gcctagtccgcacgagactggccggcgcgggatgagaggatgatgccgacgatgagaccg 673

                                                                       
Query: 349 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
           || |||||||||||||| ||||| ||||| ||||||||||| ||||| ||||||||||| 
Sbjct: 672 tatagggcgagcgcttcagcgaagatgaggatgaggatcatgcccacaaacagctttggc 613

                                                                       
Query: 409 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 468
           || || || || |||||||| ||||||||||| || ||||||||||||||||| || || 
Sbjct: 612 tgctgagcgttcgccctgacaccagcatcaccaacgatgccaatggccatgcctgcagca 553

                                                                       
Query: 469 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 528
           ||||| || || |||||||| || ||||| || || ||||| |||||||| |||||| ||
Sbjct: 552 agcccagcaagaccacaggcaaggccggacgacaggtgggcatagccgtcaaagaggtag 493

                                                                       
Query: 529 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 588
           || |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 492 tatggcttggccttggggttgatcccagtgctgatgatgacggcgatgatgaggccgtag 433

                                                                       
Query: 589 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 648
           || |||||||| || |||||||| ||||||||||||||||||||||||||||| || |||
Sbjct: 432 ataccgagcacaccagccatgaccacgggcacgatggacttcatgacgagctctgggcgc 373

                                                                       
Query: 649 atgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccat 708
           ||||| |||||||||||||| |||||||| |||||||||| ||||||| |||||||||||
Sbjct: 372 atgacacccatggacgccacgccgacgccactcttggccg-tcccgtacgccgcccccat 314

                                
Query: 709 gcatgagaagacgagggcggc 729
           ||||||||| ||||| |||||
Sbjct: 313 gcatgagaaaacgagagcggc 293



to top

>dbj|AK104011.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-B07, full
           insert sequence
          Length = 1039

 Score =  478 bits (241), Expect = e-131
 Identities = 391/440 (88%), Gaps = 1/440 (0%)
 Strand = Plus / Minus

                                                                       
Query: 289 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
           ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || 
Sbjct: 742 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 683

                                                                       
Query: 349 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
           || || || |||||||| || |||||||| ||||||||||||||||||||||||||||||
Sbjct: 682 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 623

                                                                       
Query: 409 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 468
           || || || || ||||||||||| || ||||| || |||||||||||||| ||||| |||
Sbjct: 622 tgctgggcgttcgccctgactccggcgtcaccaacgatgccaatggccattccggcagcg 563

                                                                       
Query: 469 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 528
           || || ||||| ||||||||||| || || ||||| || |||||||||||||||||| ||
Sbjct: 562 agaccggcgagaccacaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtag 503

                                                                       
Query: 529 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 588
           ||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 502 tagggcttggccttggggttgatccccgtgctgatgatgactgcgatgatgaggccgtag 443

                                                                       
Query: 589 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 648
           || || ||||| || |||||||| |||||||||||||||||||| ||||||||||| |||
Sbjct: 442 atacccagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 383

                                                                       
Query: 649 atgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccat 708
           || |||||||| ||||||||||||||||||||||| |||| ||||||| |||||||||||
Sbjct: 382 atcacccccatcgacgccaccccgacgccgctcttcgccg-tcccgtacgccgcccccat 324

                               
Query: 709 gcatgagaagacgagggcgg 728
           ||||||||||||||||||||
Sbjct: 323 gcatgagaagacgagggcgg 304



to top

>dbj|AK071641.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023106A11, full
           insert sequence
          Length = 1081

 Score =  478 bits (241), Expect = e-131
 Identities = 391/440 (88%), Gaps = 1/440 (0%)
 Strand = Plus / Minus

                                                                       
Query: 289 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
           ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || 
Sbjct: 779 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 720

                                                                       
Query: 349 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
           || || || |||||||| || |||||||| ||||||||||||||||||||||||||||||
Sbjct: 719 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 660

                                                                       
Query: 409 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 468
           || || || || ||||||||||| || ||||| || |||||||||||||| ||||| |||
Sbjct: 659 tgctgggcgttcgccctgactccggcgtcaccaacgatgccaatggccattccggcagcg 600

                                                                       
Query: 469 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 528
           || || ||||| ||||||||||| || || ||||| || |||||||||||||||||| ||
Sbjct: 599 agaccggcgagaccacaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtag 540

                                                                       
Query: 529 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 588
           ||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 539 tagggcttggccttggggttgatccccgtgctgatgatgactgcgatgatgaggccgtag 480

                                                                       
Query: 589 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 648
           || || ||||| || |||||||| |||||||||||||||||||| ||||||||||| |||
Sbjct: 479 atacccagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 420

                                                                       
Query: 649 atgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccat 708
           || |||||||| ||||||||||||||||||||||| |||| ||||||| |||||||||||
Sbjct: 419 atcacccccatcgacgccaccccgacgccgctcttcgccg-tcccgtacgccgcccccat 361

                               
Query: 709 gcatgagaagacgagggcgg 728
           ||||||||||||||||||||
Sbjct: 360 gcatgagaagacgagggcgg 341



to top

>gb|M73232.1|ASTATPASEH Avena sativa vacuolar H+-ATPase 16 kDa proteolipid subunit
           (vatp-P1) mRNA, complete cds
          Length = 821

 Score =  476 bits (240), Expect = e-131
 Identities = 387/435 (88%), Gaps = 1/435 (0%)
 Strand = Plus / Minus

                                                                       
Query: 289 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
           |||||||| || ||||| ||||| || |||||||| ||||||||||| || ||||| || 
Sbjct: 627 gcctaatcggcacgggattggccagctcgggatgataggatgatgccgacaatgaggcca 568

                                                                       
Query: 349 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
           || || |||||||| |||||||| ||||| ||||||||||| || || |||| ||| || 
Sbjct: 567 tacagagcgagcgcctctgcgaagatgaggatgaggatcatgccaacaaacaacttcggc 508

                                                                       
Query: 409 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 468
           || || ||||| |||||||||||||||||||| || ||||| |||||||| || || || 
Sbjct: 507 tgctgagcatttgccctgactccagcatcaccaacgatgccgatggccattccagcagca 448

                                                                       
Query: 469 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 528
           ||||| ||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 447 agcccggcgaggccacatgcgagcccggatgagaggtgggcgtagccgtcgaagaggaag 388

                                                                       
Query: 529 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 588
           ||||||||||||||||| ||||||||||| ||||||||||||||||| ||||| ||||||
Sbjct: 387 tagggcttggccttggggttgatcccggtactgatgatgacggcgataatgagcccgtag 328

                                                                       
Query: 589 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 648
           || |||||||| || ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 327 ataccgagcacaccagccatgacgacgggcacgatggacttcatgacgagctccgggcgc 268

                                                                       
Query: 649 atgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccat 708
           ||||| ||||| |||||||| ||||||||||||||||||| ||||||| |||||||||||
Sbjct: 267 atgactcccatagacgccacgccgacgccgctcttggccg-tcccgtaggccgcccccat 209

                          
Query: 709 gcatgagaagacgag 723
           |||||||||||||||
Sbjct: 208 gcatgagaagacgag 194



to top

>ref|XM_466150.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 883

 Score =  440 bits (222), Expect = e-120
 Identities = 378/429 (88%), Gaps = 1/429 (0%)
 Strand = Plus / Minus

                                                                       
Query: 295 tccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagg 354
           ||||| ||||| || || ||||| ||||| | |||||| || || |||||||| || || 
Sbjct: 632 tccgctcgggattgaccagcacgagatgacaagatgataccaacaatgagaccatagagt 573

                                                                       
Query: 355 gcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgc 414
           || |||||||| || || || || ||||||||||||||||| ||||| ||||| ||||| 
Sbjct: 572 gcaagcgcttccgcaaagataaggatgaggatcatacccacaaacagttttggctgttga 513

                                                                       
Query: 415 gcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagcccc 474
           ||||| |||||||| || || || ||||| ||||| |||||||| ||||||||||| || 
Sbjct: 512 gcatttgccctgacgccggcgtcgccgacgatgccgatggccatcccggcggcgaggccg 453

                                                                       
Query: 475 gcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggc 534
           |||||||| || ||||| ||||||||||| || |||||||||||||||||||||||||||
Sbjct: 452 gcgaggccgcacgcgaggccggaggagaggtgcgcgtagccgtcgaagaggaagtagggc 393

                                                                       
Query: 535 ttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccg 594
           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 392 ttggccttggggttgatcccggtgctgatgatgacggcgatgatgaggccgtagatcccg 333

                                                                       
Query: 595 agcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacc 654
           ||||| || ||||||||||||||||||||||| ||||||||||||||||| |||||||| 
Sbjct: 332 agcaccccggccatgacgacgggcacgatggatttcatgacgagctccgggcgcatgacg 273

                                                                       
Query: 655 cccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgcatga 714
           |||||||||||||||||||||||||||||||||| | ||||| || || |||||||| ||
Sbjct: 272 cccatggacgccaccccgacgccgctcttggccg-tgccgtaggcggcgcccatgcagga 214

                    
Query: 715 gaagacgag 723
           |||||||||
Sbjct: 213 gaagacgag 205



to top

>gb|AF286464.1|AF286464 Porteresia coarctata V-ATPase subunit c (PVA1) mRNA, complete cds
          Length = 876

 Score =  440 bits (222), Expect = e-120
 Identities = 390/445 (87%), Gaps = 1/445 (0%)
 Strand = Plus / Minus

                                                                       
Query: 282 gcaaggcgcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgat 341
           |||||| || ||||| || ||||| || || |||||||||||||||||||||||||| ||
Sbjct: 578 gcaaggtgcttaatctgcacgggattgaccagcacgggatgagaggatgatgcccacaat 519

                                                                       
Query: 342 gagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||||| || || || || ||||| ||||||||||| ||||||||||| |||||||| ||
Sbjct: 518 gagaccatacagagcaagagcttcagcgaaaatgaggatgaggatcatgcccacgaaaag 459

                                                                       
Query: 402 ctttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgcc 461
           |||||||||||| ||||| ||||| || |||||||||||||| ||||| |||||||||||
Sbjct: 458 ctttggttgttgtgcatttgccctaacaccagcatcaccgacgatgccgatggccatgcc 399

                                                                       
Query: 462 ggcggcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaa 521
            |||||||| || || ||||||||||| ||||| ||||||||||| ||||| || |||||
Sbjct: 398 tgcggcgagaccagcaaggccacaggcaagccctgaggagagatgcgcgtatccatcgaa 339

                                                                       
Query: 522 gaggaagtagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgag 581
           |||| |||| ||||| |||||||| || |||||||| |||||||||||||| ||||| ||
Sbjct: 338 gaggtagtacggcttcgccttggggttaatcccggtactgatgatgacggcaatgataag 279

                                                                       
Query: 582 gccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctc 641
            |||||||| |||||||| || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 278 cccgtagataccgagcacaccagccatgacgactggcacgatggacttcatgacgagctc 219

                                                                       
Query: 642 cggccgcatgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccg 701
            || ||||| || |||||||||||||| |||||||| ||||| |||| ||||||| || |
Sbjct: 218 ggggcgcatcacacccatggacgccacgccgacgccactcttcgccg-tcccgtacgctg 160

                                    
Query: 702 cccccatgcatgagaagacgagggc 726
           |||||||||||||||||||||||||
Sbjct: 159 cccccatgcatgagaagacgagggc 135



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 58/66 (87%), Gaps = 2/66 (3%)
 Strand = Plus / Minus

                                                                       
Query: 42  tttattcaccaccaataggattaaaacccatattcccaggagcagc-aatccagcctacc 100
           |||||||||||| ||||||||| ||| |||| | | |||||||||| ||||||||||| |
Sbjct: 799 tttattcaccacgaataggatt-aaatccatttgctcaggagcagcaaatccagcctaac 741

                 
Query: 101 ccaaaa 106
           ||||||
Sbjct: 740 ccaaaa 735



to top

>gb|AY106384.1| Zea mays PCO086002 mRNA sequence
          Length = 924

 Score =  436 bits (220), Expect = e-119
 Identities = 385/439 (87%), Gaps = 1/439 (0%)
 Strand = Plus / Minus

                                                                       
Query: 291 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 350
           |||||| ||||| || ||||| |||||||||||||| ||||| || ||||||||||||||
Sbjct: 673 ctaatcggcgcgagattggcctgcacgggatgagagaatgataccgacgatgagaccgta 614

                                                                       
Query: 351 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 410
            || || || ||||||||||| || || || || ||||| ||||| |||| |||||| ||
Sbjct: 613 cagagcaagagcttctgcgaagataaggatcagaatcatgcccacaaacaactttggctg 554

                                                                       
Query: 411 ttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgag 470
            || ||||| ||||| ||||| || || ||||| ||||| |||||||||||||| |||||
Sbjct: 553 ctgtgcattcgccctaactccggcgtctccgacgatgccgatggccatgccggcagcgag 494

                                                                       
Query: 471 ccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagta 530
            || |||||||| |||||||| ||||||||||| || |||||||||||||||||||||||
Sbjct: 493 gccagcgaggccgcaggcgagtccggaggagaggtgcgcgtagccgtcgaagaggaagta 434

                                                                       
Query: 531 gggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagat 590
           ||||||||||||||| ||||||||||||  ||||||||||||||||||||||||||||||
Sbjct: 433 gggcttggccttggggttgatcccggtggagatgatgacggcgatgatgaggccgtagat 374

                                                                       
Query: 591 tccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
            ||||| |||||||||||||||||||| ||||||||||||||||||||||| || |||||
Sbjct: 373 gccgagtactcccgccatgacgacggggacgatggacttcatgacgagctcggggcgcat 314

                                                                       
Query: 651 gacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
           ||| |||||||| || || ||||||||||||||||||| ||||||| || || |||||||
Sbjct: 313 gacgcccatggaggcgacgccgacgccgctcttggccg-tcccgtaggcggcgcccatgc 255

                              
Query: 711 atgagaagacgagggcggc 729
           | ||||||||||| |||||
Sbjct: 254 aggagaagacgagcgcggc 236



to top

>gb|BT017938.1| Zea mays clone EL01N0520G10.c mRNA sequence
          Length = 983

 Score =  434 bits (219), Expect = e-118
 Identities = 384/438 (87%), Gaps = 1/438 (0%)
 Strand = Plus / Minus

                                                                       
Query: 292 taatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaa 351
           ||||| || ||||| || || ||||||||||| ||||| || || || ||||||||||| 
Sbjct: 646 taatctgcccgggattgaccagcacgggatgaaaggataattccaacaatgagaccgtac 587

                                                                       
Query: 352 agggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgt 411
           || || |||||||||||||||||||| ||||||||||| ||||| || ||||| || |||
Sbjct: 586 agagcaagcgcttctgcgaaaatgaggatgaggatcatgcccacaaaaagcttcggctgt 527

                                                                       
Query: 412 tgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagc 471
           || ||||| |||||||||||||||||||| |||||||| ||||||||||| || || |||
Sbjct: 526 tgtgcattcgccctgactccagcatcaccaacaatgccgatggccatgccagctgcaagc 467

                                                                       
Query: 472 cccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtag 531
           || || ||||||||||| |||||||| || || || |||||||| || || ||| |||||
Sbjct: 466 ccagcaaggccacaggcaagcccggacgaaaggtgagcgtagccatcaaaaaggtagtag 407

                                                                       
Query: 532 ggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagatt 591
           |||||||||||||| |||||||| |||||||||||||||||||||||||| |||||||| 
Sbjct: 406 ggcttggccttggggttgatcccagtgctgatgatgacggcgatgatgagcccgtagata 347

                                                                       
Query: 592 ccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatg 651
           |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||| 
Sbjct: 346 ccgagcacaccagccatgaccacgggcacgatggacttcatgacgagctccggccgcatc 287

                                                                       
Query: 652 acccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgca 711
           || ||||| |||||||| |||||||||||||| | || ||||||| || || ||||||||
Sbjct: 286 acacccatcgacgccacgccgacgccgctcttcg-cggtcccgtacgctgcgcccatgca 228

                             
Query: 712 tgagaagacgagggcggc 729
           ||||||||||||||||||
Sbjct: 227 tgagaagacgagggcggc 210



to top

>dbj|AK099459.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013023C24, full
           insert sequence
          Length = 883

 Score =  432 bits (218), Expect = e-118
 Identities = 377/429 (87%), Gaps = 1/429 (0%)
 Strand = Plus / Minus

                                                                       
Query: 295 tccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagg 354
           ||||| ||||| || || ||||| ||||| | |||||| || || |||||||| || || 
Sbjct: 632 tccgctcgggattgaccagcacgagatgacaagatgataccaacaatgagaccatagagt 573

                                                                       
Query: 355 gcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgc 414
           || |||||||| || || || || ||||||||||||||||| ||||| ||||| ||||| 
Sbjct: 572 gcaagcgcttccgcaaagataaggatgaggatcatacccacaaacagttttggctgttga 513

                                                                       
Query: 415 gcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagcccc 474
           ||||| |||||||| || || || ||||| |||||  ||||||| ||||||||||| || 
Sbjct: 512 gcatttgccctgacgccggcgtcgccgacgatgccgttggccatcccggcggcgaggccg 453

                                                                       
Query: 475 gcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggc 534
           |||||||| || ||||| ||||||||||| || |||||||||||||||||||||||||||
Sbjct: 452 gcgaggccgcacgcgaggccggaggagaggtgcgcgtagccgtcgaagaggaagtagggc 393

                                                                       
Query: 535 ttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccg 594
           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 392 ttggccttggggttgatcccggtgctgatgatgacggcgatgatgaggccgtagatcccg 333

                                                                       
Query: 595 agcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacc 654
           ||||| || ||||||||||||||||||||||| ||||||||||||||||| |||||||| 
Sbjct: 332 agcaccccggccatgacgacgggcacgatggatttcatgacgagctccgggcgcatgacg 273

                                                                       
Query: 655 cccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgcatga 714
           |||||||||||||||||||||||||||||||||| | ||||| || || |||||||| ||
Sbjct: 272 cccatggacgccaccccgacgccgctcttggccg-tgccgtaggcggcgcccatgcagga 214

                    
Query: 715 gaagacgag 723
           |||||||||
Sbjct: 213 gaagacgag 205



to top

>gb|BT017156.1| Zea mays clone EL01N0367F12.c mRNA sequence
          Length = 992

 Score =  408 bits (206), Expect = e-110
 Identities = 377/433 (87%), Gaps = 1/433 (0%)
 Strand = Plus / Minus

                                                                       
Query: 291 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 350
           |||||| |||||||||||||||||||| || |||||||| ||||| ||||||||||| ||
Sbjct: 597 ctaatctgcgcgggactggccggcacgagacgagaggataatgccgacgatgagaccata 538

                                                                       
Query: 351 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 410
            ||||| |||||||| || ||||| || ||||||||||| || || |||| ||| || ||
Sbjct: 537 gagggcaagcgcttcagcaaaaataaggatgaggatcatgccaacaaacaacttcggctg 478

                                                                       
Query: 411 ttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgag 470
            || || || |||||||| ||||||||||| || ||||||||||||||||| || || ||
Sbjct: 477 ctgagcgttcgccctgacaccagcatcaccaacgatgccaatggccatgcctgcagcaag 418

                                                                       
Query: 471 ccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagta 530
           ||| || || |||||||| || || || || || ||||| |||||||| |||||| ||||
Sbjct: 417 cccagcaagaccacaggcaaggccagacgacaggtgggcatagccgtcaaagaggtagta 358

                                                                       
Query: 531 gggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagat 590
            |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 357 tggcttggccttggggttgatcccagtgctgatgatgacggcgatgatgaggccgtagat 298

                                                                       
Query: 591 tccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
            |||||||| || |||||||| ||||||||||||||||||||||||||||| || |||||
Sbjct: 297 accgagcacaccagccatgaccacgggcacgatggacttcatgacgagctctgggcgcat 238

                                                                       
Query: 651 gacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
           ||| |||||||||||||| || ||||| |||||||| | ||||||| |||||||||||||
Sbjct: 237 gacacccatggacgccacgccaacgccactcttggctg-tcccgtacgccgcccccatgc 179

                        
Query: 711 atgagaagacgag 723
           |||||||||||||
Sbjct: 178 atgagaagacgag 166



to top

>dbj|AK063178.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-112-A08, full
           insert sequence
          Length = 853

 Score =  402 bits (203), Expect = e-109
 Identities = 380/438 (86%), Gaps = 1/438 (0%)
 Strand = Plus / Minus

                                                                       
Query: 291 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 350
           ||||||||| || || ||||| ||||| || ||||||||||| || || || || || ||
Sbjct: 601 ctaatccgctcgagattggcccgcacgagacgagaggatgataccaacaatcaggccata 542

                                                                       
Query: 351 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 410
            || || || |||||||| || || || ||||||||||| |||||||||| |||||| ||
Sbjct: 541 cagagcaagagcttctgcaaagataaggatgaggatcatgcccacgaacaactttggctg 482

                                                                       
Query: 411 ttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgag 470
            |||||||| ||||||||||| || || ||||| ||||| ||||||||||||||||||||
Sbjct: 481 ctgcgcattggccctgactccggcgtcgccgacgatgccgatggccatgccggcggcgag 422

                                                                       
Query: 471 ccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagta 530
            || |||||||| |||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 421 accggcgaggccgcaggcgagaccggaggagaggtgggcgtaaccgtcgaagaggaagta 362

                                                                       
Query: 531 gggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagat 590
           ||||||||||||||| ||||| ||||||  ||||||||||||||||||||||||||||||
Sbjct: 361 gggcttggccttggggttgatgccggtggagatgatgacggcgatgatgaggccgtagat 302

                                                                       
Query: 591 tccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
            ||||||||||| |||||||||||||| |||||||||||||| || || ||||| |||||
Sbjct: 301 accgagcactccggccatgacgacggggacgatggacttcatcaccagttccgggcgcat 242

                                                                       
Query: 651 gacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
            ||||||||||||||||| || ||||||||||||| || | ||||| || || |||||||
Sbjct: 241 cacccccatggacgccacgcccacgccgctcttgg-cggtgccgtaggcggcgcccatgc 183

                             
Query: 711 atgagaagacgagggcgg 728
           | ||||| ||||||||||
Sbjct: 182 aggagaatacgagggcgg 165



to top

>gb|BT017861.1| Zea mays clone EL01N0511G07.c mRNA sequence
          Length = 1094

 Score =  392 bits (198), Expect = e-106
 Identities = 375/433 (86%), Gaps = 1/433 (0%)
 Strand = Plus / Minus

                                                                       
Query: 291 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 350
           |||||| |||||||||||||||||||| || |||||||| ||||| ||||||||||| ||
Sbjct: 681 ctaatctgcgcgggactggccggcacgagacgagaggataatgccgacgatgagaccata 622

                                                                       
Query: 351 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 410
            ||||| |||||||| || ||||| || ||||||||||| || || |||| ||| || ||
Sbjct: 621 gagggcaagcgcttcagcaaaaataaggatgaggatcatgccaacaaacaacttcggctg 562

                                                                       
Query: 411 ttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgag 470
            || || || |||||||| ||||||||||| || ||||||||||||||||| || || ||
Sbjct: 561 ctgagcgttcgccctgacaccagcatcaccaacgatgccaatggccatgcctgcagcaag 502

                                                                       
Query: 471 ccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagta 530
           ||| || || |||||||| || || || || || ||||| |||||||| |||||| ||||
Sbjct: 501 cccagcaagaccacaggcaaggccagacgacaggtgggcatagccgtcaaagaggtagta 442

                                                                       
Query: 531 gggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagat 590
            |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 441 tggcttggccttggggttgatcccagtgctgatgatgacggcgatgatgaggccgtagat 382

                                                                       
Query: 591 tccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
            |||||||| || |||||||| ||||||||||||||||||||||||||||| || |||||
Sbjct: 381 accgagcacaccagccatgaccacgggcacgatggacttcatgacgagctctgggcgcat 322

                                                                       
Query: 651 gacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
           ||| |||||||||||||| || ||||| ||||| | |  ||||||| |||||||||||||
Sbjct: 321 gacacccatggacgccacgccaacgccactctt-gactatcccgtacgccgcccccatgc 263

                        
Query: 711 atgagaagacgag 723
           |||||||||||||
Sbjct: 262 atgagaagacgag 250



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  377 bits (190), Expect = e-101
 Identities = 262/285 (91%), Gaps = 1/285 (0%)
 Strand = Plus / Plus

                                                                            
Query: 439      ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 498
                ||||| ||||| |||||||| ||||||||||| || |||||||| || ||||| ||||||
Sbjct: 20706700 ccgacgatgccgatggccatcccggcggcgaggccggcgaggccgcacgcgaggccggag 20706759

                                                                            
Query: 499      gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 558
                ||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 20706760 gagaggtgcgcgtagccgtcgaagaggaagtagggcttggccttggggttgatcccggtg 20706819

                                                                            
Query: 559      ctgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggc 618
                |||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||
Sbjct: 20706820 ctgatgatgacggcgatgatgaggccgtagatcccgagcaccccggccatgacgacgggc 20706879

                                                                            
Query: 619      acgatggacttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccg 678
                |||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 20706880 acgatggatttcatgacgagctccgggcgcatgacgcccatggacgccaccccgacgccg 20706939

                                                             
Query: 679      ctcttggccgttcccgtangccgcccccatgcatgagaagacgag 723
                |||||||||| | ||||| || || |||||||| |||||||||||
Sbjct: 20706940 ctcttggccg-tgccgtaggcggcgcccatgcaggagaagacgag 20706983



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 109/133 (81%)
 Strand = Plus / Plus

                                                                            
Query: 295      tccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagg 354
                ||||| ||||| || || ||||| ||||| | |||||| || || |||||||| || || 
Sbjct: 20705311 tccgctcgggattgaccagcacgagatgacaagatgataccaacaatgagaccatagagt 20705370

                                                                            
Query: 355      gcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgc 414
                || |||||||| || || || || ||||||||||||||||| ||||| ||||| ||||| 
Sbjct: 20705371 gcaagcgcttccgcaaagataaggatgaggatcatacccacaaacagttttggctgttga 20705430

                             
Query: 415      gcattagccctga 427
                ||||| |||||||
Sbjct: 20705431 gcatttgccctga 20705443



to top

>dbj|AP004775.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0451A10
          Length = 137046

 Score =  377 bits (190), Expect = e-101
 Identities = 262/285 (91%), Gaps = 1/285 (0%)
 Strand = Plus / Plus

                                                                         
Query: 439   ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 498
             ||||| ||||| |||||||| ||||||||||| || |||||||| || ||||| ||||||
Sbjct: 57806 ccgacgatgccgatggccatcccggcggcgaggccggcgaggccgcacgcgaggccggag 57865

                                                                         
Query: 499   gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 558
             ||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 57866 gagaggtgcgcgtagccgtcgaagaggaagtagggcttggccttggggttgatcccggtg 57925

                                                                         
Query: 559   ctgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggc 618
             |||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||
Sbjct: 57926 ctgatgatgacggcgatgatgaggccgtagatcccgagcaccccggccatgacgacgggc 57985

                                                                         
Query: 619   acgatggacttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccg 678
             |||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 57986 acgatggatttcatgacgagctccgggcgcatgacgcccatggacgccaccccgacgccg 58045

                                                          
Query: 679   ctcttggccgttcccgtangccgcccccatgcatgagaagacgag 723
             |||||||||| | ||||| || || |||||||| |||||||||||
Sbjct: 58046 ctcttggccg-tgccgtaggcggcgcccatgcaggagaagacgag 58089



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 109/133 (81%)
 Strand = Plus / Plus

                                                                         
Query: 295   tccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagg 354
             ||||| ||||| || || ||||| ||||| | |||||| || || |||||||| || || 
Sbjct: 56417 tccgctcgggattgaccagcacgagatgacaagatgataccaacaatgagaccatagagt 56476

                                                                         
Query: 355   gcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgc 414
             || |||||||| || || || || ||||||||||||||||| ||||| ||||| ||||| 
Sbjct: 56477 gcaagcgcttccgcaaagataaggatgaggatcatacccacaaacagttttggctgttga 56536

                          
Query: 415   gcattagccctga 427
             ||||| |||||||
Sbjct: 56537 gcatttgccctga 56549



to top

>dbj|AP005469.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0040I22
          Length = 134273

 Score =  377 bits (190), Expect = e-101
 Identities = 262/285 (91%), Gaps = 1/285 (0%)
 Strand = Plus / Plus

                                                                          
Query: 439    ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 498
              ||||| ||||| |||||||| ||||||||||| || |||||||| || ||||| ||||||
Sbjct: 103555 ccgacgatgccgatggccatcccggcggcgaggccggcgaggccgcacgcgaggccggag 103614

                                                                          
Query: 499    gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 558
              ||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 103615 gagaggtgcgcgtagccgtcgaagaggaagtagggcttggccttggggttgatcccggtg 103674

                                                                          
Query: 559    ctgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggc 618
              |||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||
Sbjct: 103675 ctgatgatgacggcgatgatgaggccgtagatcccgagcaccccggccatgacgacgggc 103734

                                                                          
Query: 619    acgatggacttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccg 678
              |||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 103735 acgatggatttcatgacgagctccgggcgcatgacgcccatggacgccaccccgacgccg 103794

                                                           
Query: 679    ctcttggccgttcccgtangccgcccccatgcatgagaagacgag 723
              |||||||||| | ||||| || || |||||||| |||||||||||
Sbjct: 103795 ctcttggccg-tgccgtaggcggcgcccatgcaggagaagacgag 103838



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 109/133 (81%)
 Strand = Plus / Plus

                                                                          
Query: 295    tccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagg 354
              ||||| ||||| || || ||||| ||||| | |||||| || || |||||||| || || 
Sbjct: 102166 tccgctcgggattgaccagcacgagatgacaagatgataccaacaatgagaccatagagt 102225

                                                                          
Query: 355    gcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgc 414
              || |||||||| || || || || ||||||||||||||||| ||||| ||||| ||||| 
Sbjct: 102226 gcaagcgcttccgcaaagataaggatgaggatcatacccacaaacagttttggctgttga 102285

                           
Query: 415    gcattagccctga 427
              ||||| |||||||
Sbjct: 102286 gcatttgccctga 102298



to top

>gb|AC147812.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0073K23 map near R10571S, complete sequence
          Length = 161073

 Score =  327 bits (165), Expect = 3e-86
 Identities = 258/288 (89%), Gaps = 1/288 (0%)
 Strand = Plus / Minus

                                                                         
Query: 423   cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
             |||||| |||||||||||||| ||||| |||||||| ||||| ||||| || ||||||||
Sbjct: 54434 cctgacaccagcatcaccgacgatgccgatggccattccggcagcgagaccggcgaggcc 54375

                                                                         
Query: 483   acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
             ||||||||||||||| || ||||| ||||||||||| |||||| |||| ||||| |||||
Sbjct: 54374 acaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtagtacggcttagcctt 54315

                                                                         
Query: 543   gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 602
             ||| |||||||| || |||||||||||||||||||||||||||||||| |||||||| ||
Sbjct: 54314 ggggttgatccctgtactgatgatgacggcgatgatgaggccgtagataccgagcacacc 54255

                                                                         
Query: 603   cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 662
              |||||||| |||||||||||||||||||| ||||||||||| ||||| || ||||||||
Sbjct: 54254 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacgcccatgga 54195

                                                             
Query: 663   cgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
             |||||| |||||||||||||| |||| ||||||| ||||| |||||||
Sbjct: 54194 cgccacgccgacgccgctcttcgccg-tcccgtacgccgcacccatgc 54148



 Score =  163 bits (82), Expect = 1e-36
 Identities = 124/138 (89%)
 Strand = Plus / Minus

                                                                         
Query: 289   gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
             |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 55510 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 55451

                                                                         
Query: 349   taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
             || ||||| |||||||||||||||||||| ||||||||||| |||||||| |||||||||
Sbjct: 55450 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 55391

                               
Query: 409   tgttgcgcattagccctg 426
             || || ||||| ||||||
Sbjct: 55390 tgctgtgcatttgccctg 55373



to top

>gb|AY620961.1| Pennisetum glaucum vacuolar ATPase subunit c isoform gene, promoter
            region and complete cds
          Length = 3305

 Score =  327 bits (165), Expect = 3e-86
 Identities = 258/288 (89%), Gaps = 1/288 (0%)
 Strand = Plus / Minus

                                                                        
Query: 423  cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
            |||||||||||| |||||||| ||||||||||||||||| ||||| ||||||||||| ||
Sbjct: 2144 cctgactccagcgtcaccgacgatgccaatggccatgccagcggcaagccccgcgagtcc 2085

                                                                        
Query: 483  acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
            ||| |||||||| || ||||| || |||||||| ||||||||| |||| |||||||||||
Sbjct: 2084 acaagcgagcccagacgagaggtgcgcgtagccatcgaagaggtagtatggcttggcctt 2025

                                                                        
Query: 543  gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 602
            ||| ||||| ||||| |||||||||||||| |||||||| |||||||| |||||||| ||
Sbjct: 2024 ggggttgattccggtactgatgatgacggcaatgatgagtccgtagataccgagcacacc 1965

                                                                        
Query: 603  cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 662
             |||||||| |||||||||||||||||||| ||||||||||||||||| || ||||||||
Sbjct: 1964 agccatgaccacgggcacgatggacttcatcacgagctccggccgcatcacacccatgga 1905

                                                            
Query: 663  cgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
            |||||| ||||| ||||||||||||| ||||||| ||||| |||||||
Sbjct: 1904 cgccacgccgacaccgctcttggccg-tcccgtaggccgcgcccatgc 1858



 Score =  137 bits (69), Expect = 6e-29
 Identities = 123/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 287  gcgcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagac 346
            |||||||||| || ||||| ||||| |||||||| |||||||||||||||||||||||||
Sbjct: 3276 gcgcctaatcggcacgggattggccagcacgggacgagaggatgatgcccacgatgagac 3217

                                                                        
Query: 347  cgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttg 406
            |||| || || ||||| |||||||||||||||||||| ||||| ||||| || ||||| |
Sbjct: 3216 cgtagagagcaagcgcctctgcgaaaatgagaatgagaatcattcccacaaatagcttcg 3157

                                 
Query: 407  gttgttgcgcattagccctga 427
            | ||||| || || |||||||
Sbjct: 3156 gctgttgtgcgtttgccctga 3136



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  327 bits (165), Expect = 3e-86
 Identities = 258/288 (89%), Gaps = 1/288 (0%)
 Strand = Plus / Plus

                                                                           
Query: 423     cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
               ||||||||| || ||||| || |||||||||||||| ||||| ||||| || ||||| ||
Sbjct: 3500503 cctgactccggcgtcaccaacgatgccaatggccattccggcagcgagaccggcgagacc 3500562

                                                                           
Query: 483     acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
               ||||||||| || || ||||| || |||||||||||||||||| ||||||||||||||||
Sbjct: 3500563 acaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtagtagggcttggcctt 3500622

                                                                           
Query: 543     gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 602
               ||| |||||||| |||||||||||||| |||||||||||||||||||| || ||||| ||
Sbjct: 3500623 ggggttgatccccgtgctgatgatgactgcgatgatgaggccgtagatacccagcacacc 3500682

                                                                           
Query: 603     cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 662
                |||||||| |||||||||||||||||||| ||||||||||| ||||| |||||||| ||
Sbjct: 3500683 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacccccatcga 3500742

                                                               
Query: 663     cgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
               ||||||||||||||||||||| |||| ||||||| |||||||||||||
Sbjct: 3500743 cgccaccccgacgccgctcttcgccg-tcccgtacgccgcccccatgc 3500789



 Score =  125 bits (63), Expect = 2e-25
 Identities = 120/139 (86%)
 Strand = Plus / Plus

                                                                           
Query: 289     gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
               ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || 
Sbjct: 3498846 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 3498905

                                                                           
Query: 349     taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
               || || || |||||||| || |||||||| ||||||||||||||||||||||||||||||
Sbjct: 3498906 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 3498965

                                  
Query: 409     tgttgcgcattagccctga 427
               || || || || |||||||
Sbjct: 3498966 tgctgggcgttcgccctga 3498984



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  327 bits (165), Expect = 3e-86
 Identities = 258/288 (89%), Gaps = 1/288 (0%)
 Strand = Plus / Plus

                                                                           
Query: 423     cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
               |||||| |||||||||||||| ||||| |||||||| ||||| ||||| || ||||||||
Sbjct: 3359860 cctgacaccagcatcaccgacgatgccgatggccattccggcagcgagaccggcgaggcc 3359919

                                                                           
Query: 483     acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
               ||||||||||||||| || ||||| ||||||||||| |||||| |||| ||||| |||||
Sbjct: 3359920 acaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtagtacggcttagcctt 3359979

                                                                           
Query: 543     gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 602
               ||| |||||||| || |||||||||||||||||||||||||||||||| |||||||| ||
Sbjct: 3359980 ggggttgatccctgtactgatgatgacggcgatgatgaggccgtagataccgagcacacc 3360039

                                                                           
Query: 603     cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 662
                |||||||| |||||||||||||||||||| ||||||||||| ||||| || ||||||||
Sbjct: 3360040 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacgcccatgga 3360099

                                                               
Query: 663     cgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
               |||||| |||||||||||||| |||| ||||||| ||||| |||||||
Sbjct: 3360100 cgccacgccgacgccgctcttcgccg-tcccgtacgccgcacccatgc 3360146



 Score =  163 bits (82), Expect = 1e-36
 Identities = 124/138 (89%)
 Strand = Plus / Plus

                                                                           
Query: 289     gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
               |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 3358784 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 3358843

                                                                           
Query: 349     taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
               || ||||| |||||||||||||||||||| ||||||||||| |||||||| |||||||||
Sbjct: 3358844 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 3358903

                                 
Query: 409     tgttgcgcattagccctg 426
               || || ||||| ||||||
Sbjct: 3358904 tgctgtgcatttgccctg 3358921



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  327 bits (165), Expect = 3e-86
 Identities = 258/288 (89%), Gaps = 1/288 (0%)
 Strand = Plus / Plus

                                                                           
Query: 423     cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
               |||||| |||||||||||||| ||||| |||||||| ||||| ||||| || ||||||||
Sbjct: 3368565 cctgacaccagcatcaccgacgatgccgatggccattccggcagcgagaccggcgaggcc 3368624

                                                                           
Query: 483     acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
               ||||||||||||||| || ||||| ||||||||||| |||||| |||| ||||| |||||
Sbjct: 3368625 acaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtagtacggcttagcctt 3368684

                                                                           
Query: 543     gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 602
               ||| |||||||| || |||||||||||||||||||||||||||||||| |||||||| ||
Sbjct: 3368685 ggggttgatccctgtactgatgatgacggcgatgatgaggccgtagataccgagcacacc 3368744

                                                                           
Query: 603     cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 662
                |||||||| |||||||||||||||||||| ||||||||||| ||||| || ||||||||
Sbjct: 3368745 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacgcccatgga 3368804

                                                               
Query: 663     cgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
               |||||| |||||||||||||| |||| ||||||| ||||| |||||||
Sbjct: 3368805 cgccacgccgacgccgctcttcgccg-tcccgtacgccgcacccatgc 3368851



 Score =  163 bits (82), Expect = 1e-36
 Identities = 124/138 (89%)
 Strand = Plus / Plus

                                                                           
Query: 289     gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
               |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 3367489 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 3367548

                                                                           
Query: 349     taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
               || ||||| |||||||||||||||||||| ||||||||||| |||||||| |||||||||
Sbjct: 3367549 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 3367608

                                 
Query: 409     tgttgcgcattagccctg 426
               || || ||||| ||||||
Sbjct: 3367609 tgctgtgcatttgccctg 3367626



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  327 bits (165), Expect = 3e-86
 Identities = 258/288 (89%), Gaps = 1/288 (0%)
 Strand = Plus / Plus

                                                                           
Query: 423     cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
               ||||||||| || ||||| || |||||||||||||| ||||| ||||| || ||||| ||
Sbjct: 3500448 cctgactccggcgtcaccaacgatgccaatggccattccggcagcgagaccggcgagacc 3500507

                                                                           
Query: 483     acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
               ||||||||| || || ||||| || |||||||||||||||||| ||||||||||||||||
Sbjct: 3500508 acaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtagtagggcttggcctt 3500567

                                                                           
Query: 543     gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 602
               ||| |||||||| |||||||||||||| |||||||||||||||||||| || ||||| ||
Sbjct: 3500568 ggggttgatccccgtgctgatgatgactgcgatgatgaggccgtagatacccagcacacc 3500627

                                                                           
Query: 603     cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 662
                |||||||| |||||||||||||||||||| ||||||||||| ||||| |||||||| ||
Sbjct: 3500628 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacccccatcga 3500687

                                                               
Query: 663     cgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
               ||||||||||||||||||||| |||| ||||||| |||||||||||||
Sbjct: 3500688 cgccaccccgacgccgctcttcgccg-tcccgtacgccgcccccatgc 3500734



 Score =  125 bits (63), Expect = 2e-25
 Identities = 120/139 (86%)
 Strand = Plus / Plus

                                                                           
Query: 289     gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
               ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || 
Sbjct: 3498791 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 3498850

                                                                           
Query: 349     taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
               || || || |||||||| || |||||||| ||||||||||||||||||||||||||||||
Sbjct: 3498851 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 3498910

                                  
Query: 409     tgttgcgcattagccctga 427
               || || || || |||||||
Sbjct: 3498911 tgctgggcgttcgccctga 3498929



to top

>emb|AL954825.3|CNS08CD1 Oryza sativa chromosome 12, . BAC OJ2007_H06 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 103647

 Score =  327 bits (165), Expect = 3e-86
 Identities = 258/288 (89%), Gaps = 1/288 (0%)
 Strand = Plus / Plus

                                                                         
Query: 423   cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
             ||||||||| || ||||| || |||||||||||||| ||||| ||||| || ||||| ||
Sbjct: 15431 cctgactccggcgtcaccaacgatgccaatggccattccggcagcgagaccggcgagacc 15490

                                                                         
Query: 483   acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
             ||||||||| || || ||||| || |||||||||||||||||| ||||||||||||||||
Sbjct: 15491 acaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtagtagggcttggcctt 15550

                                                                         
Query: 543   gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 602
             ||| |||||||| |||||||||||||| |||||||||||||||||||| || ||||| ||
Sbjct: 15551 ggggttgatccccgtgctgatgatgactgcgatgatgaggccgtagatacccagcacacc 15610

                                                                         
Query: 603   cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 662
              |||||||| |||||||||||||||||||| ||||||||||| ||||| |||||||| ||
Sbjct: 15611 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacccccatcga 15670

                                                             
Query: 663   cgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
             ||||||||||||||||||||| |||| ||||||| |||||||||||||
Sbjct: 15671 cgccaccccgacgccgctcttcgccg-tcccgtacgccgcccccatgc 15717



 Score =  125 bits (63), Expect = 2e-25
 Identities = 120/139 (86%)
 Strand = Plus / Plus

                                                                         
Query: 289   gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
             ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || 
Sbjct: 13774 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 13833

                                                                         
Query: 349   taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
             || || || |||||||| || |||||||| ||||||||||||||||||||||||||||||
Sbjct: 13834 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 13893

                                
Query: 409   tgttgcgcattagccctga 427
             || || || || |||||||
Sbjct: 13894 tgctgggcgttcgccctga 13912



to top

>gb|AC104285.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0035J08, complete sequence
          Length = 117555

 Score =  325 bits (164), Expect = 1e-85
 Identities = 239/264 (90%)
 Strand = Plus / Plus

                                                                         
Query: 423   cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
             ||||||||| || || ||||| ||||| |||||||||||||||||||| || ||||||||
Sbjct: 71771 cctgactccggcgtcgccgacgatgccgatggccatgccggcggcgagaccggcgaggcc 71830

                                                                         
Query: 483   acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
              |||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 71831 gcaggcgagaccggaggagaggtgggcgtaaccgtcgaagaggaagtagggcttggcctt 71890

                                                                         
Query: 543   gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 602
             ||| ||||| ||||||  |||||||||||||||||||||||||||||| |||||||||||
Sbjct: 71891 ggggttgatgccggtggagatgatgacggcgatgatgaggccgtagataccgagcactcc 71950

                                                                         
Query: 603   cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 662
              |||||||||||||| |||||||||||||| || || ||||| ||||| |||||||||||
Sbjct: 71951 ggccatgacgacggggacgatggacttcatcaccagttccgggcgcatcacccccatgga 72010

                                     
Query: 663   cgccaccccgacgccgctcttggc 686
             |||||| || ||||||||||||||
Sbjct: 72011 cgccacgcccacgccgctcttggc 72034



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 111/136 (81%)
 Strand = Plus / Plus

                                                                         
Query: 291   ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 350
             ||||||||| || || ||||| ||||| || ||||||||||| || || || || || ||
Sbjct: 70561 ctaatccgctcgagattggcccgcacgagacgagaggatgataccaacaatcaggccata 70620

                                                                         
Query: 351   aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 410
              || || || |||||||| || || || ||||||||||| |||||||||| |||||| ||
Sbjct: 70621 cagagcaagagcttctgcaaagataaggatgaggatcatgcccacgaacaactttggctg 70680

                             
Query: 411   ttgcgcattagccctg 426
              |||||||| ||||||
Sbjct: 70681 ctgcgcattggccctg 70696



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5,
              complete sequence
          Length = 29737217

 Score =  325 bits (164), Expect = 1e-85
 Identities = 239/264 (90%)
 Strand = Plus / Plus

                                                                          
Query: 423    cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
              ||||||||| || || ||||| ||||| |||||||||||||||||||| || ||||||||
Sbjct: 296251 cctgactccggcgtcgccgacgatgccgatggccatgccggcggcgagaccggcgaggcc 296310

                                                                          
Query: 483    acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
               |||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 296311 gcaggcgagaccggaggagaggtgggcgtaaccgtcgaagaggaagtagggcttggcctt 296370

                                                                          
Query: 543    gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 602
              ||| ||||| ||||||  |||||||||||||||||||||||||||||| |||||||||||
Sbjct: 296371 ggggttgatgccggtggagatgatgacggcgatgatgaggccgtagataccgagcactcc 296430

                                                                          
Query: 603    cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 662
               |||||||||||||| |||||||||||||| || || ||||| ||||| |||||||||||
Sbjct: 296431 ggccatgacgacggggacgatggacttcatcaccagttccgggcgcatcacccccatgga 296490

                                      
Query: 663    cgccaccccgacgccgctcttggc 686
              |||||| || ||||||||||||||
Sbjct: 296491 cgccacgcccacgccgctcttggc 296514



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 111/136 (81%)
 Strand = Plus / Plus

                                                                          
Query: 291    ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 350
              ||||||||| || || ||||| ||||| || ||||||||||| || || || || || ||
Sbjct: 295041 ctaatccgctcgagattggcccgcacgagacgagaggatgataccaacaatcaggccata 295100

                                                                          
Query: 351    aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 410
               || || || |||||||| || || || ||||||||||| |||||||||| |||||| ||
Sbjct: 295101 cagagcaagagcttctgcaaagataaggatgaggatcatgcccacgaacaactttggctg 295160

                              
Query: 411    ttgcgcattagccctg 426
               |||||||| ||||||
Sbjct: 295161 ctgcgcattggccctg 295176



to top

>emb|AL713902.2|CNS07YQ2 Oryza sativa chromosome 12, . BAC OJ1494_F10 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 116371

 Score =  313 bits (158), Expect = 4e-82
 Identities = 258/289 (89%), Gaps = 2/289 (0%)
 Strand = Plus / Minus

                                                                         
Query: 423   cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
             ||||||||| || ||||| || |||||||||||||| ||||| ||||| || ||||| ||
Sbjct: 31411 cctgactccggcgtcaccaacgatgccaatggccattccggcagcgagaccggcgagacc 31352

                                                                         
Query: 483   acaggcgagcccggaggagagatgggcgtagccgtcgaag-aggaagtagggcttggcct 541
             ||||||||| || || ||||| || ||||||||||||||| ||| |||||||||||||||
Sbjct: 31351 acaggcgaggccagatgagaggtgcgcgtagccgtcgaaggaggtagtagggcttggcct 31292

                                                                         
Query: 542   tgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactc 601
             |||| |||||||| |||||||||||||| |||||||||||||||||||| || ||||| |
Sbjct: 31291 tggggttgatccccgtgctgatgatgactgcgatgatgaggccgtagatacccagcacac 31232

                                                                         
Query: 602   ccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgg 661
             | |||||||| |||||||||||||||||||| ||||||||||| ||||| |||||||| |
Sbjct: 31231 cagccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacccccatcg 31172

                                                              
Query: 662   acgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
             |||||||||||||||||||||| |||| ||||||| |||||||||||||
Sbjct: 31171 acgccaccccgacgccgctcttcgccg-tcccgtacgccgcccccatgc 31124



 Score =  125 bits (63), Expect = 2e-25
 Identities = 120/139 (86%)
 Strand = Plus / Minus

                                                                         
Query: 289   gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 348
             ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || 
Sbjct: 33068 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 33009

                                                                         
Query: 349   taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
             || || || |||||||| || |||||||| ||||||||||||||||||||||||||||||
Sbjct: 33008 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 32949

                                
Query: 409   tgttgcgcattagccctga 427
             || || || || |||||||
Sbjct: 32948 tgctgggcgttcgccctga 32930



to top

>ref|NM_189368.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 498

 Score =  283 bits (143), Expect = 4e-73
 Identities = 359/430 (83%), Gaps = 1/430 (0%)
 Strand = Plus / Minus

                                                                       
Query: 298 gcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcg 357
           ||||| ||||||||||| ||||| |||||||||||||| |||||||| ||||| ||| | 
Sbjct: 491 gcgcgcgactggccggcgcgggaggagaggatgatgccgacgatgaggccgtagaggcca 432

                                                                       
Query: 358 agcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgca 417
           ||||| || ||||| ||||| ||||||||||| || ||||||||||| || || ||||| 
Sbjct: 431 agcgcctcggcgaagatgaggatgaggatcatgccgacgaacagcttgggctgctgcgcg 372

                                                                       
Query: 418 ttagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcg 477
           || |||||||| || || || ||||| | ||| ||||| | ||||||||||||  |   |
Sbjct: 371 ttggccctgacgccggcgtcgccgacgacgccgatggcgaggccggcggcgagggcgcag 312

                                                                       
Query: 478 aggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttg 537
           || ||   ||||||||| | || ||| ||| || ||||||||||| || |||| ||| | 
Sbjct: 311 agccccgtggcgagccccgcggcgaggtggacggagccgtcgaagtggtagtacggcatc 252

                                                                       
Query: 538 gccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagc 597
           ||| | || ||||| |||||| |||||||||| |||||||||||||||||||| || |||
Sbjct: 251 gccgtcgggttgatgccggtggtgatgatgacagcgatgatgaggccgtagatccccagc 192

                                                                       
Query: 598 actcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgaccccc 657
           ||||| ||||| || || |||||||| |||||||| || |||||||||||||| ||||||
Sbjct: 191 actccggccatcaccaccggcacgatcgacttcatcaccagctccggccgcatcaccccc 132

                                                                       
Query: 658 atggacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgcatgagaa 717
           |||  |||||||||||||||||||   |||| ||||||| ||||||||||||||||||||
Sbjct: 131 atgtgcgccaccccgacgccgctccgagccg-tcccgtacgccgcccccatgcatgagaa 73

                     
Query: 718 gacgagggcg 727
           ||||||||||
Sbjct: 72  gacgagggcg 63



to top

>gb|BT017996.1| Zea mays clone EL01N0526E06.c mRNA sequence
          Length = 586

 Score =  258 bits (130), Expect = 2e-65
 Identities = 193/214 (90%)
 Strand = Plus / Minus

                                                                       
Query: 358 agcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgca 417
           |||||||||||||||||||| ||||||||||| || ||||| |||||||| |||||||||
Sbjct: 214 agcgcttctgcgaaaatgaggatgaggatcatgccaacgaaaagctttggctgttgcgca 155

                                                                       
Query: 418 ttagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcg 477
           || ||||||||||||||||||||||||||||| ||||||||||| || || ||||| |||
Sbjct: 154 tttgccctgactccagcatcaccgacaatgccgatggccatgccagctgcaagcccagcg 95

                                                                       
Query: 478 aggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttg 537
           || |||||||| |||||||| || || ||||||||||| || |||||| |||||||||||
Sbjct: 94  agaccacaggcaagcccggacgaaaggtgggcgtagccatcaaagaggtagtagggcttg 35

                                             
Query: 538 gccttgggattgatcccggtgctgatgatgacgg 571
           |||||||| |||||||| ||||||||||||||||
Sbjct: 34  gccttggggttgatccccgtgctgatgatgacgg 1



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  250 bits (126), Expect = 6e-63
 Identities = 342/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                            
Query: 298      gcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcg 357
                ||||| ||||||||||| ||||| |||||||||||||| |||||||| ||||| ||| | 
Sbjct: 42411090 gcgcgcgactggccggcgcgggaggagaggatgatgccgacgatgaggccgtagaggcca 42411031

                                                                            
Query: 358      agcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgca 417
                ||||| || ||||| ||||| ||||||||||| || ||||||||||| || || ||||| 
Sbjct: 42411030 agcgcctcggcgaagatgaggatgaggatcatgccgacgaacagcttgggctgctgcgcg 42410971

                                                                            
Query: 418      ttagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcg 477
                || |||||||| || || || ||||| | ||| ||||| | ||||||||||||  |   |
Sbjct: 42410970 ttggccctgacgccggcgtcgccgacgacgccgatggcgaggccggcggcgagggcgcag 42410911

                                                                            
Query: 478      aggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttg 537
                || ||   ||||||||| | || ||| ||| || ||||||||||| || |||| ||| | 
Sbjct: 42410910 agccccgtggcgagccccgcggcgaggtggacggagccgtcgaagtggtagtacggcatc 42410851

                                                                            
Query: 538      gccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagc 597
                ||| | || ||||| |||||| |||||||||| |||||||||||||||||||| || |||
Sbjct: 42410850 gccgtcgggttgatgccggtggtgatgatgacagcgatgatgaggccgtagatccccagc 42410791

                                                                            
Query: 598      actcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgaccccc 657
                ||||| ||||| || || |||||||| |||||||| || |||||||||||||| ||||||
Sbjct: 42410790 actccggccatcaccaccggcacgatcgacttcatcaccagctccggccgcatcaccccc 42410731

                                                                     
Query: 658      atggacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
                |||  |||||||||||||||||||   |||| ||||||| |||||||||||||
Sbjct: 42410730 atgtgcgccaccccgacgccgctccgagccg-tcccgtacgccgcccccatgc 42410679



to top

>dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0483G10
          Length = 190721

 Score =  250 bits (126), Expect = 6e-63
 Identities = 342/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                         
Query: 298   gcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcg 357
             ||||| ||||||||||| ||||| |||||||||||||| |||||||| ||||| ||| | 
Sbjct: 70428 gcgcgcgactggccggcgcgggaggagaggatgatgccgacgatgaggccgtagaggcca 70369

                                                                         
Query: 358   agcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgca 417
             ||||| || ||||| ||||| ||||||||||| || ||||||||||| || || ||||| 
Sbjct: 70368 agcgcctcggcgaagatgaggatgaggatcatgccgacgaacagcttgggctgctgcgcg 70309

                                                                         
Query: 418   ttagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcg 477
             || |||||||| || || || ||||| | ||| ||||| | ||||||||||||  |   |
Sbjct: 70308 ttggccctgacgccggcgtcgccgacgacgccgatggcgaggccggcggcgagggcgcag 70249

                                                                         
Query: 478   aggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttg 537
             || ||   ||||||||| | || ||| ||| || ||||||||||| || |||| ||| | 
Sbjct: 70248 agccccgtggcgagccccgcggcgaggtggacggagccgtcgaagtggtagtacggcatc 70189

                                                                         
Query: 538   gccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagc 597
             ||| | || ||||| |||||| |||||||||| |||||||||||||||||||| || |||
Sbjct: 70188 gccgtcgggttgatgccggtggtgatgatgacagcgatgatgaggccgtagatccccagc 70129

                                                                         
Query: 598   actcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgaccccc 657
             ||||| ||||| || || |||||||| |||||||| || |||||||||||||| ||||||
Sbjct: 70128 actccggccatcaccaccggcacgatcgacttcatcaccagctccggccgcatcaccccc 70069

                                                                  
Query: 658   atggacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgc 710
             |||  |||||||||||||||||||   |||| ||||||| |||||||||||||
Sbjct: 70068 atgtgcgccaccccgacgccgctccgagccg-tcccgtacgccgcccccatgc 70017



to top

>gb|U16244.1|KDU16244 Kalanchoe daigremontiana V-type H+-ATPase 16 kDa subunit mRNA,
           complete cds
          Length = 820

 Score =  246 bits (124), Expect = 9e-62
 Identities = 352/427 (82%), Gaps = 1/427 (0%)
 Strand = Plus / Minus

                                                                       
Query: 303 ggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgc 362
           |||||||||||| ||||| || | |||||||||||||||||| ||||| ||||| |||||
Sbjct: 497 ggactggccggctcgggaggacaagatgatgcccacgatgaggccgtagagggccagcgc 438

                                                                       
Query: 363 ttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagc 422
           ||| || || ||||| ||||||||||| |||||||| || || ||||| || || || ||
Sbjct: 437 ttccgcaaagatgaggatgaggatcattcccacgaagagtttcggttgctgagcgttggc 378

                                                                       
Query: 423 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
           |||||| ||||| ||||| || || ||||||||||| || |||| ||| || || |||||
Sbjct: 377 cctgacaccagcgtcaccaacgattccaatggccattccagcggagagtccagcaaggcc 318

                                                                       
Query: 483 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
           ||| || |  || || || |  ||||| || |||||||| ||| |||||| |||||||||
Sbjct: 317 acaagccaagccagacgacaagtgggcatatccgtcgaacaggtagtaggacttggcctt 258

                                                                       
Query: 543 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 602
           ||| || |||||||| |||||||| |||||||| || || || || || || | ||||||
Sbjct: 257 ggggttaatcccggtactgatgataacggcgataatcagaccataaatacccaacactcc 198

                                                                       
Query: 603 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 662
            |||||||| || ||||| ||||||||||| || ||||| |||| ||| |||||||| ||
Sbjct: 197 tgccatgaccaccggcacaatggacttcatcaccagctctggcctcatcacccccattga 138

                                                                       
Query: 663 cgccaccccgacgccgctcttggccgttcccgtangccgcccccatgcatgagaagacga 722
           |||||| || || || ||||| |||| ||||||| ||||| |||||||| ||||||||||
Sbjct: 137 cgccactcccaccccactcttcgccg-tcccgtaagccgctcccatgcaggagaagacga 79

                  
Query: 723 gggcggc 729
           |||||||
Sbjct: 78  gggcggc 72



to top

>gb|AY620960.1| Pennisetum glaucum truncated vacuolar ATPase subunit c isoform
           mRNA, partial cds
          Length = 911

 Score =  214 bits (108), Expect = 3e-52
 Identities = 195/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 432 agcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgag 491
           ||||||||| |||||||||||||||||||| || ||||| || ||||| |||||||| ||
Sbjct: 255 agcatcaccaacaatgccaatggccatgccagcagcgagaccagcgagaccacaggcaag 196

                                                                       
Query: 492 cccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgat 551
            || || | ||| || ||||| ||||| |||||| ||||||||||||||||||| |||||
Sbjct: 195 gccagatgtgaggtgagcgtatccgtcaaagaggtagtagggcttggccttggggttgat 136

                                                                       
Query: 552 cccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgac 611
           |||||| ||||||||||| | ||||||||| |||||||| |||||||| || ||||||||
Sbjct: 135 cccggtactgatgatgacagtgatgatgagcccgtagataccgagcacaccagccatgac 76

                                                       
Query: 612 gacgggcacgatggacttcatgacgagctccggccgcatgaccc 655
            ||||||| |||||||||||||||||||||| | | ||||||||
Sbjct: 75  cacgggcatgatggacttcatgacgagctccaggcacatgaccc 32



to top

>gb|AY389658.1| Hyacinthus orientalis vacuolar H+-ATPase proteolipid 16 kDa subunit
           mRNA, partial cds
          Length = 757

 Score =  206 bits (104), Expect = 8e-50
 Identities = 344/423 (81%), Gaps = 1/423 (0%)
 Strand = Plus / Minus

                                                                       
Query: 304 gactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgct 363
           |||||||| || || ||||||||||||||||| || || ||||| || ||||| || |||
Sbjct: 464 gactggccagcccgagatgagaggatgatgccaacaatcagaccatatagggcaagagct 405

                                                                       
Query: 364 tctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagcc 423
           || ||||||||||||||||| ||||||||||| || ||||| || || || ||||| || 
Sbjct: 404 tcggcgaaaatgagaatgagaatcatacccacaaatagcttgggctgctgtgcattggct 345

                                                                       
Query: 424 ctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcca 483
           | |||||| ||||||||||| || ||||| |||||||| ||||  ||||| || || |||
Sbjct: 344 cggactcctgcatcaccgacgataccaatagccatgccagcggacagcccagctagccca 285

                                                                       
Query: 484 caggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttg 543
           || || |  || || ||||| || ||||| || ||||| |   | || | ||| || || 
Sbjct: 284 caagctaaaccagaagagaggtgagcgtacccatcgaacaaataataagacttcgcgtta 225

                                                                       
Query: 544 ggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactccc 603
           || |||||||| || ||||| || || || ||||| || ||||| || || |  ||||||
Sbjct: 224 gggttgatcccagtactgataatcaccgctatgatcagcccgtatatccccaaaactccc 165

                                                                       
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatggac 663
           ||||| || || |||||||| |||||||| ||||||||||||||||| || ||||| |||
Sbjct: 164 gccataaccaccggcacgatcgacttcatcacgagctccggccgcatcactcccatcgac 105

                                                                       
Query: 664 gccaccccgacgccgctcttggccgttcccgtangccgcccccatgcatgagaagacgag 723
           || || |||||||||||||| |||| ||||||| |||||||||||||| |||||||||||
Sbjct: 104 gctactccgacgccgctcttcgccg-tcccgtatgccgcccccatgcaggagaagacgag 46

              
Query: 724 ggc 726
           |||
Sbjct: 45  ggc 43



to top

>emb|X92374.1|ZMATP162 Z.mays mRNA for V-type H+-ATPase, clone 16-2
          Length = 228

 Score =  192 bits (97), Expect = 1e-45
 Identities = 190/221 (85%)
 Strand = Plus / Minus

                                                                       
Query: 400 agctttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatg 459
           ||||| || ||||| ||||| |||||||||||||||||||| ||||| || || ||||||
Sbjct: 221 agcttcggctgttgtgcattcgccctgactccagcatcaccaacaattccgattgccatg 162

                                                                       
Query: 460 ccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcg 519
           || || |  | ||| || ||||||||||| |||||||| || || || |||||||| || 
Sbjct: 161 ccagctggcaacccagcaaggccacaggcaagcccggacgaaaggtgagcgtagccatca 102

                                                                       
Query: 520 aagaggaagtagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatg 579
           || ||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 101 aaaaggtagtagggcttggccttggggttgatcccagtgctgatgatgacggcgatgatg 42

                                                    
Query: 580 aggccgtagattccgagcactcccgccatgacgacgggcac 620
           || |||||||| |||||||| || |||||||| ||||||||
Sbjct: 41  agcccgtagataccgagcacaccagccatgaccacgggcac 1



to top

>emb|X92375.1|ZMATP164 Z.mays mRNA for V-type H+-ATPase, clone 16-4
          Length = 228

 Score =  176 bits (89), Expect = 7e-41
 Identities = 188/221 (85%)
 Strand = Plus / Minus

                                                                       
Query: 400 agctttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatg 459
           ||||| || ||||| ||||| |||||||||||| ||||||| ||||| || || ||||| 
Sbjct: 221 agcttcggctgttgtgcattcgccctgactccaccatcaccaacaattccgattgccatt 162

                                                                       
Query: 460 ccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcg 519
           || || |  | ||| || || |||||||| || ||||| || || ||||| |||||||| 
Sbjct: 161 cctgcaggcaacccagcaagaccacaggcaaggccggacgacaggtgggcatagccgtca 102

                                                                       
Query: 520 aagaggaagtagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatg 579
           |||||| |||| |||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 101 aagaggtagtatggcttggccttggggttgatcccagtgctgatgatgacggcgatgatg 42

                                                    
Query: 580 aggccgtagattccgagcactcccgccatgacgacgggcac 620
           ||||||||||| |||||||| || |||||||| ||||||||
Sbjct: 41  aggccgtagataccgagcacaccagccatgaccacgggcac 1



to top

>gb|AF193814.1|AF193814 Dendrobium crumenatum vacuolar H+-ATP synthase 16kDa proteolipid
           subunit mRNA, complete cds
          Length = 896

 Score =  172 bits (87), Expect = 1e-39
 Identities = 354/442 (80%), Gaps = 1/442 (0%)
 Strand = Plus / Minus

                                                                       
Query: 292 taatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaa 351
           |||||||| || || ||||| || || || ||||| |||||||| || |||||||| || 
Sbjct: 567 taatccgcacgagattggccagcccgagaagagagaatgatgccaacaatgagaccatag 508

                                                                       
Query: 352 agggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgt 411
           ||||| || ||||| || ||||| ||||| || ||||| || || || || ||||| || 
Sbjct: 507 agggcaagagcttcagcaaaaataagaataagaatcatgcctacaaagagttttggctgc 448

                                                                       
Query: 412 tgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagc 471
           || ||||||||||| || |||||||||||||| || ||||| ||||| || || |  || 
Sbjct: 447 tgagcattagccctcacaccagcatcaccgacgatcccaatagccataccagctgataga 388

                                                                       
Query: 472 cccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtag 531
           || || |||||||| || || ||||| || || || ||||| ||||| || ||| | || 
Sbjct: 387 ccagcaaggccacacgcaaggccggaagataggtgagcgtatccgtcaaaaaggtaataa 328

                                                                       
Query: 532 ggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagatt 591
           | ||||||||||||||| || || ||||| || || || || || || |  ||||| || 
Sbjct: 327 gacttggccttgggattaattcccgtgctaataatcaccgcaataatcaatccgtaaata 268

                                                                       
Query: 592 ccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatg 651
           ||||| || || |||||||| |||||||| || |||||||| || |||||||||||||||
Sbjct: 267 ccgagaacaccagccatgaccacgggcacaattgacttcataacaagctccggccgcatg 208

                                                                       
Query: 652 acccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgca 711
           |||||||| || ||||| |||||||||||||| |||| ||||||| || |||||||| ||
Sbjct: 207 acccccatcgaggccacgccgacgccgctctttgccg-tcccgtaggcggcccccataca 149

                                 
Query: 712 tgagaagacgagggcggctgcg 733
            |||||||| || || ||||||
Sbjct: 148 ggagaagacaagcgctgctgcg 127



to top

>dbj|AB024276.1| Citrus unshiu (CitVATP c-3) mRNA for vacuolar H+-ATPase c subunit,
           complete cds
          Length = 982

 Score =  155 bits (78), Expect = 2e-34
 Identities = 306/381 (80%), Gaps = 1/381 (0%)
 Strand = Plus / Minus

                                                                       
Query: 349 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
           ||||| || |||||||| || || || |||||||||||||| || ||||| ||||| || 
Sbjct: 511 taaagtgccagcgcttcggcaaagatcagaatgaggatcatcccaacgaaaagcttcggc 452

                                                                       
Query: 409 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 468
           ||||| |||||||| ||||| |||||||||||||| || ||||| ||||| || |||| |
Sbjct: 451 tgttgagcattagctctgacaccagcatcaccgacgatcccaattgccataccagcggag 392

                                                                       
Query: 469 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 528
           || || || |||||||| ||||| || || |||||||| |||||||| ||||| ||| | 
Sbjct: 391 agaccagcaaggccacaagcgaggccagaagagagatgcgcgtagccatcgaaaaggtaa 332

                                                                       
Query: 529 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 588
           || |  |||||||| || || || ||||| || || || || || || || |  ||||| 
Sbjct: 331 taagatttggccttagggttaattccggtactaataataacagcaataatcaaaccgtaa 272

                                                                       
Query: 589 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 648
           || || |  ||||||||||| || ||||||||||| || ||||| || |||||||||| |
Sbjct: 271 atacccaaaactcccgccataacaacgggcacgatcgatttcatcacaagctccggcctc 212

                                                                       
Query: 649 atgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgcccccat 708
           || || ||||| |||||||| |||||||| ||||| |||||| ||||| || || |||||
Sbjct: 211 atcactcccatcgacgccacaccgacgccactcttcgccgtt-ccgtacgcagctcccat 153

                                
Query: 709 gcatgagaagacgagggcggc 729
            || || ||||| ||||||||
Sbjct: 152 acaggaaaagactagggcggc 132



to top

>gb|AF022925.1|AF022925 Vigna radiata adenosine triphosphatase mRNA, partial cds
          Length = 680

 Score =  151 bits (76), Expect = 4e-33
 Identities = 265/327 (81%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 400 agctttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatg 459
           |||||||| ||||| ||||| || || || || || || || || |||||||||||||||
Sbjct: 329 agctttggctgttgggcatttgctctaacaccggcgtcgccaacgatgccaatggccatg 270

                                                                       
Query: 460 ccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcg 519
           || |||| ||| || ||||| ||||| || || || || || ||||| |||||||| |||
Sbjct: 269 ccagcggagagaccagcgagaccacaagcaagaccagaagacagatgagcgtagccatcg 210

                                                                       
Query: 520 aagaggaagtagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatg 579
           || ||  |||| |  |||||||| || || || || ||||||||||| || |||||||| 
Sbjct: 209 aacagatagtacgatttggccttagggttaattcccgtgctgatgatcactgcgatgatc 150

                                                                       
Query: 580 aggccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatgacgagc 639
           | ||||||||| || ||||||||||||||||| || ||||| || || ||||| || |||
Sbjct: 149 aagccgtagatgccaagcactcccgccatgacaaccggcacaatcgatttcatcaccagc 90

                                                                       
Query: 640 tccggccgcatgacccccatggacgccaccccgacgccgctcttggccgttcccgtangc 699
           ||||||| ||| || ||||| || || || || ||||||||||| |||| | ||||| ||
Sbjct: 89  tccggcctcatcacgcccattgaggcaacaccaacgccgctcttcgccg-taccgtacgc 31

                                      
Query: 700 cgcccccatgcatgagaagacgagggc 726
           |||||||||||| ||||| ||||||||
Sbjct: 30  cgcccccatgcaagagaaaacgagggc 4



to top

>gb|AF303372.1| Tortula ruralis vacuolar-type H(+)-ATPase subunit c mRNA, complete
           cds
          Length = 830

 Score =  145 bits (73), Expect = 2e-31
 Identities = 190/228 (83%), Gaps = 1/228 (0%)
 Strand = Plus / Minus

                                                                       
Query: 502 agatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctg 561
           ||||| ||||||||||| || | | |||| ||||||| |||||| ||||| || ||||||
Sbjct: 401 agatgcgcgtagccgtcaaacacgtagtacggcttggacttggggttgattcctgtgctg 342

                                                                       
Query: 562 atgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggcacg 621
           || || || || || || || |||||||| || ||||||||||||||||| |||||||||
Sbjct: 341 ataatcacagcaataatcagtccgtagatacccagcactcccgccatgaccacgggcacg 282

                                                                       
Query: 622 atggacttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccgctc 681
           ||||||||||| |||||||| || ||||| || |||||||||||||| || || || |||
Sbjct: 281 atggacttcatcacgagctcggggcgcatcacacccatggacgccactcccactccactc 222

                                                           
Query: 682 ttggccgttcccgtangccgcccccatgcatgagaagacgagggcggc 729
           || || ||| || || || || ||||| |||||||||||||| |||||
Sbjct: 221 ttagctgtt-ccataggcagctcccatacatgagaagacgagcgcggc 175



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 108/135 (80%)
 Strand = Plus / Minus

                                                                       
Query: 327 gatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggat 386
           ||||||||||||||| |||||||| |  || ||||| || ||||||||||| || | |||
Sbjct: 576 gatgatgcccacgatcagaccgtacaaagcaagcgcctcagcgaaaatgaggatcaagat 517

                                                                       
Query: 387 catacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaat 446
           ||| ||  | |||||||| || || ||||| || |||||| | || | ||| || || ||
Sbjct: 516 catgccaccaaacagcttgggctgctgcgcgttggccctgccaccgggatctcccaccat 457

                          
Query: 447 gccaatggccatgcc 461
           |||||||||| ||||
Sbjct: 456 gccaatggccctgcc 442



to top

>ref|NM_106215.2| Arabidopsis thaliana AVA-P; ATPase AT1G75630 (AVA-P) mRNA, complete
           cds
          Length = 759

 Score =  135 bits (68), Expect = 2e-28
 Identities = 212/260 (81%)
 Strand = Plus / Minus

                                                                       
Query: 319 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 378
           |||||||||||||| || || |||||||| || || || |||||||| || || ||||||
Sbjct: 507 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 448

                                                                       
Query: 379 atgaggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatca 438
           || || ||||| ||||| |||||||| |||||||||||||| || || || |||||||||
Sbjct: 447 atcagaatcattcccacaaacagcttcggttgttgcgcattcgctctaacaccagcatca 388

                                                                       
Query: 439 ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 498
           ||||| || ||||| ||||| || || | ||| || || || ||||| || ||||| || 
Sbjct: 387 ccgacgattccaatagccataccagcagagagaccagcaagaccacaagctagcccagaa 328

                                                                       
Query: 499 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 558
           |||||||| || ||||| ||||| ||| | || | |||||||||||| || ||||| || 
Sbjct: 327 gagagatgagcatagccatcgaataggtaataagacttggccttggggttaatcccagta 268

                               
Query: 559 ctgatgatgacggcgatgat 578
           |||||||| || ||||||||
Sbjct: 267 ctgatgataacagcgatgat 248



to top

>gb|AY098985.1| Arabidopsis thaliana At1g75630/F10A5_17 mRNA, complete cds
          Length = 501

 Score =  135 bits (68), Expect = 2e-28
 Identities = 212/260 (81%)
 Strand = Plus / Minus

                                                                       
Query: 319 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 378
           |||||||||||||| || || |||||||| || || || |||||||| || || ||||||
Sbjct: 473 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 414

                                                                       
Query: 379 atgaggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatca 438
           || || ||||| ||||| |||||||| |||||||||||||| || || || |||||||||
Sbjct: 413 atcagaatcattcccacaaacagcttcggttgttgcgcattcgctctaacaccagcatca 354

                                                                       
Query: 439 ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 498
           ||||| || ||||| ||||| || || | ||| || || || ||||| || ||||| || 
Sbjct: 353 ccgacgattccaatagccataccagcagagagaccagcaagaccacaagctagcccagaa 294

                                                                       
Query: 499 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 558
           |||||||| || ||||| ||||| ||| | || | |||||||||||| || ||||| || 
Sbjct: 293 gagagatgagcatagccatcgaataggtaataagacttggccttggggttaatcccagta 234

                               
Query: 559 ctgatgatgacggcgatgat 578
           |||||||| || ||||||||
Sbjct: 233 ctgatgataacagcgatgat 214



to top

>gb|AF424574.1|AF424574 Arabidopsis thaliana At1g75630/F10A5_17 mRNA, complete cds
          Length = 749

 Score =  135 bits (68), Expect = 2e-28
 Identities = 212/260 (81%)
 Strand = Plus / Minus

                                                                       
Query: 319 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 378
           |||||||||||||| || || |||||||| || || || |||||||| || || ||||||
Sbjct: 497 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 438

                                                                       
Query: 379 atgaggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatca 438
           || || ||||| ||||| |||||||| |||||||||||||| || || || |||||||||
Sbjct: 437 atcagaatcattcccacaaacagcttcggttgttgcgcattcgctctaacaccagcatca 378

                                                                       
Query: 439 ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 498
           ||||| || ||||| ||||| || || | ||| || || || ||||| || ||||| || 
Sbjct: 377 ccgacgattccaatagccataccagcagagagaccagcaagaccacaagctagcccagaa 318

                                                                       
Query: 499 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 558
           |||||||| || ||||| ||||| ||| | || | |||||||||||| || ||||| || 
Sbjct: 317 gagagatgagcatagccatcgaataggtaataagacttggccttggggttaatcccagta 258

                               
Query: 559 ctgatgatgacggcgatgat 578
           |||||||| || ||||||||
Sbjct: 257 ctgatgataacagcgatgat 238



to top

>gb|L44584.1|ATHAVAPC Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kD proteolipid
           (ava-p) mRNA, complete cds
          Length = 689

 Score =  135 bits (68), Expect = 2e-28
 Identities = 212/260 (81%)
 Strand = Plus / Minus

                                                                       
Query: 319 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 378
           |||||||||||||| || || |||||||| || || || |||||||| || || ||||||
Sbjct: 507 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 448

                                                                       
Query: 379 atgaggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatca 438
           || || ||||| ||||| |||||||| |||||||||||||| || || || |||||||||
Sbjct: 447 atcagaatcattcccacaaacagcttcggttgttgcgcattcgctctaacaccagcatca 388

                                                                       
Query: 439 ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 498
           ||||| || ||||| ||||| || || | ||| || || || ||||| || ||||| || 
Sbjct: 387 ccgacgattccaatagccataccagcagagagaccagcaagaccacaagctagcccagaa 328

                                                                       
Query: 499 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 558
           |||||||| || ||||| ||||| ||| | || | |||||||||||| || ||||| || 
Sbjct: 327 gagagatgagcatagccatcgaataggtaataagacttggccttggggttaatcccagta 268

                               
Query: 559 ctgatgatgacggcgatgat 578
           |||||||| || ||||||||
Sbjct: 267 ctgatgataacagcgatgat 248



to top

>gb|M95063.1|MZEORFD Zea mays putative proteolipid subunit of vacuolar H+ ATPase mRNA,
           partial cds
          Length = 202

 Score =  133 bits (67), Expect = 9e-28
 Identities = 145/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 291 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 350
           |||||| |||||||||||||||||||| || |||||||| ||||| ||||||||||| ||
Sbjct: 177 ctaatctgcgcgggactggccggcacgagacgagaggataatgccgacgatgagaccata 118

                                                                       
Query: 351 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 410
            ||||| || ||||| || ||||| || ||||||||||| || || |||| ||| || ||
Sbjct: 117 gagggcaagtgcttcagcaaaaataaggatgaggatcatgccaacaaacaacttcggctg 58

                                                              
Query: 411 ttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgcc 461
            || || || |||||||| ||||||||||| || |||||||||||||||||
Sbjct: 57  ctgagcgttcgccctgacaccagcatcaccaacgatgccaatggccatgcc 7



to top

>ref|NM_101846.2| Arabidopsis thaliana AVA-P2; ATPase AT1G19910 (AVA-P2) mRNA,
           complete cds
          Length = 788

 Score =  129 bits (65), Expect = 1e-26
 Identities = 200/245 (81%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| 
Sbjct: 538 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 479

                                                                       
Query: 382 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 441
           || ||||| ||||| |||| ||| |||||||| ||||| || || || || ||||| |||
Sbjct: 478 agaatcattcccacaaacaacttaggttgttgtgcattcgctctaacaccggcatcgccg 419

                                                                       
Query: 442 acaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggag 501
           ||||| ||||| ||||| ||||||| ||| || ||||| ||||| || || ||||| |||
Sbjct: 418 acaattccaatagccataccggcggagagaccagcgagaccacaagcaagaccggaagag 359

                                                                       
Query: 502 agatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctg 561
           ||||| || ||||| ||||| ||  |||| | ||||||||| || ||||| ||||| |||
Sbjct: 358 agatgagcatagccatcgaatagatagtaagacttggccttagggttgattccggtactg 299

                
Query: 562 atgat 566
           |||||
Sbjct: 298 atgat 294



to top

>gb|BT024867.1| Arabidopsis thaliana At1g19910 gene, complete cds
          Length = 498

 Score =  129 bits (65), Expect = 1e-26
 Identities = 200/245 (81%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| 
Sbjct: 467 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 408

                                                                       
Query: 382 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 441
           || ||||| ||||| |||| ||| |||||||| ||||| || || || || ||||| |||
Sbjct: 407 agaatcattcccacaaacaacttaggttgttgtgcattcgctctaacaccggcatcgccg 348

                                                                       
Query: 442 acaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggag 501
           ||||| ||||| ||||| ||||||| ||| || ||||| ||||| || || ||||| |||
Sbjct: 347 acaattccaatagccataccggcggagagaccagcgagaccacaagcaagaccggaagag 288

                                                                       
Query: 502 agatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctg 561
           ||||| || ||||| ||||| ||  |||| | ||||||||| || ||||| ||||| |||
Sbjct: 287 agatgagcatagccatcgaatagatagtaagacttggccttagggttgattccggtactg 228

                
Query: 562 atgat 566
           |||||
Sbjct: 227 atgat 223



to top

>gb|L44585.1|ATHAVAPD Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kDa proteolipid
           (ava-p2e) mRNA, complete cds
          Length = 665

 Score =  129 bits (65), Expect = 1e-26
 Identities = 200/245 (81%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| 
Sbjct: 475 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 416

                                                                       
Query: 382 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 441
           || ||||| ||||| |||| ||| |||||||| ||||| || || || || ||||| |||
Sbjct: 415 agaatcattcccacaaacaacttaggttgttgtgcattcgctctaacaccggcatcgccg 356

                                                                       
Query: 442 acaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggag 501
           ||||| ||||| ||||| ||||||| ||| || ||||| ||||| || || ||||| |||
Sbjct: 355 acaattccaatagccataccggcggagagaccagcgagaccacaagcaagaccggaagag 296

                                                                       
Query: 502 agatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctg 561
           ||||| || ||||| ||||| ||  |||| | ||||||||| || ||||| ||||| |||
Sbjct: 295 agatgagcatagccatcgaatagatagtaagacttggccttagggttgattccggtactg 236

                
Query: 562 atgat 566
           |||||
Sbjct: 235 atgat 231



to top

>gb|L44582.1|ATHAVAPA Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kDa proteolipid
           (ava-p2) mRNA, complete cds
          Length = 692

 Score =  129 bits (65), Expect = 1e-26
 Identities = 200/245 (81%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| 
Sbjct: 443 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 384

                                                                       
Query: 382 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 441
           || ||||| ||||| |||| ||| |||||||| ||||| || || || || ||||| |||
Sbjct: 383 agaatcattcccacaaacaacttaggttgttgtgcattcgctctaacaccggcatcgccg 324

                                                                       
Query: 442 acaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggag 501
           ||||| ||||| ||||| ||||||| ||| || ||||| ||||| || || ||||| |||
Sbjct: 323 acaattccaatagccataccggcggagagaccagcgagaccacaagcaagaccggaagag 264

                                                                       
Query: 502 agatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctg 561
           ||||| || ||||| ||||| ||  |||| | ||||||||| || ||||| ||||| |||
Sbjct: 263 agatgagcatagccatcgaatagatagtaagacttggccttagggttgattccggtactg 204

                
Query: 562 atgat 566
           |||||
Sbjct: 203 atgat 199



to top

>ref|NM_120052.2| Arabidopsis thaliana ATPase AT4G38920 mRNA, complete cds
          Length = 1028

 Score =  121 bits (61), Expect = 3e-24
 Identities = 313/396 (79%), Gaps = 1/396 (0%)
 Strand = Plus / Minus

                                                                       
Query: 328 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
           ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 577 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 518

                                                                       
Query: 388 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 447
           ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || 
Sbjct: 517 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 458

                                                                       
Query: 448 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 507
           || |||||||| || || |  || || || || ||||| || || || || |||||||| 
Sbjct: 457 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 398

                                                                       
Query: 508 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgatg 567
           || || |||||||||||| ||||||  || |||||||| || |||||||| |||||||| 
Sbjct: 397 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgata 338

                                                                       
Query: 568 acggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggac 627
           || || || || |  || ||||| || | ||| || ||||| || || || || || |||
Sbjct: 337 acagcaataatcaaaccatagatacccaacacaccagccataacaactgggacaatagac 278

                                                                       
Query: 628 ttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccgctcttggcc 687
           ||||| || | |||||||| ||| || ||||| || ||||| || || || ||||| || 
Sbjct: 277 ttcatcaccaactccggcctcatcacacccatagatgccactcccacaccactctttgct 218

                                               
Query: 688 gttcccgtangccgcccccatgcatgagaagacgag 723
           | ||||||| || || ||||| ||||||||||||||
Sbjct: 217 g-tcccgtacgcagctcccatacatgagaagacgag 183



to top

>gb|AY093249.1| Arabidopsis thaliana H+-transporting ATPase 16K chain P2, vacuolar
           (F19H22.20) mRNA, complete cds
          Length = 667

 Score =  121 bits (61), Expect = 3e-24
 Identities = 313/396 (79%), Gaps = 1/396 (0%)
 Strand = Plus / Minus

                                                                       
Query: 328 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
           ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 458 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 399

                                                                       
Query: 388 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 447
           ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || 
Sbjct: 398 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 339

                                                                       
Query: 448 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 507
           || |||||||| || || |  || || || || ||||| || || || || |||||||| 
Sbjct: 338 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 279

                                                                       
Query: 508 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgatg 567
           || || |||||||||||| ||||||  || |||||||| || |||||||| |||||||| 
Sbjct: 278 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgata 219

                                                                       
Query: 568 acggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggac 627
           || || || || |  || ||||| || | ||| || ||||| || || || || || |||
Sbjct: 218 acagcaataatcaaaccatagatacccaacacaccagccataacaactgggacaatagac 159

                                                                       
Query: 628 ttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccgctcttggcc 687
           ||||| || | |||||||| ||| || ||||| || ||||| || || || ||||| || 
Sbjct: 158 ttcatcaccaactccggcctcatcacacccatagatgccactcccacaccactctttgct 99

                                               
Query: 688 gttcccgtangccgcccccatgcatgagaagacgag 723
           | ||||||| || || ||||| ||||||||||||||
Sbjct: 98  g-tcccgtacgcagctcccatacatgagaagacgag 64



to top

>gb|AY090271.1| Arabidopsis thaliana AT4g38920/F19H22_20 mRNA, complete cds
          Length = 495

 Score =  121 bits (61), Expect = 3e-24
 Identities = 313/396 (79%), Gaps = 1/396 (0%)
 Strand = Plus / Minus

                                                                       
Query: 328 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
           ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 458 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 399

                                                                       
Query: 388 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 447
           ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || 
Sbjct: 398 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 339

                                                                       
Query: 448 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 507
           || |||||||| || || |  || || || || ||||| || || || || |||||||| 
Sbjct: 338 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 279

                                                                       
Query: 508 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgatg 567
           || || |||||||||||| ||||||  || |||||||| || |||||||| |||||||| 
Sbjct: 278 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgata 219

                                                                       
Query: 568 acggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggac 627
           || || || || |  || ||||| || | ||| || ||||| || || || || || |||
Sbjct: 218 acagcaataatcaaaccatagatacccaacacaccagccataacaactgggacaatagac 159

                                                                       
Query: 628 ttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccgctcttggcc 687
           ||||| || | |||||||| ||| || ||||| || ||||| || || || ||||| || 
Sbjct: 158 ttcatcaccaactccggcctcatcacacccatagatgccactcccacaccactctttgct 99

                                               
Query: 688 gttcccgtangccgcccccatgcatgagaagacgag 723
           | ||||||| || || ||||| ||||||||||||||
Sbjct: 98  g-tcccgtacgcagctcccatacatgagaagacgag 64



to top

>gb|AY059836.1| Arabidopsis thaliana H+-transporting ATPase 16K chain P2, vacuolar
           (F19H22.20) mRNA, complete cds
          Length = 1028

 Score =  121 bits (61), Expect = 3e-24
 Identities = 313/396 (79%), Gaps = 1/396 (0%)
 Strand = Plus / Minus

                                                                       
Query: 328 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
           ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 577 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 518

                                                                       
Query: 388 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 447
           ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || 
Sbjct: 517 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 458

                                                                       
Query: 448 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 507
           || |||||||| || || |  || || || || ||||| || || || || |||||||| 
Sbjct: 457 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 398

                                                                       
Query: 508 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgatg 567
           || || |||||||||||| ||||||  || |||||||| || |||||||| |||||||| 
Sbjct: 397 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgata 338

                                                                       
Query: 568 acggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggac 627
           || || || || |  || ||||| || | ||| || ||||| || || || || || |||
Sbjct: 337 acagcaataatcaaaccatagatacccaacacaccagccataacaactgggacaatagac 278

                                                                       
Query: 628 ttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccgctcttggcc 687
           ||||| || | |||||||| ||| || ||||| || ||||| || || || ||||| || 
Sbjct: 277 ttcatcaccaactccggcctcatcacacccatagatgccactcccacaccactctttgct 218

                                               
Query: 688 gttcccgtangccgcccccatgcatgagaagacgag 723
           | ||||||| || || ||||| ||||||||||||||
Sbjct: 217 g-tcccgtacgcagctcccatacatgagaagacgag 183



to top

>gb|AF412097.1|AF412097 Arabidopsis thaliana AT4g38920/F19H22_20 mRNA, complete cds
          Length = 879

 Score =  121 bits (61), Expect = 3e-24
 Identities = 313/396 (79%), Gaps = 1/396 (0%)
 Strand = Plus / Minus

                                                                       
Query: 328 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
           ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 568 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 509

                                                                       
Query: 388 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 447
           ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || 
Sbjct: 508 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 449

                                                                       
Query: 448 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 507
           || |||||||| || || |  || || || || ||||| || || || || |||||||| 
Sbjct: 448 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 389

                                                                       
Query: 508 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgatg 567
           || || |||||||||||| ||||||  || |||||||| || |||||||| |||||||| 
Sbjct: 388 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgata 329

                                                                       
Query: 568 acggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggac 627
           || || || || |  || ||||| || | ||| || ||||| || || || || || |||
Sbjct: 328 acagcaataatcaaaccatagatacccaacacaccagccataacaactgggacaatagac 269

                                                                       
Query: 628 ttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccgctcttggcc 687
           ||||| || | |||||||| ||| || ||||| || ||||| || || || ||||| || 
Sbjct: 268 ttcatcaccaactccggcctcatcacacccatagatgccactcccacaccactctttgct 209

                                               
Query: 688 gttcccgtangccgcccccatgcatgagaagacgag 723
           | ||||||| || || ||||| ||||||||||||||
Sbjct: 208 g-tcccgtacgcagctcccatacatgagaagacgag 174



to top

>gb|AY049249.1| Arabidopsis thaliana AT4g38920/F19H22_20 mRNA, complete cds
          Length = 914

 Score =  121 bits (61), Expect = 3e-24
 Identities = 313/396 (79%), Gaps = 1/396 (0%)
 Strand = Plus / Minus

                                                                       
Query: 328 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
           ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 569 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 510

                                                                       
Query: 388 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 447
           ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || 
Sbjct: 509 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 450

                                                                       
Query: 448 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 507
           || |||||||| || || |  || || || || ||||| || || || || |||||||| 
Sbjct: 449 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 390

                                                                       
Query: 508 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgatg 567
           || || |||||||||||| ||||||  || |||||||| || |||||||| |||||||| 
Sbjct: 389 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgata 330

                                                                       
Query: 568 acggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggac 627
           || || || || |  || ||||| || | ||| || ||||| || || || || || |||
Sbjct: 329 acagcaataatcaaaccatagatacccaacacaccagccataacaactgggacaatagac 270

                                                                       
Query: 628 ttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccgctcttggcc 687
           ||||| || | |||||||| ||| || ||||| || ||||| || || || ||||| || 
Sbjct: 269 ttcatcaccaactccggcctcatcacacccatagatgccactcccacaccactctttgct 210

                                               
Query: 688 gttcccgtangccgcccccatgcatgagaagacgag 723
           | ||||||| || || ||||| ||||||||||||||
Sbjct: 209 g-tcccgtacgcagctcccatacatgagaagacgag 175



to top

>emb|BX828233.1|CNS0A338 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH66ZB12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 890

 Score =  121 bits (61), Expect = 3e-24
 Identities = 313/396 (79%), Gaps = 1/396 (0%)
 Strand = Plus / Minus

                                                                       
Query: 328 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
           ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 545 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 486

                                                                       
Query: 388 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 447
           ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || 
Sbjct: 485 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 426

                                                                       
Query: 448 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 507
           || |||||||| || || |  || || || || ||||| || || || || |||||||| 
Sbjct: 425 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 366

                                                                       
Query: 508 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgatg 567
           || || |||||||||||| ||||||  || |||||||| || |||||||| |||||||| 
Sbjct: 365 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgata 306

                                                                       
Query: 568 acggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggac 627
           || || || || |  || ||||| || | ||| || ||||| || || || || || |||
Sbjct: 305 acagcaataatcaaaccatagatacccaacacaccagccataacaactgggacaatagac 246

                                                                       
Query: 628 ttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccgctcttggcc 687
           ||||| || | |||||||| ||| || ||||| || ||||| || || || ||||| || 
Sbjct: 245 ttcatcaccaactccggcctcatcacacccatagatgccactcccacaccactctttgct 186

                                               
Query: 688 gttcccgtangccgcccccatgcatgagaagacgag 723
           | ||||||| || || ||||| ||||||||||||||
Sbjct: 185 g-tcccgtacgcagctcccatacatgagaagacgag 151



to top

>gb|AY087112.1| Arabidopsis thaliana clone 31833 mRNA, complete sequence
          Length = 911

 Score =  121 bits (61), Expect = 3e-24
 Identities = 313/396 (79%), Gaps = 1/396 (0%)
 Strand = Plus / Minus

                                                                       
Query: 328 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
           ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 568 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 509

                                                                       
Query: 388 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 447
           ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || 
Sbjct: 508 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 449

                                                                       
Query: 448 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 507
           || |||||||| || || |  || || || || ||||| || || || || |||||||| 
Sbjct: 448 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 389

                                                                       
Query: 508 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgatg 567
           || || |||||||||||| ||||||  || |||||||| || |||||||| |||||||| 
Sbjct: 388 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgata 329

                                                                       
Query: 568 acggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggac 627
           || || || || |  || ||||| || | ||| || ||||| || || || || || |||
Sbjct: 328 acagcaataatcaaaccatagatacccaacacaccagccataacaactgggacaatagac 269

                                                                       
Query: 628 ttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccgctcttggcc 687
           ||||| || | |||||||| ||| || ||||| || ||||| || || || ||||| || 
Sbjct: 268 ttcatcaccaactccggcctcatcacacccatagatgccactcccacaccactctttgct 209

                                               
Query: 688 gttcccgtangccgcccccatgcatgagaagacgag 723
           | ||||||| || || ||||| ||||||||||||||
Sbjct: 208 g-tcccgtacgcagctcccatacatgagaagacgag 174



to top

>emb|AJ843122.1| Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene)
          Length = 700

 Score =  117 bits (59), Expect = 5e-23
 Identities = 290/366 (79%), Gaps = 1/366 (0%)
 Strand = Plus / Minus

                                                                       
Query: 361 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 420
           ||||| |||||||| || ||||||||||| || ||||| |||||||||||||| ||||||
Sbjct: 542 gcttcagcgaaaataaggatgaggatcattccaacgaaaagctttggttgttgtgcatta 483

                                                                       
Query: 421 gccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgagg 480
           ||||| || |||||||| || ||||| ||||| ||||| || || || |  || || |||
Sbjct: 482 gccctcacaccagcatctcccacaattccaatagccataccagcagccaagccagcaagg 423

                                                                       
Query: 481 ccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcc 540
           ||||| || ||||| || ||||||||||| || || || || ||| |||| | |||||||
Sbjct: 422 ccacaagcaagcccagatgagagatgggcatatccatcaaacaggtagtatgacttggcc 363

                                                                       
Query: 541 ttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcact 600
           || || ||||| || |||||||| || || || || || |  |||||||| || | ||| 
Sbjct: 362 tttgggttgataccagtgctgataataacagcaataatcaaaccgtagatacccaacaca 303

                                                                       
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatg 660
           || |||||||| || ||||| || || |||||||| ||||| || | ||| || ||||| 
Sbjct: 302 ccagccatgaccactggcacaatcgatttcatgacaagctctggtctcatcacacccata 243

                                                                       
Query: 661 gacgccaccccgacgccgctcttggccgttcccgtangccgcccccatgcatgagaagac 720
           || ||||| || || || ||||| || | |||| || || || |||||||| ||||||||
Sbjct: 242 gaagccactcctacaccactcttagctg-tcccataagctgctcccatgcaggagaagac 184

                 
Query: 721 gagggc 726
            |||||
Sbjct: 183 aagggc 178



to top

>gb|AF022926.1|AF022926 Vigna radiata adenosine triphosphatase mRNA, complete cds
          Length = 956

 Score =  115 bits (58), Expect = 2e-22
 Identities = 214/266 (80%)
 Strand = Plus / Minus

                                                                       
Query: 304 gactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgct 363
           ||||| |||||||| || || |||||||| || || |||||||| || ||||| || |||
Sbjct: 567 gactgaccggcacgagaagacaggatgataccaacaatgagaccatacagggcaagagct 508

                                                                       
Query: 364 tctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagcc 423
           || || || ||||| ||||| ||||| || ||||| |||||||| || || ||||| || 
Sbjct: 507 tcggcaaagatgaggatgagaatcattccaacgaaaagctttggctgctgtgcattggct 448

                                                                       
Query: 424 ctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcca 483
           || || ||||||||||| ||||| ||||| |||||||| || | |||||| || || |||
Sbjct: 447 ctaacaccagcatcaccaacaataccaatagccatgccagcagagagcccagccagccca 388

                                                                       
Query: 484 caggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttg 543
           ||||| || || ||||||||||| || || || || |||||| | || |  |||||||||
Sbjct: 387 caggcaagaccagaggagagatgtgcataaccatcaaagaggtaataagatttggccttg 328

                                     
Query: 544 ggattgatcccggtgctgatgatgac 569
           ||||| || || || |||||||||||
Sbjct: 327 ggattaatgccagtactgatgatgac 302



to top

>dbj|D21104.1|RICAK23 Oryza sativa mRNA for H+-ATPase, partial sequence
          Length = 307

 Score =  109 bits (55), Expect = 1e-20
 Identities = 103/116 (88%), Gaps = 5/116 (4%)
 Strand = Plus / Minus

                                                                       
Query: 613 acgggcacgatggacttcatgacgagctccggccgcatgacccccatggacgccaccccg 672
           |||||||||||||||||||| ||||||||||   |||| || |||||||||||||| |||
Sbjct: 306 acgggcacgatggacttcatcacgagctccg---gcatcacgcccatggacgccacgccg 250

                                                                   
Query: 673 acgccgctcttggccgttcccgtangccgcccccatgcatgagaagacgagggcgg 728
           ||||||||||| |||| ||||||| | ||| |||||||||||||||| ||||||||
Sbjct: 249 acgccgctcttcgccg-tcccgtacg-cgcacccatgcatgagaagatgagggcgg 196



to top

>dbj|AB036924.1| Citrus unshiu Cit-VATP c-3 gene for vacuolar H+-ATPase c subunit,
           complete cds
          Length = 1369

 Score =  107 bits (54), Expect = 5e-20
 Identities = 216/270 (80%)
 Strand = Plus / Minus

                                                                       
Query: 423 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
           |||||| |||||||||||||| || ||||| ||||| || |||| ||| || || |||||
Sbjct: 497 cctgacaccagcatcaccgacgatcccaattgccataccagcggagagaccagcaaggcc 438

                                                                       
Query: 483 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
           ||| ||||| || || |||||||| |||||||| ||||| ||| | || |  ||||||||
Sbjct: 437 acaagcgaggccagaagagagatgcgcgtagccatcgaaaaggtaataagatttggcctt 378

                                                                       
Query: 543 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 602
            || || || ||||| || || || || || || || |  ||||| || || |  |||||
Sbjct: 377 agggttaattccggtactaataataacagcaataatcaaaccgtaaatacccaaaactcc 318

                                                                       
Query: 603 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 662
           |||||| || ||||||||||| || ||||| || |||||||||| ||| || ||||| ||
Sbjct: 317 cgccataacaacgggcacgatcgatttcatcacaagctccggcctcatcactcccatcga 258

                                         
Query: 663 cgccaccccgacgccgctcttggccgttcc 692
           |||||| |||||||| ||||| ||||||||
Sbjct: 257 cgccacaccgacgccactcttcgccgttcc 228



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                        
Query: 349  taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 408
            ||||| || |||||||| || || || |||||||||||||| || ||||| ||||| || 
Sbjct: 1311 taaagtgccagcgcttcggcaaagatcagaatgaggatcatcccaacgaaaagcttcggc 1252

                          
Query: 409  tgttgcgcattagc 422
            ||||| ||||||||
Sbjct: 1251 tgttgagcattagc 1238



to top

>dbj|AB024275.1| Citrus unshiu (CitVATP c-2) mRNA for vacuolar H+-ATPase c subunit,
           complete cds
          Length = 813

 Score =  103 bits (52), Expect = 8e-19
 Identities = 118/140 (84%)
 Strand = Plus / Minus

                                                                       
Query: 319 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 378
           |||||||||||||| |||||||||||||| ||||| ||||| ||||| || || ||||||
Sbjct: 630 gatgagaggatgattcccacgatgagaccataaagagcgagagcttcggcaaagatgaga 571

                                                                       
Query: 379 atgaggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatca 438
           || || ||||| ||||| |||| ||| || || || || |||||||| ||||| ||||||
Sbjct: 570 ataagaatcattcccacaaacaacttaggctgctgtgcgttagccctaactcccgcatca 511

                               
Query: 439 ccgacaatgccaatggccat 458
           || ||||| ||||| |||||
Sbjct: 510 ccaacaattccaatagccat 491



to top

>emb|BX841550.1|CNS09YFN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS95ZC06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 896

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 312/397 (78%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 328 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
           ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 555 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 496

                                                                       
Query: 388 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccga-caat 446
           ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || | | ||
Sbjct: 495 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaaccgat 436

                                                                       
Query: 447 gccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatg 506
            || |||||||| || || |  || || || || ||||| || || || || ||||||||
Sbjct: 435 acctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatg 376

                                                                       
Query: 507 ggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgat 566
            || || |||||||||||| ||||||  || ||||| || || |||||||| ||||||||
Sbjct: 375 agcatatccgtcgaagaggtagtaggatttagccttcgggttaatcccggtactgatgat 316

                                                                       
Query: 567 gacggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatgga 626
            || || || || |  || ||||| || | ||| || ||||| || || || || || ||
Sbjct: 315 aacagcaataatcaaaccatagatacccaacacaccagccataacaactgggacaataga 256

                                                                       
Query: 627 cttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccgctcttggc 686
           |||||| || | |||||||| ||| || ||||| || ||||| || || || ||||| ||
Sbjct: 255 cttcatcaccaactccggcctcatcacacccatagatgccactcccacaccactctttgc 196

                                                
Query: 687 cgttcccgtangccgcccccatgcatgagaagacgag 723
            | ||||||| || || ||||| ||||||||||||||
Sbjct: 195 tg-tcccgtacgcagctcccatacatgagaagacgag 160



to top

>ref|NM_119638.2| Arabidopsis thaliana ATPase/ hydrogen-transporting ATPase,
           rotational mechanism AT4G34720 mRNA, complete cds
          Length = 1024

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 178/221 (80%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 405
           |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| 
Sbjct: 570 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 511

                                                                       
Query: 406 ggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcg 465
           || || || ||||| |||||||| || |||||||| ||||| ||||||||||| || || 
Sbjct: 510 ggctgctgagcatttgccctgacaccggcatcaccaacaatcccaatggccattccagct 451

                                                                       
Query: 466 gcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagg 525
           | ||| || || || ||||| || || || || |||||||| ||||| || || ||||||
Sbjct: 450 gagagaccagcaagaccacaagcaagaccagacgagagatgtgcgtatccatcaaagagg 391

                                                    
Query: 526 aagtagggcttggccttgggattgatcccggtgctgatgat 566
            |||| | ||| |||||||| || |||||||| ||||||||
Sbjct: 390 tagtaagacttagccttggggttaatcccggtactgatgat 350



to top

>gb|AY127950.1| Arabidopsis thaliana AT4g34720/T4L20_300 mRNA, complete cds
          Length = 495

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 178/221 (80%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 405
           |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| 
Sbjct: 440 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 381

                                                                       
Query: 406 ggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcg 465
           || || || ||||| |||||||| || |||||||| ||||| ||||||||||| || || 
Sbjct: 380 ggctgctgagcatttgccctgacaccggcatcaccaacaatcccaatggccattccagct 321

                                                                       
Query: 466 gcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagg 525
           | ||| || || || ||||| || || || || |||||||| ||||| || || ||||||
Sbjct: 320 gagagaccagcaagaccacaagcaagaccagacgagagatgtgcgtatccatcaaagagg 261

                                                    
Query: 526 aagtagggcttggccttgggattgatcccggtgctgatgat 566
            |||| | ||| |||||||| || |||||||| ||||||||
Sbjct: 260 tagtaagacttagccttggggttaatcccggtactgatgat 220



to top

>gb|AF372872.1|AF372872 Arabidopsis thaliana AT4g34720/T4L20_300 mRNA, complete cds
          Length = 831

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 178/221 (80%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 405
           |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| 
Sbjct: 503 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 444

                                                                       
Query: 406 ggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcg 465
           || || || ||||| |||||||| || |||||||| ||||| ||||||||||| || || 
Sbjct: 443 ggctgctgagcatttgccctgacaccggcatcaccaacaatcccaatggccattccagct 384

                                                                       
Query: 466 gcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagg 525
           | ||| || || || ||||| || || || || |||||||| ||||| || || ||||||
Sbjct: 383 gagagaccagcaagaccacaagcaagaccagacgagagatgtgcgtatccatcaaagagg 324

                                                    
Query: 526 aagtagggcttggccttgggattgatcccggtgctgatgat 566
            |||| | ||| |||||||| || |||||||| ||||||||
Sbjct: 323 tagtaagacttagccttggggttaatcccggtactgatgat 283



to top

>gb|AY086410.1| Arabidopsis thaliana clone 24998 mRNA, complete sequence
          Length = 911

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 178/221 (80%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 405
           |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| 
Sbjct: 571 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 512

                                                                       
Query: 406 ggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcg 465
           || || || ||||| |||||||| || |||||||| ||||| ||||||||||| || || 
Sbjct: 511 ggctgctgagcatttgccctgacaccggcatcaccaacaatcccaatggccattccagct 452

                                                                       
Query: 466 gcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagg 525
           | ||| || || || ||||| || || || || |||||||| ||||| || || ||||||
Sbjct: 451 gagagaccagcaagaccacaagcaagaccagacgagagatgtgcgtatccatcaaagagg 392

                                                    
Query: 526 aagtagggcttggccttgggattgatcccggtgctgatgat 566
            |||| | ||| |||||||| || |||||||| ||||||||
Sbjct: 391 tagtaagacttagccttggggttaatcccggtactgatgat 351



to top

>gb|L44581.1|ATHAVAP Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kDa proteolipid
           (ava-p1) mRNA, complete cds
          Length = 825

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 178/221 (80%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 405
           |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| 
Sbjct: 487 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 428

                                                                       
Query: 406 ggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcg 465
           || || || ||||| |||||||| || |||||||| ||||| ||||||||||| || || 
Sbjct: 427 ggctgctgagcatttgccctgacaccggcatcaccaacaatcccaatggccattccagct 368

                                                                       
Query: 466 gcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagg 525
           | ||| || || || ||||| || || || || |||||||| ||||| || || ||||||
Sbjct: 367 gagagaccagcaagaccacaagcaagaccagacgagagatgtgcgtatccatcaaagagg 308

                                                    
Query: 526 aagtagggcttggccttgggattgatcccggtgctgatgat 566
            |||| | ||| |||||||| || |||||||| ||||||||
Sbjct: 307 tagtaagacttagccttggggttaatcccggtactgatgat 267



to top

>gb|DQ235180.1| Solanum tuberosum clone 160C10 vacuolar proton ATPase proteolipid
           subunit-like protein mRNA, complete cds
          Length = 832

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 361 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 420
           ||||| ||||||||||||||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 474 gcttcagcgaaaatgagaatgaggatcattccaacaaaaagcttgggttgttgtgcatta 415

                                                 
Query: 421 gccctgactccagcatcaccgacaatgccaatggccat 458
           ||||| || |||||||| || ||||| ||||| |||||
Sbjct: 414 gccctaacaccagcatctccaacaataccaatagccat 377



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 91/111 (81%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                       
Query: 616 ggcacgatggacttcatgacgagctccggccgcatgacccccatggacgccaccccgacg 675
           ||||| ||||| ||||| || | |||||||| ||| || ||||| |||||||| || || 
Sbjct: 219 ggcacaatggatttcatcaccaactccggcctcatcactcccattgacgccactccaaca 160

                                                              
Query: 676 ccgctcttggccgttcccgtangccgcccccatgcatgagaagacgagggc 726
           || ||||| || |||||  || || |||||||| |||||||||||||||||
Sbjct: 159 ccactctttgctgttcca-taagctgcccccatacatgagaagacgagggc 110



to top

>gb|DQ191632.1| Solanum tuberosum vacuolar proton ATPase proteolipid subunit-like
           protein mRNA, complete cds
          Length = 845

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 361 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 420
           ||||| ||||||||||||||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 479 gcttcagcgaaaatgagaatgaggatcattccaacaaaaagcttgggttgttgtgcatta 420

                                                 
Query: 421 gccctgactccagcatcaccgacaatgccaatggccat 458
           ||||| || |||||||| || ||||| ||||| |||||
Sbjct: 419 gccctaacaccagcatctccaacaataccaatagccat 382



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 91/111 (81%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                       
Query: 616 ggcacgatggacttcatgacgagctccggccgcatgacccccatggacgccaccccgacg 675
           ||||| ||||| ||||| || | |||||||| ||| || ||||| |||||||| || || 
Sbjct: 224 ggcacaatggatttcatcaccaactccggcctcatcactcccattgacgccactccaaca 165

                                                              
Query: 676 ccgctcttggccgttcccgtangccgcccccatgcatgagaagacgagggc 726
           || ||||| || |||||  || || |||||||| |||||||||||||||||
Sbjct: 164 ccactctttgctgttcca-taagctgcccccatacatgagaagacgagggc 115



to top

>gb|BT012782.1| Lycopersicon esculentum clone 113772R, mRNA sequence
          Length = 1106

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 361 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 420
           ||||| ||||||||||||||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 713 gcttcagcgaaaatgagaatgaggatcatcccaacaaaaagcttgggttgttgtgcatta 654

                                                 
Query: 421 gccctgactccagcatcaccgacaatgccaatggccat 458
           ||||| || |||||||| || ||||| ||||| |||||
Sbjct: 653 gccctaacaccagcatctccaacaataccaatagccat 616



to top

>gb|AF010228.1|AF010228 Lycopersicon esculentum vacuolar proton ATPase proteolipid subunit
           mRNA, complete cds
          Length = 946

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 361 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 420
           ||||| ||||||||||||||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 512 gcttcagcgaaaatgagaatgaggatcattccgacaaaaagcttgggttgttgtgcatta 453

                                                 
Query: 421 gccctgactccagcatcaccgacaatgccaatggccat 458
           ||||| || |||||||| || ||||| ||||| |||||
Sbjct: 452 gccctaacaccagcatctccaacaataccaatagccat 415



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 91/111 (81%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                       
Query: 616 ggcacgatggacttcatgacgagctccggccgcatgacccccatggacgccaccccgacg 675
           ||||| ||||||||||| || | ||| |||| ||| || ||||| |||||||| || || 
Sbjct: 257 ggcacaatggacttcatcaccaactctggcctcatcactcccattgacgccactccaaca 198

                                                              
Query: 676 ccgctcttggccgttcccgtangccgcccccatgcatgagaagacgagggc 726
           || ||||| || |||||  || || |||||||| |||||||||||||||||
Sbjct: 197 ccactctttgctgttcca-taagctgcccccatacatgagaagacgagggc 148



to top

>dbj|AB024274.1| Citrus unshiu (CitVATP c-1) mRNA for vacuolar H+-ATPase c subunit,
           complete cds
          Length = 842

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 125/152 (82%)
 Strand = Plus / Minus

                                                                       
Query: 370 aaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagccctgact 429
           |||||||||||||| ||||| || || || ||||||||||| || |||||||| ||||| 
Sbjct: 467 aaaatgagaatgagaatcattccaacaaaaagctttggttgctgtgcattagctctgaca 408

                                                                       
Query: 430 ccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcg 489
           ||||||||||| || |||||||| ||||| || || | ||| || |||||||| || |||
Sbjct: 407 ccagcatcaccaacgatgccaatagccataccagcagagagaccagcgaggccgcaagcg 348

                                           
Query: 490 agcccggaggagagatgggcgtagccgtcgaa 521
           || || || || | ||| |||||||| |||||
Sbjct: 347 agacccgaagacaaatgagcgtagccatcgaa 316



to top

>emb|X95752.1|NTPROTATP N.tabacum mRNA for c subunit of V-type ATPase (980 bp)
          Length = 980

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 127/155 (81%)
 Strand = Plus / Minus

                                                                       
Query: 304 gactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgct 363
           |||||||| ||||| || ||||| |||||||| || || || || ||||| || || |||
Sbjct: 546 gactggccagcacgagaagagagaatgatgccaacaataaggccataaagagccagggct 487

                                                                       
Query: 364 tctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagcc 423
           || |||||||| ||||| || ||||| || || || |||||||| |||||||||||||| 
Sbjct: 486 tcagcgaaaataagaatcagaatcatcccaacaaagagctttggctgttgcgcattagct 427

                                              
Query: 424 ctgactccagcatcaccgacaatgccaatggccat 458
           || || ||||||||||| || || || ||||||||
Sbjct: 426 ctaacaccagcatcaccaacgattccgatggccat 392



to top

>gb|AC152103.2| Ostreococcus sp. CCE9901 clone JGIACFB-9A1, complete sequence
          Length = 40624

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 108/129 (83%), Gaps = 1/129 (0%)
 Strand = Plus / Minus

                                                                         
Query: 583   ccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctcc 642
             ||||| || |||||||| ||||||||||| || || |||||||| ||||| || | ||||
Sbjct: 14253 ccgtatatcccgagcacgcccgccatgaccaccgggacgatggatttcatcaccaactcc 14194

                                                                         
Query: 643   ggccgcatgacccccatggacgccaccccgacgccgctcttggccgttcccgtangccgc 702
             |||||||| |||||||||||||| |  |||||||||  ||| |||| | ||||| |||||
Sbjct: 14193 ggccgcatcacccccatggacgcgatgccgacgccggacttcgccg-tgccgtacgccgc 14135

                      
Query: 703   ccccatgca 711
              ||||||||
Sbjct: 14134 gcccatgca 14126



to top

>emb|X98851.1|BVSUBCATP B.vulgaris mRNA for subunit c of V-type ATPase
          Length = 1097

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 156/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 313 gcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaa 372
           |||||||| ||||||||||| || || || |||||||| |  || |  ||||| ||||||
Sbjct: 617 gcacgggaagagaggatgataccaacaataagaccgtacaaagccaaagcttcagcgaaa 558

                                                                       
Query: 373 atgagaatgaggatcatacccacgaacagctttggttgttgcgcattagccctgactcca 432
           ||||||||||||||||| || ||||| ||||| || || || || || || ||||| || 
Sbjct: 557 atgagaatgaggatcattccaacgaaaagcttgggctgctgggcgtttgctctgacaccg 498

                                                                       
Query: 433 gcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagc 492
           ||||| |||||||| || ||||||||||| || | ||| || || || ||||| ||||| 
Sbjct: 497 gcatcgccgacaataccgatggccatgccagcagagagaccagcaagaccacaagcgaga 438

                         
Query: 493 ccggaggagagatg 506
           || || ||||||||
Sbjct: 437 ccagaagagagatg 424



to top

>gb|AC006434.5|AC006434 Genomic sequence for Arabidopsis thaliana BAC F10A5, complete sequence
          Length = 129547

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                         
Query: 319   gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 378
             |||||||||||||| || || |||||||| || || || |||||||| || || ||||||
Sbjct: 57311 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 57370

                                                      
Query: 379   atgaggatcatacccacgaacagctttggttgttgcgcatt 419
             || || ||||| ||||| |||||||| ||||||||||||||
Sbjct: 57371 atcagaatcattcccacaaacagcttcggttgttgcgcatt 57411



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 120/149 (80%)
 Strand = Plus / Plus

                                                                         
Query: 430   ccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcg 489
             |||||||||||||| || ||||| ||||| || || | ||| || || || ||||| || 
Sbjct: 58202 ccagcatcaccgacgattccaatagccataccagcagagagaccagcaagaccacaagct 58261

                                                                         
Query: 490   agcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattg 549
             ||||| || |||||||| || ||||| ||||| ||| | || | |||||||||||| || 
Sbjct: 58262 agcccagaagagagatgagcatagccatcgaataggtaataagacttggccttggggtta 58321

                                          
Query: 550   atcccggtgctgatgatgacggcgatgat 578
             ||||| || |||||||| || ||||||||
Sbjct: 58322 atcccagtactgatgataacagcgatgat 58350



to top

>gb|AF153677.1|AF153677 Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kDa subunit c
            isoform 4 (AVAP4) gene, complete cds
          Length = 2762

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                        
Query: 319  gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 378
            |||||||||||||| || || |||||||| || || || |||||||| || || ||||||
Sbjct: 1813 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 1754

                                                     
Query: 379  atgaggatcatacccacgaacagctttggttgttgcgcatt 419
            || || ||||| ||||| |||||||| ||||||||||||||
Sbjct: 1753 atcagaatcattcccacaaacagcttcggttgttgcgcatt 1713



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 122/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 430 ccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcg 489
           ||||||||||||||||| ||||||||||| || || | ||| || || || ||||| || 
Sbjct: 924 ccagcatcaccgacaatcccaatggccataccagcagagagaccagcaagaccacaagct 865

                                                                       
Query: 490 agcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattg 549
           ||||| || |||||||| || ||||| ||||| ||| | || | |||||||||||| || 
Sbjct: 864 agcccagaagagagatgagcatagccatcgaataggtaataagacttggccttggggtta 805

                                        
Query: 550 atcccggtgctgatgatgacggcgatgat 578
           ||||| || |||||||| || ||||||||
Sbjct: 804 atcccagtactgatgataacagcgatgat 776



to top

>dbj|AB036923.1| Citrus unshiu Cit-VATP c-2 gene for vacuolar H+-ATPase c subunit,
            complete cds
          Length = 1909

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 92/109 (84%)
 Strand = Plus / Minus

                                                                        
Query: 319  gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 378
            |||||||||||||| |||||||||||||| ||||| ||||| ||||| || || ||||||
Sbjct: 1881 gatgagaggatgattcccacgatgagaccataaagagcgagagcttcggcaaagatgaga 1822

                                                             
Query: 379  atgaggatcatacccacgaacagctttggttgttgcgcattagccctga 427
            || || ||||| ||||| |||| ||| || || || || ||||||||||
Sbjct: 1821 ataagaatcattcccacaaacaacttaggctgctgtgcgttagccctga 1773



to top

>emb|AJ002061.1|BVSCVTATP Beta vulgaris mRNA for subunit c of V-type ATPase
          Length = 912

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 109/132 (82%)
 Strand = Plus / Minus

                                                                       
Query: 327 gatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggat 386
           ||||||||| || ||||||||||| || || || ||||| || || |||||||| |||||
Sbjct: 549 gatgatgccgacaatgagaccgtagagagcaagtgcttcagcaaagatgagaataaggat 490

                                                                       
Query: 387 catacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaat 446
           ||| || ||||| |||||||| || || ||||| || || || ||||||||||| |||||
Sbjct: 489 catcccgacgaaaagctttggctgctgtgcattggctctaacaccagcatcaccaacaat 430

                       
Query: 447 gccaatggccat 458
            ||||| |||||
Sbjct: 429 accaatagccat 418



to top

>emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 90
          Length = 198987

 Score = 77.8 bits (39), Expect = 5e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                         
Query: 328   atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
             ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 62971 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 62912

                                                    
Query: 388   atacccacgaacagctttggttgttgcgcattagccctg 426
             ||||| ||||| |||||||| ||||| ||||| ||||||
Sbjct: 62911 ataccaacgaaaagctttggctgttgagcattggccctg 62873



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                         
Query: 499   gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 558
             |||||||| || || |||||||||||| ||||||  || |||||||| || |||||||| 
Sbjct: 62463 gagagatgagcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggta 62404

                     
Query: 559   ctgatgat 566
             ||||||||
Sbjct: 62403 ctgatgat 62396



to top

>emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, BAC clone F19H22 (ESSA project)
          Length = 100469

 Score = 77.8 bits (39), Expect = 5e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                         
Query: 328   atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
             ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 24961 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 24902

                                                    
Query: 388   atacccacgaacagctttggttgttgcgcattagccctg 426
             ||||| ||||| |||||||| ||||| ||||| ||||||
Sbjct: 24901 ataccaacgaaaagctttggctgttgagcattggccctg 24863



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                         
Query: 499   gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 558
             |||||||| || || |||||||||||| ||||||  || |||||||| || |||||||| 
Sbjct: 24453 gagagatgagcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggta 24394

                     
Query: 559   ctgatgat 566
             ||||||||
Sbjct: 24393 ctgatgat 24386



to top

>gb|L44583.1|ATHAVAPB Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kDa proteolipid
            (ava-p) gene, complete cds
          Length = 2546

 Score = 77.8 bits (39), Expect = 5e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                        
Query: 328  atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 387
            ||||| || |||||||||||||| || || || ||||| ||||||||||| || || |||
Sbjct: 2118 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 2059

                                                   
Query: 388  atacccacgaacagctttggttgttgcgcattagccctg 426
            ||||| ||||| |||||||| ||||| ||||| ||||||
Sbjct: 2058 ataccaacgaaaagctttggctgttgagcattggccctg 2020



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 499  gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 558
            |||||||| || || |||||||||||| ||||||  || |||||||| || |||||||| 
Sbjct: 1611 gagagatgagcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggta 1552

                    
Query: 559  ctgatgat 566
            ||||||||
Sbjct: 1551 ctgatgat 1544



to top

>dbj|AB028204.1| Porphyra yezoensis mRNA for vacuolar-ATPase c subunit, complete cds
          Length = 921

 Score = 77.8 bits (39), Expect = 5e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 583 ccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctcc 642
           |||||||| |||||||| ||||||||||| ||||| | |||| |   ||| || ||||||
Sbjct: 389 ccgtagataccgagcacacccgccatgaccacgggaatgatgcagcgcatcaccagctcc 330

                                              
Query: 643 ggccgcatgacccccatggacgccaccccgacgcc 677
           || |||||||| |||||||||||||| ||||||||
Sbjct: 329 gggcgcatgacacccatggacgccacaccgacgcc 295



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 352 agggcgagcgcttctgcgaaaatgagaatgaggatcat 389
           |||||||||||||| |||||||||||||| ||||||||
Sbjct: 614 agggcgagcgcttcagcgaaaatgagaatcaggatcat 577



to top

>gb|AY261522.1| Suaeda maritima subsp. salsa vacuolar H(+)-ATPase subunit c mRNA,
           complete cds
          Length = 952

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 361 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 420
           ||||| ||||||||||| ||||||||||| || ||||| ||||| || || || ||||| 
Sbjct: 508 gcttcagcgaaaatgaggatgaggatcattccaacgaaaagcttgggctgctgggcattg 449

                                     
Query: 421 gccctgactccagcatcaccgacaat 446
           || ||||| |||||||||||||||||
Sbjct: 448 gctctgacaccagcatcaccgacaat 423



to top

>gb|BT014562.1| Lycopersicon esculentum clone 134016F, mRNA sequence
          Length = 947

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 280/360 (77%), Gaps = 1/360 (0%)
 Strand = Plus / Minus

                                                                       
Query: 370 aaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagccctgact 429
           ||||| ||||| | ||||||||| || || || ||||||||||| ||||| || || || 
Sbjct: 514 aaaataagaatcaagatcataccaacaaagagttttggttgttgtgcatttgctctaaca 455

                                                                       
Query: 430 ccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcg 489
           ||||||||||| ||||| ||||| ||||| |||||||  || || ||||| ||||| || 
Sbjct: 454 ccagcatcaccaacaattccaatagccattccggcggaaaggccagcgagaccacaagcc 395

                                                                       
Query: 490 agcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattg 549
           |  ||||| || || ||||| || || || || ||| | || |  |||| |||||| || 
Sbjct: 394 aaaccggaagaaaggtgggcatatccatcaaaaaggtaatacgatttggtcttggggtta 335

                                                                       
Query: 550 atcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatg 609
           |||||||| ||||| ||||| || || || |  || || || || | ||| || ||||| 
Sbjct: 334 atcccggtactgataatgactgcaataatcaatccataaatacctaacacaccagccata 275

                                                                       
Query: 610 acgacgggcacgatggacttcatgacgagctccggccgcatgacccccatggacgccacc 669
           || || ||||| || |||||||| || ||||| |||| ||| || |||||||||||||| 
Sbjct: 274 acaaccggcacaattgacttcatcacaagctctggcctcattactcccatggacgccact 215

                                                                       
Query: 670 ccgacgccgctcttggccgttcccgtangccgcccccatgcatgagaagacgagggcggc 729
           || || |||||||| || ||| || || || || ||||| |||||||| ||||| |||||
Sbjct: 214 cccacaccgctcttcgctgtt-ccataagcagctcccatacatgagaaaacgagcgcggc 156



to top

>gb|AY610014.1| Sus scrofa clone Clu_560.scr.msk.p1.Contig3, mRNA sequence
          Length = 1146

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| |||| ||||| ||||| |||
Sbjct: 597 gagaggatgagggcaacgatgagaccgtagaggccgagcacttccgcgaagatgaggatg 538

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 537 aggatcatgcccacgaa 521



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| ||||| | ||||||||||||||  ||||| |||||||||||
Sbjct: 324 gccatgaccacggggatgatggacttcatgatcagctctggccgcatgac 275



to top

>emb|X94999.1|MCVTATPC M.crystallinum mRNA for V-type ATPase c subunit
          Length = 991

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 108/132 (81%)
 Strand = Plus / Minus

                                                                       
Query: 327 gatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggat 386
           |||||| || || ||||||||||| || || |||||||| || || |||||||| || ||
Sbjct: 576 gatgataccgacaatgagaccgtagagagcaagcgcttcagcaaagatgagaataagaat 517

                                                                       
Query: 387 catacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaat 446
           ||| |||||||| || ||||| || || ||||| || || || ||||||||||| |||||
Sbjct: 516 cattcccacgaaaagttttggctgctgagcattggctctaacaccagcatcaccaacaat 457

                       
Query: 447 gccaatggccat 458
            ||||| |||||
Sbjct: 456 accaatagccat 445



to top

>gb|U13670.1|GHU13670 Gossypium hirsutum vacuolar H+-ATPase proteolipid (16 kDa) subunit 
           (cva16-4) mRNA, complete cds
          Length = 895

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 99/120 (82%)
 Strand = Plus / Minus

                                                                       
Query: 327 gatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggat 386
           |||||||||||||||||| |||||||| || |  ||||| || || ||||| || |||||
Sbjct: 550 gatgatgcccacgatgaggccgtaaagagccaaagcttcagcaaagatgaggataaggat 491

                                                                       
Query: 387 catacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaat 446
           ||| || || || || ||||| || || |||||||| ||||| ||||||||||| |||||
Sbjct: 490 cattccaacaaaaagttttggctgctgtgcattagctctgacaccagcatcaccaacaat 431



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 87/108 (80%), Gaps = 1/108 (0%)
 Strand = Plus / Minus

                                                                       
Query: 622 atggacttcatgacgagctccggccgcatgacccccatggacgccaccccgacgccgctc 681
           ||||| ||||| || | ||| |||| ||| || ||||| || ||||| || || ||||||
Sbjct: 255 atggatttcatcaccaactcaggcctcatcacacccattgaagccacacccacaccgctc 196

                                                           
Query: 682 ttggccgttcccgtangccgcccccatgcatgagaagacgagggcggc 729
           || ||||| |||||| || || ||||| || ||||||||||| |||||
Sbjct: 195 ttagccgt-cccgtatgcagctcccatacaggagaagacgagagcggc 149



to top

>gb|U13669.1|GHU13669 Gossypium hirsutum vacuolar H+-ATPase proteolipid (16 kDa) subunit
           (cva16-2) mRNA, complete cds
          Length = 809

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 161/203 (79%)
 Strand = Plus / Minus

                                                                       
Query: 373 atgagaatgaggatcatacccacgaacagctttggttgttgcgcattagccctgactcca 432
           ||||| || |||||||| || || || |||||||| || || || ||||| ||||| |||
Sbjct: 500 atgaggataaggatcattccaacaaaaagctttggctgctgtgcgttagctctgacacca 441

                                                                       
Query: 433 gcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagc 492
           ||||| |||||||| ||||| ||||| || || |  ||||| || |||||||| || || 
Sbjct: 440 gcatcgccgacaattccaattgccattccagcagaaagcccagcaaggccacaagcaaga 381

                                                                       
Query: 493 ccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatc 552
           || || || ||||||||||| || ||||| ||| | || |  |||||||| |||||||||
Sbjct: 380 ccagaagaaagatgggcgtaaccatcgaaaaggtaatacgatttggccttaggattgatc 321

                                  
Query: 553 ccggtgctgatgatgacggcgat 575
           || || || || ||||| |||||
Sbjct: 320 ccagtactaataatgacagcgat 298



to top

>gb|AY826922.1| Heterocapsa triquetra clone HTVATP1 vacuolar ATP synthase mRNA,
           complete cds
          Length = 592

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 560 tgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacggg 617
           |||||||||| ||| |||||||||||||||| ||||| ||||| ||||| ||||||||
Sbjct: 271 tgatgatgactgcggtgatgaggccgtagatgccgaggactcctgccatcacgacggg 214



to top

>gb|AC007797.7|AC007797 Arabidopsis thaliana chromosome I BAC F6F9 genomic sequence, complete
            sequence
          Length = 119942

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                        
Query: 322  gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
            ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| 
Sbjct: 8425 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 8484

                                                  
Query: 382  aggatcatacccacgaacagctttggttgttgcgcatt 419
            || ||||| ||||| |||| ||| |||||||| |||||
Sbjct: 8485 agaatcattcccacaaacaacttaggttgttgtgcatt 8522



to top

>gb|U59737.1|ATU59737 Arabidopsis thaliana ATP sulfurylase (APS2) gene, complete cds, and
            vacuolar H+-pumping ATPase 16 kDa proteolipid (AVA-P2est)
            gene, partial cds
          Length = 3918

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                        
Query: 322  gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
            ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| 
Sbjct: 3374 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 3433

                                                  
Query: 382  aggatcatacccacgaacagctttggttgttgcgcatt 419
            || ||||| ||||| |||| ||| |||||||| |||||
Sbjct: 3434 agaatcattcccacaaacaacttaggttgttgtgcatt 3471



to top

>gb|L16884.1|HELATPASEV Heliothis virescens 17kDa H+-ATPase V-type subunit mRNA, complete
           cds
          Length = 1015

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
           ||||||||||||||||| | |||||||||||||| |||||| ||||||||
Sbjct: 252 cccgccatgacgacgggaatgatggacttcatgatgagctcaggccgcat 203



to top

>dbj|AB028205.1| Porphyra yezoensis gene for vacuolar-ATPase c subunit, complete cds
          Length = 1562

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 592 ccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatg 651
           |||||||| ||||||||||| ||||| | |||| |   ||| || |||||||| ||||||
Sbjct: 196 ccgagcacacccgccatgaccacgggaatgatgcagcgcatcaccagctccgggcgcatg 137

                                     
Query: 652 acccccatggacgccaccccgacgcc 677
           || |||||||||||||| ||||||||
Sbjct: 136 acacccatggacgccacaccgacgcc 111



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 360  cgcttctgcgaaaatgagaatgaggatcat 389
            |||||| |||||||||||||| ||||||||
Sbjct: 1281 cgcttcagcgaaaatgagaatcaggatcat 1252



to top

>gb|BC007759.2| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit
           c, mRNA (cDNA clone MGC:12873 IMAGE:4127653), complete
           cds
          Length = 1069

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 564 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 505

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 504 aggatcatgcccacgaa 488



to top

>gb|BC007389.2| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit
           c, mRNA (cDNA clone MGC:16271 IMAGE:3831016), complete
           cds
          Length = 1134

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 580 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 521

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 520 aggatcatgcccacgaa 504



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 307 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 258



to top

>gb|BT007459.1| Synthetic construct Homo sapiens ATPase, H+ transporting, lysosomal
           16kDa, V0 subunit c mRNA, partial cds
          Length = 468

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 398 aggatcatgcccacgaa 382



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136



to top

>gb|BT007155.1| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
           mRNA, complete cds
          Length = 468

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 398 aggatcatgcccacgaa 382



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136



to top

>emb|CR622720.1| full-length cDNA clone CS0DM012YP05 of Fetal liver of Homo sapiens
           (human)
          Length = 1035

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 604 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 545

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 544 aggatcatgcccacgaa 528



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 331 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 282



to top

>emb|CR616665.1| full-length cDNA clone CS0DF036YP04 of Fetal brain of Homo sapiens
           (human)
          Length = 869

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 390 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 331

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 330 aggatcatgcccacgaa 314



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 117 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 68



to top

>emb|CR616464.1| full-length cDNA clone CS0DC002YJ21 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 989

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 508 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 449

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 448 aggatcatgcccacgaa 432



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 235 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 186



to top

>emb|CR613683.1| full-length cDNA clone CS0DD001YD19 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 730

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 281 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 222

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 221 aggatcatgcccacgaa 205



to top

>emb|CR608280.1| full-length cDNA clone CS0DC018YA15 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1042

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 595 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 536

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 535 aggatcatgcccacgaa 519



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 322 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 273



to top

>emb|CR603009.1| full-length cDNA clone CS0DK007YM15 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 627

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 144 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 85

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 84  aggatcatgcccacgaa 68



to top

>emb|CR601237.1| full-length cDNA clone CS0DC029YE21 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1062

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 585 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 526

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 525 aggatcatgcccacgaa 509



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 312 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 263



to top

>emb|CR600796.1| full-length cDNA clone CS0DI019YH17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 949

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 547 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 488

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 487 aggatcatgcccacgaa 471



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 274 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 225



to top

>emb|CR599331.1| full-length cDNA clone CS0DH005YC07 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1018

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 581 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 522

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 521 aggatcatgcccacgaa 505



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 308 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 259



to top

>emb|CR599309.1| full-length cDNA clone CS0DI067YF17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1057

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 604 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 545

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 544 aggatcatgcccacgaa 528



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 331 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 282



to top

>emb|CR597229.1| full-length cDNA clone CS0DN004YA02 of Adult brain of Homo sapiens
           (human)
          Length = 1046

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 568 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 509

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 508 aggatcatgcccacgaa 492



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 295 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 246



to top

>emb|CR592409.1| full-length cDNA clone CS0DI067YN17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1057

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 604 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 545

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 544 aggatcatgcccacgaa 528



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 331 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 282



to top

>emb|CR592150.1| full-length cDNA clone CS0DF014YE05 of Fetal brain of Homo sapiens
           (human)
          Length = 1071

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 592 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 533

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 532 aggatcatgcccacgaa 516



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 319 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 270



to top

>emb|CR590083.1| full-length cDNA clone CS0DJ004YP02 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 992

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 513 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 454

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 453 aggatcatgcccacgaa 437



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 240 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 191



to top

>ref|NM_001694.2| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
           (ATP6V0C), mRNA
          Length = 1126

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 610 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 551

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 550 aggatcatgcccacgaa 534



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 337 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 288



to top

>emb|CR541951.1| Homo sapiens full open reading frame cDNA clone RZPDo834E0134D for
           gene ATP6V0C, ATPase, H+ transporting, lysosomal 16kDa,
           V0 subunit c; complete cds, without stopcodon
          Length = 465

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 398 aggatcatgcccacgaa 382



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136



to top

>emb|CR541930.1| Homo sapiens full open reading frame cDNA clone RZPDo834B0334D for
           gene ATP6V0C, ATPase, H+ transporting, lysosomal 16kDa,
           V0 subunit c; complete cds, incl. stopcodon
          Length = 468

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 398 aggatcatgcccacgaa 382



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136



to top

>gb|BC004537.2| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit
           c, mRNA (cDNA clone MGC:3723 IMAGE:3618755), complete
           cds
          Length = 1077

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 576 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 517

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 516 aggatcatgcccacgaa 500



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 303 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 254



to top

>gb|AC093525.3| Homo sapiens chromosome 16 clone RP11-20I23, complete sequence
          Length = 157518

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 322   gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
             |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 73505 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 73564

                              
Query: 382   aggatcatacccacgaa 398
             |||||||| ||||||||
Sbjct: 73565 aggatcatgcccacgaa 73581



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 604   gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
             |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 73917 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 73966



to top

>gb|AY892471.1| Synthetic construct Homo sapiens clone FLH014562.01L ATPase H+
           transporting lysosomal 16kDa V0 subunit c (ATP6V0C)
           mRNA, partial cds
          Length = 468

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 398 aggatcatgcccacgaa 382



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136



to top

>gb|AY889986.1| Synthetic construct Homo sapiens clone FLH014566.01X ATPase
           lysosomal V0 subunit c (ATP6V0C) mRNA, complete cds
          Length = 468

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 398 aggatcatgcccacgaa 382



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136



to top

>gb|BC009290.2| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit
           c, mRNA (cDNA clone MGC:16615 IMAGE:4111426), complete
           cds
          Length = 1113

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 597 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 538

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 537 aggatcatgcccacgaa 521



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 324 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 275



to top

>gb|M62762.1|HUMPCHSUCA Human vacuolar H+ ATPase proton channel subunit mRNA, complete cds
          Length = 1162

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| 
Sbjct: 688 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 629

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 628 aggatcatgcccacgaa 612



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||   ||||||||||||||||
Sbjct: 415 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 366



to top

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 116/144 (80%)
 Strand = Plus / Plus

                                                                         
Query: 423   cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
             |||||| || |||||||| ||||| ||||||||||| || || | ||| || || || ||
Sbjct: 23230 cctgacaccggcatcaccaacaatcccaatggccattccagctgagagaccagcaagacc 23289

                                                                         
Query: 483   acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
             ||| || || || || |||||||| ||||| || || |||||| |||| | ||| |||||
Sbjct: 23290 acaagcaagaccagacgagagatgtgcgtatccatcaaagaggtagtaagacttagcctt 23349

                                     
Query: 543   gggattgatcccggtgctgatgat 566
             ||| || |||||||| ||||||||
Sbjct: 23350 ggggttaatcccggtactgatgat 23373



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                         
Query: 346   ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 405
             |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| 
Sbjct: 23056 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 23115

                                   
Query: 406   ggttgttgcgcattagccctga 427
             || || || ||||| |||||||
Sbjct: 23116 ggctgctgagcatttgccctga 23137



to top

>emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project)
          Length = 125502

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 116/144 (80%)
 Strand = Plus / Plus

                                                                          
Query: 423    cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
              |||||| || |||||||| ||||| ||||||||||| || || | ||| || || || ||
Sbjct: 104462 cctgacaccggcatcaccaacaatcccaatggccattccagctgagagaccagcaagacc 104521

                                                                          
Query: 483    acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 542
              ||| || || || || |||||||| ||||| || || |||||| |||| | ||| |||||
Sbjct: 104522 acaagcaagaccagacgagagatgtgcgtatccatcaaagaggtagtaagacttagcctt 104581

                                      
Query: 543    gggattgatcccggtgctgatgat 566
              ||| || |||||||| ||||||||
Sbjct: 104582 ggggttaatcccggtactgatgat 104605



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                          
Query: 346    ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 405
              |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| 
Sbjct: 104288 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 104347

                                    
Query: 406    ggttgttgcgcattagccctga 427
              || || || ||||| |||||||
Sbjct: 104348 ggctgctgagcatttgccctga 104369



to top

>dbj|AP006639.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT25N16, TM0216,
             complete sequence
          Length = 95667

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                         
Query: 423   cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
             |||||| ||||||||||| ||||| ||||| ||||||||||| | |||||| || || ||
Sbjct: 93902 cctgacaccagcatcaccaacaataccaatagccatgccggcagagagcccagcaagccc 93961

                                     
Query: 483   acaggcgagcccggaggagagatg 506
              ||||| || || |||||||||||
Sbjct: 93962 gcaggcaagaccagaggagagatg 93985



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                          
Query: 303   ggactggccggcacgggatgagaggatgatgcccacgatgagacc 347
             |||||| || ||||| || ||||||||||| || |||||||||||
Sbjct: 92922 ggactgaccagcacgagaagagaggatgataccgacgatgagacc 92966



to top

>gb|AY190685.1| Pagrus major ATPase H+ transporting lysosomal vacuolar proton pump
           mRNA, complete cds
          Length = 676

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggcc 646
           ||||||||||||||||| | ||| |||||||||| |||||||||||
Sbjct: 387 cccgccatgacgacggggatgattgacttcatgatgagctccggcc 342



to top

>emb|X65051.1|MSVATP16S M.sexta mRNA for vacuolar ATPase 16 kD proteolipid subunit
          Length = 1428

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
           ||||||||||||||||| | ||||||||||||||  ||||| ||||||||
Sbjct: 238 cccgccatgacgacggggatgatggacttcatgatcagctcgggccgcat 189



to top

>gb|BC102659.1| Bos taurus proteolipid protein, mRNA (cDNA clone MGC:127859
           IMAGE:30956944), complete cds
          Length = 1187

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 337 acgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacg 396
           |||||||||||||| ||| ||||| | || ||||| ||||| ||||||||||| ||||||
Sbjct: 602 acgatgagaccgtagaggccgagcacctcggcgaagatgaggatgaggatcatgcccacg 543

             
Query: 397 aa 398
           ||
Sbjct: 542 aa 541



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           ||||||||||| || || | ||||||||||||||  | ||| |||||||||||
Sbjct: 347 cccgccatgaccaccgggatgatggacttcatgatcatctctggccgcatgac 295



to top

>emb|BX816345.1|CNS0ABM3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH42ZD04 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1207

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                        
Query: 322  gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
            ||||||||||| || || ||||||||||| ||||| ||  |||| || || |||||||| 
Sbjct: 1017 gagaggatgataccaacaatgagaccgtacagggcaagttcttcagcaaagatgagaatc 958

                                                  
Query: 382  aggatcatacccacgaacagctttggttgttgcgcatt 419
            || ||||| ||||| |||| ||| |||||||| |||||
Sbjct: 957  agaatcattcccacaaacaacttaggttgttgtgcatt 920



to top

>ref|NM_001017954.1| Bos taurus ATPase, H+ transporting, lysosomal, V0 subunit c
           (ATP6V0C), mRNA
          Length = 1133

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 337 acgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacg 396
           |||||||||||||| ||| ||||| | || ||||| ||||| ||||||||||| ||||||
Sbjct: 575 acgatgagaccgtagaggccgagcacctcggcgaagatgaggatgaggatcatgcccacg 516

             
Query: 397 aa 398
           ||
Sbjct: 515 aa 514



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           ||||||||||| || || | ||||||||||||||  | ||| |||||||||||
Sbjct: 320 cccgccatgaccaccgggatgatggacttcatgatcatctctggccgcatgac 268



to top

>gb|AY246555.1| Spodoptera littoralis H(+)-ATPase C subunit mRNA, partial cds
          Length = 314

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
           ||||||||||||||||| | |||||| ||||||| |||||| ||||||||
Sbjct: 78  cccgccatgacgacgggaatgatggatttcatgatgagctcgggccgcat 29



to top

>gb|J03835.1|BOVATPPLC Bovine proteolipid protein of the H+ -ATPase of chromaffin granules
           mRNA, complete cds
          Length = 1133

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 337 acgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacg 396
           |||||||||||||| ||| ||||| | || ||||| ||||| ||||||||||| ||||||
Sbjct: 575 acgatgagaccgtagaggccgagcacctcggcgaagatgaggatgaggatcatgcccacg 516

             
Query: 397 aa 398
           ||
Sbjct: 515 aa 514



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           ||||||||||| || || | ||||||||||||||  | ||| |||||||||||
Sbjct: 320 cccgccatgaccaccgggatgatggacttcatgatcatctctggccgcatgac 268



to top

>emb|CR728680.2|CNS0GP72 Tetraodon nigroviridis full-length cDNA
          Length = 1423

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           ||||||||||| || || | |||||||||||||| ||||||||||| ||||||
Sbjct: 382 cccgccatgaccactgggatgatggacttcatgatgagctccggcctcatgac 330



to top

>emb|CR723295.2|CNS0GL1H Tetraodon nigroviridis full-length cDNA
          Length = 1424

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           ||||||||||| || || | |||||||||||||| ||||||||||| ||||||
Sbjct: 382 cccgccatgaccactgggatgatggacttcatgatgagctccggcctcatgac 330



to top

>emb|CR719662.2|CNS0GI8K Tetraodon nigroviridis full-length cDNA
          Length = 861

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           ||||||||||| || || | |||||||||||||| ||||||||||| ||||||
Sbjct: 362 cccgccatgaccactgggatgatggacttcatgatgagctccggcctcatgac 310



to top

>emb|CR703907.2|CNS0G633 Tetraodon nigroviridis full-length cDNA
          Length = 858

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           ||||||||||| || || | |||||||||||||| ||||||||||| ||||||
Sbjct: 364 cccgccatgaccacagggatgatggacttcatgatgagctccggcctcatgac 312



to top

>emb|CR649696.2|CNS0F09Y Tetraodon nigroviridis full-length cDNA
          Length = 852

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           ||||||||||| || || | |||||||||||||| ||||||||||| ||||||
Sbjct: 358 cccgccatgaccactgggatgatggacttcatgatgagctccggcctcatgac 306



to top

>emb|CR648948.2|CNS0EZP6 Tetraodon nigroviridis full-length cDNA
          Length = 853

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           ||||||||||| || || | |||||||||||||| ||||||||||| ||||||
Sbjct: 358 cccgccatgaccactgggatgatggacttcatgatgagctccggcctcatgac 306



to top

>gb|AC148293.6| Medicago truncatula clone mth2-16c13, complete sequence
          Length = 117793

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                         
Query: 304   gactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgct 363
             |||||||||||||| || || | ||| || || || ||||||||||||||||| || |||
Sbjct: 18755 gactggccggcacgtgaagacaagataataccaacaatgagaccgtaaagggcaagagct 18814

                                                         
Query: 364   tctgcgaaaatgagaatgaggatcatacccacgaacagctttgg 407
             || || || ||||| || |||||||| || ||||| || |||||
Sbjct: 18815 tcagcaaagatgaggataaggatcattccaacgaaaagttttgg 18858



to top

>emb|AJ879499.1| Phaseolus vulgaris SCAR-RADP fragment SG14
          Length = 671

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Plus

                                                                       
Query: 430 ccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcg 489
           ||||||||||| ||||| ||||| |||||||| || |  ||||| || | ||||||||| 
Sbjct: 449 ccagcatcaccaacaataccaatagccatgcctgcagacagcccagccaagccacaggca 508

                                               
Query: 490 agcccggaggagagatgggcgtagccgtcgaagagg 525
           || || ||||||||||| ||||| || || ||||||
Sbjct: 509 agaccagaggagagatgtgcgtaaccatcaaagagg 544



to top

>emb|BX817547.1|CNS0AB6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL2ZD03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 706

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 391 cccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatgcca 450
           ||||| || ||||| |||||||||||||| || || || |||||||||||||| || |||
Sbjct: 416 cccacaaagagcttcggttgttgcgcattcgctctcacaccagcatcaccgacgattcca 357

                   
Query: 451 atggccat 458
           || |||||
Sbjct: 356 atagccat 349



to top

>ref|XM_859597.1| PREDICTED: Canis familiaris similar to Vacuolar ATP synthase 16 kDa
           proteolipid subunit, transcript variant 2 (LOC479877),
           mRNA
          Length = 1140

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 340 atgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaa 398
           ||||||||||| ||| ||||| | || ||||||||||| || |||||||| ||||||||
Sbjct: 587 atgagaccgtagaggccgagcacctcggcgaaaatgaggatcaggatcatgcccacgaa 529



to top

>ref|XM_537002.2| PREDICTED: Canis familiaris similar to Vacuolar ATP synthase 16 kDa
           proteolipid subunit, transcript variant 1 (LOC479877),
           mRNA
          Length = 1131

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 340 atgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaa 398
           ||||||||||| ||| ||||| | || ||||||||||| || |||||||| ||||||||
Sbjct: 578 atgagaccgtagaggccgagcacctcggcgaaaatgaggatcaggatcatgcccacgaa 520



to top

>ref|XM_947896.1| Theileria annulata strain Ankara vacuolar H+-ATPase subunit
           (TA07825) partial mRNA
          Length = 501

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                       
Query: 574 atgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatg 633
           |||||||| |||||||||||||| || || ||||| |  ||||| | ||| |||||||||
Sbjct: 209 atgatgagaccgtagattccgagaacaccggccataataacggggatgatcgacttcatg 150

                                      
Query: 634 acgagctccggccgcatgacccccatg 660
           ||||| || || ||||| || ||||||
Sbjct: 149 acgagatcagggcgcatcacacccatg 123



to top

>ref|XM_510748.1| PREDICTED: Pan troglodytes similar to Vacuolar ATP synthase 16 kDa
           proteolipid subunit (LOC453837), mRNA
          Length = 521

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 604 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 653
           |||||||| || || | ||||||||||||||  |||||||||||||||||
Sbjct: 227 gccatgaccactgggatgatggacttcatgatcagctccggccgcatgac 178



to top

>gb|AY617308.1| Sterkiella histriomuscorum clone UGC1O0001_L09_R genomic sequence
          Length = 1046

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 415 gcattagccctgactccagcatcaccgacaatgccaat 452
           |||||||| |||||||| |||||||||||||| |||||
Sbjct: 709 gcattagctctgactcctgcatcaccgacaataccaat 672



to top

>gb|BC067156.1| Danio rerio ATPase, H+ transporting, lysosomal, V0 subunit c, mRNA
           (cDNA clone MGC:76969 IMAGE:6525380), complete cds
          Length = 1201

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
           ||||||||||| ||||| | ||||||||||||||  ||||| ||||||||
Sbjct: 307 cccgccatgaccacgggaatgatggacttcatgatcagctctggccgcat 258



to top

>gb|BC063154.1| Rattus norvegicus ATPase, H transporting, lysosomal V0 subunit c,
           mRNA (cDNA clone MGC:72710 IMAGE:6918203), complete cds
          Length = 1186

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 616 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 557

                                                                       
Query: 382 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 441
           |||||||| |||||||||||    || || || ||| |  ||| ||| |||||||| |||
Sbjct: 556 aggatcatgcccacgaacagtcgaggctgctgggcagtgccccggacaccagcatctccg 497

                         
Query: 442 acaatgccaatggc 455
           ||||||||||||||
Sbjct: 496 acaatgccaatggc 483



to top

>ref|NM_130823.2| Rattus norvegicus ATPase, H transporting, lysosomal V0 subunit c
           (Atp6v0c), mRNA
          Length = 1186

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 616 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 557

                                                                       
Query: 382 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 441
           |||||||| |||||||||||    || || || ||| |  ||| ||| |||||||| |||
Sbjct: 556 aggatcatgcccacgaacagtcgaggctgctgggcagtgccccggacaccagcatctccg 497

                         
Query: 442 acaatgccaatggc 455
           ||||||||||||||
Sbjct: 496 acaatgccaatggc 483



to top

>emb|BX908778.5| Zebrafish DNA sequence from clone CH211-193E17 in linkage group 3,
             complete sequence
          Length = 138862

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 601   cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
             ||||||||||| ||||| | ||||||||||||||  ||||| ||||||||
Sbjct: 64423 cccgccatgaccacgggaatgatggacttcatgatcagctctggccgcat 64472



to top

>gb|AY099523.1| Danio rerio vacuolar ATP synthase 16 kDa proteolipid subunit
           (atp6l) mRNA, complete cds
          Length = 902

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
           ||||||||||| ||||| | ||||||||||||||  ||||| ||||||||
Sbjct: 351 cccgccatgaccacgggaatgatggacttcatgatcagctctggccgcat 302



to top

>ref|NM_173255.1| Danio rerio ATPase, H+ transporting, lysosomal, V0 subunit c
           (atp6v0c), mRNA
          Length = 902

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 601 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
           ||||||||||| ||||| | ||||||||||||||  ||||| ||||||||
Sbjct: 351 cccgccatgaccacgggaatgatggacttcatgatcagctctggccgcat 302



to top

>emb|CR387933.10| Zebrafish DNA sequence from clone DKEY-81L17 in linkage group 3, complete
              sequence
          Length = 182618

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 601    cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
              ||||||||||| ||||| | ||||||||||||||  ||||| ||||||||
Sbjct: 112270 cccgccatgaccacgggaatgatggacttcatgatcagctctggccgcat 112221



to top

>dbj|AB003942.1| Acetabularia acetabulum mRNA for vacuolar type H+-ATPase
           proteolipid subunit, complete cds
          Length = 826

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 385 atcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgaca 444
           |||||||| || |||||||| |||||||  |||||||| |  || ||||||||||| |||
Sbjct: 476 atcataccgacaaacagcttaggttgttaggcattagcacgcacaccagcatcacccaca 417

                         
Query: 445 atgccaatggccat 458
           || ||||| |||||
Sbjct: 416 attccaatagccat 403



to top

>ref|XM_530928.1| PREDICTED: Pan troglodytes LOC462697 (LOC462697), mRNA
          Length = 837

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 621 gatggacttcatgacgagctccggccgcatgac 653
           ||||||||||||||  |||||||||||||||||
Sbjct: 33  gatggacttcatgatcagctccggccgcatgac 65



to top

>gb|AC149546.14| Medicago truncatula clone mth2-70o13, complete sequence
          Length = 124127

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                         
Query: 307   tggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttct 366
             ||||| || ||||| |||||||||||||| || || || ||||| |  || | ||| || 
Sbjct: 27259 tggccagcgcgggaagagaggatgatgccaacaataagtccgtacaacgccaacgcctcg 27318

                                                                  
Query: 367   gcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatt 419
             ||||||||||| ||||| ||||| || || || |||||||| ||||| |||||
Sbjct: 27319 gcgaaaatgaggatgagaatcattccaacaaaaagctttggctgttgagcatt 27371



to top

>emb|AL049843.18|HSJ392M17 Human DNA sequence from clone RP3-392M17 on chromosome 6p12.3-21.2
             Contains an ATPase H+ transporting lysosomal (ATP6C)
             pseudogene, the RDS gene for retinal degeneration slow
             (retinitis pigmentosa 7), the 3' end of the UBR2 gene for
             ubiquitin protein ligase E3 component n-recognin 2 and a
             CpG island, complete sequence
          Length = 110900

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 621   gatggacttcatgacgagctccggccgcatgac 653
             ||||||||||||||  |||||||||||||||||
Sbjct: 12754 gatggacttcatgatcagctccggccgcatgac 12786



to top

>gb|AC174351.5| Medicago truncatula clone mth2-7h5, complete sequence
          Length = 109873

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                         
Query: 307   tggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttct 366
             ||||| || ||||| |||||||||||||| || || || ||||| |  || | ||| || 
Sbjct: 94150 tggccagcgcgggaagagaggatgatgccaacaataagtccgtacaacgccaacgcctcg 94209

                                                                  
Query: 367   gcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatt 419
             ||||||||||| ||||| ||||| || || || |||||||| ||||| |||||
Sbjct: 94210 gcgaaaatgaggatgagaatcattccaacaaaaagctttggctgttgagcatt 94262



to top

>ref|NM_001009195.1| Ovis aries vacuolar ATPase 16kDa subunit c (ATP6V0C), mRNA
          Length = 468

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || || || ||||| || 
Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcaaagatgaggata 399

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 398 aggatcatgcccacgaa 382



to top

>gb|AF027705.1|AF027705 Ovis aries vacuolar ATPase 16kDa subunit c mRNA, complete cds
          Length = 468

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||||| | | |||||||||||||| ||| ||||| | || || || ||||| || 
Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcaaagatgaggata 399

                            
Query: 382 aggatcatacccacgaa 398
           |||||||| ||||||||
Sbjct: 398 aggatcatgcccacgaa 382



to top

>dbj|AB036922.1| Citrus unshiu Cit-VATP c-1 gene for vacuolar H+-ATPase c subunit,
           complete cds
          Length = 1060

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 370 aaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagc 422
           |||||||||||||| ||||| || || || ||||||||||| || ||||||||
Sbjct: 981 aaaatgagaatgagaatcattccaacaaaaagctttggttgctgtgcattagc 929



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 80/99 (80%)
 Strand = Plus / Minus

                                                                       
Query: 423 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 482
           |||||| ||||||||||| || |||||||| ||||| || || | ||| || ||||||||
Sbjct: 443 cctgacaccagcatcaccaacgatgccaatagccataccagcagagagaccagcgaggcc 384

                                                  
Query: 483 acaggcgagcccggaggagagatgggcgtagccgtcgaa 521
            || ||||| || || || | ||| |||||||| |||||
Sbjct: 383 gcaagcgagacccgaagacaaatgagcgtagccatcgaa 345



to top

>gb|AC166573.2| Mus musculus BAC clone RP23-153H18 from chromosome 17, complete sequence
          Length = 193004

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                          
Query: 322    gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
              |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 153764 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 153823

                                  
Query: 382    aggatcatacccacgaacag 401
              |||||||| |||||||||||
Sbjct: 153824 aggatcatgcccacgaacag 153843



to top

>ref|XM_460869.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F12683g)
           partial mRNA
          Length = 483

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 404 ttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggc 455
           |||||||||||||| || | ||||| || |||||||| ||||| ||||||||
Sbjct: 370 ttggttgttgcgcagtacctctgacaccggcatcaccaacaattccaatggc 319



to top

>gb|AC117577.16| Mus musculus chromosome 17, clone RP23-35F19, complete sequence
          Length = 198548

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                          
Query: 322    gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
              |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 188224 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 188165

                                  
Query: 382    aggatcatacccacgaacag 401
              |||||||| |||||||||||
Sbjct: 188164 aggatcatgcccacgaacag 188145



to top

>gb|BT012440.1| Drosophila melanogaster RH30178 full insert cDNA
          Length = 2812

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 518 cttcggcgaagatgagaatcaggatcatgcccacgaacag 479



to top

>gb|AY232009.1| Drosophila yakuba clone yak-ad_Vha16 mRNA sequence
          Length = 477

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 430 cttcggcgaagatgagaatcaggatcatgcccacgaacag 391



to top

>gb|AC153623.8| Mus musculus 6 BAC RP23-459F14 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 205825

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                          
Query: 322    gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
              |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 132410 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 132351

                                  
Query: 382    aggatcatacccacgaacag 401
              |||||||| |||||||||||
Sbjct: 132350 aggatcatgcccacgaacag 132331



to top

>gb|BC099475.1| Mus musculus ATPase, H+ transporting, lysosomal V0 subunit C, mRNA
           (cDNA clone IMAGE:30938468), partial cds
          Length = 1130

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 546 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 487

                               
Query: 382 aggatcatacccacgaacag 401
           |||||||| |||||||||||
Sbjct: 486 aggatcatgcccacgaacag 467



to top

>gb|BC083129.1| Mus musculus ATPase, H+ transporting, lysosomal V0 subunit C, mRNA
           (cDNA clone IMAGE:6440462), partial cds
          Length = 1147

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 583 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 524

                               
Query: 382 aggatcatacccacgaacag 401
           |||||||| |||||||||||
Sbjct: 523 aggatcatgcccacgaacag 504



to top

>gb|BC057084.1| Mus musculus ATPase, H+ transporting, lysosomal V0 subunit C, mRNA
            (cDNA clone IMAGE:5708539)
          Length = 2392

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 322  gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
            |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 2020 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 1961

                                
Query: 382  aggatcatacccacgaacag 401
            |||||||| |||||||||||
Sbjct: 1960 aggatcatgcccacgaacag 1941



to top

>emb|BX035037.1|CNS08Z75 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 329 cttcggcgaaaatgaggatcaggatcataccgacgaacag 290



to top

>emb|BX023184.1|CNS08Q1W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 535 cttcggcgaaaatgaggatcaggatcataccgacgaacag 574



to top

>emb|BX023183.1|CNS08Q1V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 493 cttcggcgaaaatgaggatcaggatcataccgacgaacag 454



to top

>emb|BX022537.1|CNS08PJX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 930 cttcggcgaaaatgaggatcaggatcataccgacgaacag 969



to top

>emb|BX022536.1|CNS08PJW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 645 cttcggcgaaaatgaggatcaggatcataccgacgaacag 606



to top

>emb|BX020878.1|CNS08O9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 557

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 441 cttcggcgaaaatgaggatcaggatcataccgacgaacag 402



to top

>emb|BX016528.1|CNS08KX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 626 cttcggcgaaaatgaggatcaggatcataccgacgaacag 587



to top

>emb|BX011628.1|CNS08H4W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 536 cttcggcgaaaatgaggatcaggatcataccgacgaacag 575



to top

>emb|BX011627.1|CNS08H4V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 498 cttcggcgaaaatgaggatcaggatcataccgacgaacag 459



to top

>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces
               hansenii
          Length = 2336804

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                   
Query: 404     ttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggc 455
               |||||||||||||| || | ||||| || |||||||| ||||| ||||||||
Sbjct: 1012849 ttggttgttgcgcagtacctctgacaccggcatcaccaacaattccaatggc 1012798



to top

>emb|X77936.1|DMCSDUC D.melanogaster (Canton S) ductin, subunit C proteolipid gene
          Length = 7252

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 362  cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
            |||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 6660 cttcggcgaagatgagaatcaggatcatgcccacgaacag 6621



to top

>ref|NM_009729.1| Mus musculus ATPase, H+ transporting, lysosomal V0 subunit C
           (Atp6v0c), mRNA
          Length = 1153

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 605 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 546

                               
Query: 382 aggatcatacccacgaacag 401
           |||||||| |||||||||||
Sbjct: 545 aggatcatgcccacgaacag 526



to top

>ref|NM_165476.1| Drosophila melanogaster Vacuolar H+ ATPase 16kD subunit CG3161-RD,
           transcript variant D (Vha16), mRNA
          Length = 1142

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 535 cttcggcgaagatgagaatcaggatcatgcccacgaacag 496



to top

>ref|NM_165475.1| Drosophila melanogaster Vacuolar H+ ATPase 16kD subunit CG3161-RC,
           transcript variant C (Vha16), mRNA
          Length = 1307

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 700 cttcggcgaagatgagaatcaggatcatgcccacgaacag 661



to top

>ref|NM_165474.1| Drosophila melanogaster Vacuolar H+ ATPase 16kD subunit CG3161-RB,
           transcript variant B (Vha16), mRNA
          Length = 1159

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 552 cttcggcgaagatgagaatcaggatcatgcccacgaacag 513



to top

>ref|NM_057453.3| Drosophila melanogaster Vacuolar H+ ATPase 16kD subunit CG3161-RA,
           transcript variant A (Vha16), mRNA
          Length = 1200

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 593 cttcggcgaagatgagaatcaggatcatgcccacgaacag 554



to top

>dbj|AK146159.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730024L21 product:ATPase, H+ transporting, V0
           subunit C, full insert sequence
          Length = 1117

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 569 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 510

                               
Query: 382 aggatcatacccacgaacag 401
           |||||||| |||||||||||
Sbjct: 509 aggatcatgcccacgaacag 490



to top

>dbj|AK170346.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630049E13
           product:ATPase, H+ transporting, V0 subunit C, full
           insert sequence
          Length = 918

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 569 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 510

                               
Query: 382 aggatcatacccacgaacag 401
           |||||||| |||||||||||
Sbjct: 509 aggatcatgcccacgaacag 490



to top

>gb|AF356008.1|AF356008 Mus musculus vacuolar proton-translocating ATPase 16 kDa subunit
            gene, complete cds
          Length = 6186

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 322  gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
            |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 6103 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 6044

                                
Query: 382  aggatcatacccacgaacag 401
            |||||||| |||||||||||
Sbjct: 6043 aggatcatgcccacgaacag 6024



to top

>dbj|AK002871.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610040L07 product:ATPase, H+
           transporting, lysosomal (vacuolar proton pump) 16 kDa,
           full insert sequence
          Length = 940

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 591 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 532

                               
Query: 382 aggatcatacccacgaacag 401
           |||||||| |||||||||||
Sbjct: 531 aggatcatgcccacgaacag 512



to top

>dbj|AK002570.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610011P10 product:ATPase, H+
           transporting, lysosomal (vacuolar proton pump) 16 kDa,
           full insert sequence
          Length = 1160

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 612 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 553

                               
Query: 382 aggatcatacccacgaacag 401
           |||||||| |||||||||||
Sbjct: 552 aggatcatgcccacgaacag 533



to top

>dbj|AK028239.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length
           enriched library, clone:2900002E12 product:ATPase, H+
           transporting, lysosomal (vacuolar proton pump) 16 kDa,
           full insert sequence
          Length = 1141

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 593 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 534

                               
Query: 382 aggatcatacccacgaacag 401
           |||||||| |||||||||||
Sbjct: 533 aggatcatgcccacgaacag 514



to top

>gb|AC007593.5|AC007593 Drosophila melanogaster, chromosome 2R, region 42E-43A, BAC clone
             BACR01C10, complete sequence
          Length = 173702

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 362   cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
             |||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 86091 cttcggcgaagatgagaatcaggatcatgcccacgaacag 86130



to top

>ref|XM_559193.1| Anopheles gambiae str. PEST ENSANGP00000027550
           (ENSANGG00000020729), partial mRNA
          Length = 819

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 430 cttcggcgaaaatgaggatcaggatcataccgacgaacag 391



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 601 cccgccatgacgacgggcacgatggacttcatga 634
           ||||||||||| ||||| | ||||||||||||||
Sbjct: 194 cccgccatgacaacgggaatgatggacttcatga 161



to top

>ref|XM_311406.2| Anopheles gambiae str. PEST ENSANGP00000025336
           (ENSANGG00000020729), partial mRNA
          Length = 777

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 529 cttcggcgaaaatgaggatcaggatcataccgacgaacag 490



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 601 cccgccatgacgacgggcacgatggacttcatga 634
           ||||||||||| ||||| | ||||||||||||||
Sbjct: 293 cccgccatgacaacgggaatgatggacttcatga 260



to top

>gb|AE003789.5| Drosophila melanogaster chromosome 2R, section 6 of 73 of the complete
              sequence
          Length = 415717

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 362    cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
              |||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 372959 cttcggcgaagatgagaatcaggatcatgcccacgaacag 372998



to top

>gb|U13842.1|MMU13842 Mus musculus vacuolar adenosine triphosphatase subunit c gene,
           complete cds
          Length = 1129

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 580 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 521

                               
Query: 382 aggatcatacccacgaacag 401
           |||||||| |||||||||||
Sbjct: 520 aggatcatgcccacgaacag 501



to top

>emb|CT010502.13| Mouse DNA sequence from clone RP23-27H19 on chromosome 17, complete
             sequence
          Length = 246273

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                         
Query: 322   gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
             |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 25109 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 25050

                                 
Query: 382   aggatcatacccacgaacag 401
             |||||||| |||||||||||
Sbjct: 25049 aggatcatgcccacgaacag 25030



to top

>emb|X55979.1|DMVHATP Drosophila mRNA for vacuolar H+-ATPase
          Length = 1138

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacag 401
           |||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 546 cttcggcgaagatgagaatcaggatcatgcccacgaacag 507



to top

>gb|M64298.1|MUSMVP Mouse vacuolar H(+)-ATPase (mvp) mRNA, complete cds
          Length = 1153

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 605 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 546

                               
Query: 382 aggatcatacccacgaacag 401
           |||||||| |||||||||||
Sbjct: 545 aggatcatgcccacgaacag 526



to top

>dbj|D10874.1|RATSDHATP Rattus norvegicus mRNA for H(+)-transporting ATPase, complete cds
          Length = 1082

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
           |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 553 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 494

                               
Query: 382 aggatcatacccacgaacag 401
           |||||||| |||||||||||
Sbjct: 493 aggatcatgcccacgaacag 474



to top

>dbj|AB059662.1| Mus musculus mvp gene for vacuolar H+-ATPase 16-kDa proteolipid
            subunit, complete cds
          Length = 10813

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 322  gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 381
            |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || 
Sbjct: 9126 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 9067

                                
Query: 382  aggatcatacccacgaacag 401
            |||||||| |||||||||||
Sbjct: 9066 aggatcatgcccacgaacag 9047



to top

>dbj|AB003938.1| Acetabularia acetabulum mRNA for vacuolar type H+-ATPase
           proteolipid subunit, complete cds
          Length = 825

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 559 ctgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggc 618
           |||||||||||||| || || |||||||| || || | ||| |||||||| || || |||
Sbjct: 345 ctgatgatgacggcaataatcaggccgtaaatacccaacacacccgccataacaaccggc 286

                                                       
Query: 619 acgatggacttcatgacgagctccggccgcatgacccccatgga 662
           || ||||| ||||| || || || || ||||| || ||||||||
Sbjct: 285 acaatggatttcatcactagttcagggcgcatcacacccatgga 242



to top

>ref|NM_205554.1| Danio rerio zgc:77708 (zgc:77708), mRNA
          Length = 1775

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 600 tcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
           |||||||||||| || || | ||||||||||||||  |||||||| |||||
Sbjct: 357 tcccgccatgaccacaggaatgatggacttcatgatcagctccggacgcat 307



to top

>ref|XM_956325.1| Neurospora crassa OR74A VACUOLAR ATP SYNTHASE 16 KDA PROTEOLIPID
           SUBUNIT (NCU01332.1) partial mRNA
          Length = 444

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                       
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 421
           |||| |||||||||||||| || ||||| || ||||| ||  | |||||||| ||| |  
Sbjct: 373 cttcggcgaaaatgagaataagaatcatgccgacgaagagtctgggttgttgagcagttc 314

                                          
Query: 422 ccctgactccagcatcaccgacaatgccaat 452
           | | ||| ||||||||||||||||| |||||
Sbjct: 313 cacggacaccagcatcaccgacaataccaat 283



to top

>ref|XM_326824.1| Neurospora crassa OR74A VACUOLAR ATP SYNTHASE 16 KDA PROTEOLIPID
           SUBUNIT (NCU01332.1) partial mRNA
          Length = 444

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                       
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 421
           |||| |||||||||||||| || ||||| || ||||| ||  | |||||||| ||| |  
Sbjct: 373 cttcggcgaaaatgagaataagaatcatgccgacgaagagtctgggttgttgagcagttc 314

                                          
Query: 422 ccctgactccagcatcaccgacaatgccaat 452
           | | ||| ||||||||||||||||| |||||
Sbjct: 313 cacggacaccagcatcaccgacaataccaat 283



to top

>ref|XM_567918.1| Cryptococcus neoformans var. neoformans JEC21 hydrogen ion
           transporter (CNK03340) partial mRNA
          Length = 709

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 337 acgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacg 396
           |||||||| ||||||||  | ||  |||| ||||||||||| || |||||||| || || 
Sbjct: 515 acgatgagcccgtaaagaccaagaacttcggcgaaaatgaggataaggatcatcccgaca 456

                                                                       
Query: 397 aacagctttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggcc 456
           |||| | | || || || ||  || ||||||| || ||||||||||| || || ||||| 
Sbjct: 455 aacaacctaggctgctgggccgtacccctgacacccgcatcaccgacgataccgatggca 396

                                  
Query: 457 atgccggcggcgagccccgcgag 479
           | |||||||||||| || |||||
Sbjct: 395 aagccggcggcgagaccggcgag 373



to top

>ref|XM_758859.1| Theileria parva strain Muguga chromosome 4 vacuolar ATPase subunit
           (TP04_0317) partial mRNA
          Length = 719

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 574 atgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatg 633
           ||||||||||| ||||| ||||| || || ||||| |  ||||| | ||| |||||||||
Sbjct: 359 atgatgaggccatagataccgagaacaccagccataataacgggaatgatagacttcatg 300

                                      
Query: 634 acgagctccggccgcatgacccccatg 660
           ||||| || || ||||| || ||||||
Sbjct: 299 acgagatcagggcgcatcacacccatg 273



to top

>gb|BC050939.1| Mus musculus ATPase, H+ transporting, lysosomal V0 subunit C, mRNA
           (cDNA clone IMAGE:6820042), partial cds
          Length = 918

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 335 ccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcataccca 394
           |||||||||||||||| ||| | ||| | || || || ||||| || |||||||| ||||
Sbjct: 540 ccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatcaggatcatgccca 481

                  
Query: 395 cgaacag 401
           |||||||
Sbjct: 480 cgaacag 474



to top

>emb|AL590075.8| Human DNA sequence from clone RP11-462L13 on chromosome X, complete
             sequence
          Length = 135711

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 210   tcaaaattagaacttttcaaagcttcc 236
             |||||| ||||||||||||||||||||
Sbjct: 35579 tcaaaaatagaacttttcaaagcttcc 35553



to top

>emb|AL451017.1|NC12F11 Neurospora crassa DNA linkage group V Cosmid contig 12F11
          Length = 74317

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                         
Query: 362   cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 421
             |||| |||||||||||||| || ||||| || ||||| ||  | |||||||| ||| |  
Sbjct: 36780 cttcggcgaaaatgagaataagaatcatgccgacgaagagtctgggttgttgagcagttc 36721

                                            
Query: 422   ccctgactccagcatcaccgacaatgccaat 452
             | | ||| ||||||||||||||||| |||||
Sbjct: 36720 cacggacaccagcatcaccgacaataccaat 36690



to top

>gb|BC065849.1| Danio rerio zgc:77708, mRNA (cDNA clone MGC:77708 IMAGE:7000508),
           complete cds
          Length = 1775

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 600 tcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
           |||||||||||| || || | ||||||||||||||  |||||||| |||||
Sbjct: 357 tcccgccatgaccacaggaatgatggacttcatgatcagctccggacgcat 307



to top

>gb|BC093130.1| Danio rerio zgc:77708, mRNA (cDNA clone MGC:111904 IMAGE:7427484),
           complete cds
          Length = 919

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 600 tcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 650
           |||||||||||| || || | ||||||||||||||  |||||||| |||||
Sbjct: 378 tcccgccatgaccacaggaatgatggacttcatgatcagctccgggcgcat 328



to top

>gb|AC009430.2|AC009430 Homo sapiens, clone RP11-45O17, complete sequence
          Length = 156454

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 210    tcaaaattagaacttttcaaagcttcc 236
              |||||| ||||||||||||||||||||
Sbjct: 116687 tcaaaaatagaacttttcaaagcttcc 116713



to top

>gb|L07105.1|NEUVMA3A Neurospora crassa proteolipid subunit of vacuolar ATPase (vma3) gene,
            complete cds
          Length = 2631

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                        
Query: 362  cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 421
            |||| |||||||||||||| || ||||| || ||||| ||  | |||||||| ||| |  
Sbjct: 1649 cttcggcgaaaatgagaataagaatcatgccgacgaagagtctgggttgttgagcagttc 1590

                                           
Query: 422  ccctgactccagcatcaccgacaatgccaat 452
            | | ||| ||||||||||||||||| |||||
Sbjct: 1589 cacggacaccagcatcaccgacaataccaat 1559



to top

>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete
              sequence
          Length = 1019846

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                        
Query: 422    ccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgag 479
              ||||||| || ||||||||||| || || ||||| | |||||||||||| || |||||
Sbjct: 982962 ccctgacacccgcatcaccgacgataccgatggcaaagccggcggcgagaccggcgag 983019



to top

>ref|XM_718009.1| Candida albicans SC5314 vacuolar ATPase subunit c (CaO19_5886),
           mRNA
          Length = 309

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 76/94 (80%)
 Strand = Plus / Minus

                                                                       
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 421
           ||||||||||||| | ||| | ||||||||| || ||||   |||||||||| ||| || 
Sbjct: 238 cttctgcgaaaatcaaaatcaagatcataccaacaaacaatcttggttgttgggcagtac 179

                                             
Query: 422 ccctgactccagcatcaccgacaatgccaatggc 455
           | ||||| || || ||||| ||||| ||||||||
Sbjct: 178 ctctgacaccggcgtcaccaacaataccaatggc 145



to top

>ref|XM_717862.1| Candida albicans SC5314 vacuolar ATPase subunit c (CaO19_13307),
           mRNA
          Length = 309

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 76/94 (80%)
 Strand = Plus / Minus

                                                                       
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 421
           ||||||||||||| | ||| | ||||||||| || ||||   |||||||||| ||| || 
Sbjct: 238 cttctgcgaaaatcaaaatcaagatcataccaacaaacaatcttggttgttgggcagtac 179

                                             
Query: 422 ccctgactccagcatcaccgacaatgccaatggc 455
           | ||||| || || ||||| ||||| ||||||||
Sbjct: 178 ctctgacaccggcgtcaccaacaataccaatggc 145



to top

>gb|AY488488.1| Capsicum annuum V-type ATPase c subunit mRNA, complete cds
          Length = 640

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 385 atcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgaca 444
           ||||| || ||||| |||||||| |||||||| || || || || ||||| ||||| || 
Sbjct: 358 atcatcccgacgaaaagctttggctgttgcgcgttggctctaacaccagcgtcaccaacg 299

                         
Query: 445 atgccaatggccat 458
           || |||||||||||
Sbjct: 298 attccaatggccat 285



to top

>ref|XM_390178.1| Gibberella zeae PH-1 chromosome 1 VATL_NEUCR Vacuolar ATP synthase
           16 kDa proteolipid subunit (FG10002.1) partial mRNA
          Length = 486

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 430 ccagcatcaccgacaatgccaatggc 455
           ||||||||||||||||| ||||||||
Sbjct: 347 ccagcatcaccgacaataccaatggc 322



to top

>ref|XM_385030.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG04854.1)
           partial mRNA
          Length = 501

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 427 actccagcatcaccgacaatgccaat 452
           |||||||||||||||||||| |||||
Sbjct: 383 actccagcatcaccgacaattccaat 358



to top

>gb|AF008924.1| Aedes aegypti V-ATPase C-subunit mRNA, complete cds
          Length = 854

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 601 cccgccatgacgacgggcacgatggacttcatga 634
           ||||||||||| ||||| | ||||||||||||||
Sbjct: 350 cccgccatgacaacgggaatgatggacttcatga 317



to top

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 54      caataggattaaaacccatattccca 79
               |||||||||||||| |||||||||||
Sbjct: 1247333 caataggattaaaaaccatattccca 1247308



to top

>gb|AC021001.5|AC021001 Homo sapiens chromosome 8, clone RP11-419L20, complete sequence
          Length = 175742

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 9      tcctaaatttattatttagcta 30
              ||||||||||||||||||||||
Sbjct: 143560 tcctaaatttattatttagcta 143539



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 461     cggcggcgagccccgcgaggcc 482
               ||||||||||||||||||||||
Sbjct: 1046763 cggcggcgagccccgcgaggcc 1046784



to top

>dbj|AB003940.1| Acetabularia acetabulum mRNA for vacuolar type H+-ATPase
           proteolipid subunit, complete cds
          Length = 752

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 361 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 420
           |||||||||||||| | ||| | ||||||||| || ||||  || |||||||| ||||||
Sbjct: 506 gcttctgcgaaaatcaaaatcaagatcataccaacaaacaatttaggttgttgggcatta 447

             
Query: 421 gc 422
           ||
Sbjct: 446 gc 445



to top

>gb|AF331918.1| Homo sapiens 19 19q13.3 carnitine acyltransferase-like protein 1
            (CATL1) gene, complete cds; nuclear gene for
            mitochondrial product, alternatively spliced
          Length = 25804

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 342  gagaccgtaaagggcgagcgc 362
            |||||||||||||||||||||
Sbjct: 1263 gagaccgtaaagggcgagcgc 1283



to top

>ref|XM_471460.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1518

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 554  cggtgctgatgatgacggcga 574
            |||||||||||||||||||||
Sbjct: 1329 cggtgctgatgatgacggcga 1349



to top

>ref|XM_655600.1| Aspergillus nidulans FGSC A4 vacuolar ATP synthase 16 kDa
           proteolipid subunit (AN3088.2), mRNA
          Length = 486

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 337 acgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcat 389
           |||||||||||||||||  | ||  |||| |||||||||||||| || |||||
Sbjct: 440 acgatgagaccgtaaagacccagaacttcagcgaaaatgagaataagaatcat 388



to top

>gb|AF480884.1| Chimpanzee cytomegalovirus, complete genome
          Length = 241087

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 562    atgatgacggcgatgatgagg 582
              |||||||||||||||||||||
Sbjct: 134316 atgatgacggcgatgatgagg 134336



to top

>ref|XM_505831.1| Yarrowia lipolytica CLIB122, YALI0F24475g predicted mRNA
          Length = 495

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaa 398
           |||| |||||||||||||| || |||||||| |||||
Sbjct: 424 cttcggcgaaaatgagaataagaatcataccaacgaa 388



to top

>ref|XM_962866.1| PREDICTED: Tribolium castaneum similar to Vacuolar ATP synthase 16
           kDa proteolipid subunit (Ductin) (VHA16K) (LOC656327),
           mRNA
          Length = 877

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 362 cttctgcgaaaatgagaatgaggatcatacccacgaa 398
           |||| ||||||||||| ||||||||||| || |||||
Sbjct: 529 cttcagcgaaaatgaggatgaggatcattccgacgaa 493



to top

>emb|AJ312686.1|HSA312686 Homo sapiens partial LIMD1 gene for LIM domains containing 1, exons
             1-2, complete sequence
          Length = 85000

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    catattcccaggagcagcaat 90
             |||||||||||||||||||||
Sbjct: 64255 catattcccaggagcagcaat 64235



to top

>gb|AC011495.8| Homo sapiens chromosome 19 clone CTB-33G10, complete sequence
          Length = 209844

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 342    gagaccgtaaagggcgagcgc 362
              |||||||||||||||||||||
Sbjct: 115760 gagaccgtaaagggcgagcgc 115780



to top

>gb|AC111399.4| Rattus norvegicus Mcs BAC CH230-138L13 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 210984

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 560   tgatgatgacggcgatgatga 580
             |||||||||||||||||||||
Sbjct: 73703 tgatgatgacggcgatgatga 73723



to top

>ref|XM_627909.1| Cryptosporidium parvum Iowa II vacuolar ATP synthetase subunit
           (cgd1_520), partial mRNA
          Length = 498

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 404 ttggttgttgcgcattagccctgactccagcatcaccgacaatgccaat 452
           |||||||||| |||  ||| || || ||||||||||||||||| |||||
Sbjct: 373 ttggttgttgagcagcagctctaacaccagcatcaccgacaataccaat 325



to top

>gb|AC096975.5| Rattus norvegicus 2 BAC CH230-203P11 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 213875

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 560    tgatgatgacggcgatgatga 580
              |||||||||||||||||||||
Sbjct: 157264 tgatgatgacggcgatgatga 157284



to top

>ref|NM_070587.2| Caenorhabditis elegans Y43D4A.5 (Y43D4A.5) mRNA, complete cds
          Length = 4947

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 211 caaaattagaacttttcaaag 231
           |||||||||||||||||||||
Sbjct: 168 caaaattagaacttttcaaag 188



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 554      cggtgctgatgatgacggcga 574
                |||||||||||||||||||||
Sbjct: 11137398 cggtgctgatgatgacggcga 11137418



to top

>gb|AF222689.1|AF222689 Homo sapiens protein arginine N-methyltransferase 1 (HRMT1L2) gene,
             complete cds, alternatively spliced
          Length = 15382

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 342   gagaccgtaaagggcgagcgc 362
             |||||||||||||||||||||
Sbjct: 15309 gagaccgtaaagggcgagcgc 15329



to top

>gb|BC068333.1| Danio rerio isocitrate dehydrogenase 3 (NAD+) alpha, mRNA (cDNA clone
            MGC:85631 IMAGE:6525521), complete cds
          Length = 1395

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 3    atataatcctaaatttattatttag 27
            |||||||| ||||||||||||||||
Sbjct: 1362 atataatcataaatttattatttag 1338



to top

>ref|NM_200951.2| Danio rerio isocitrate dehydrogenase 3 (NAD+) alpha (idh3a), mRNA
          Length = 1395

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 3    atataatcctaaatttattatttag 27
            |||||||| ||||||||||||||||
Sbjct: 1362 atataatcataaatttattatttag 1338



to top

>emb|X52002.1|TM15KDAM T.marmorata 15 kDa mRNA from a mediatophore
          Length = 616

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 427 actccagcatcaccgacaatgccaatggc 455
           |||||||||||||| || |||||||||||
Sbjct: 417 actccagcatcacctactatgccaatggc 389



to top

>emb|AL132846.1|CEY43D4A Caenorhabditis elegans YAC Y43D4A, complete sequence
          Length = 59321

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   caaaattagaacttttcaaag 231
             |||||||||||||||||||||
Sbjct: 33144 caaaattagaacttttcaaag 33164



to top

>emb|AL731637.2|OSJN00278 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0115I09,
            complete sequence
          Length = 141580

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 554  cggtgctgatgatgacggcga 574
            |||||||||||||||||||||
Sbjct: 6022 cggtgctgatgatgacggcga 6042



to top

>gb|U53182.1|PCU53182 Pleurochrysis carterae V-type ATPase 16 kD proteolipid subunit
           mRNA, partial cds
          Length = 668

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 324 gaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaat 380
           |||||| | ||| |||||||||||||||||  | ||||| || ||||| ||||||||
Sbjct: 309 gaggatcaggccgacgatgagaccgtaaagtccaagcgcctccgcgaagatgagaat 253



to top

>gb|U48365.1|PCU48365 Pleurochrysis carterae V-type ATPase 16 kDa proteolipid subunit
           mRNA, complete cds
          Length = 889

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 324 gaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaat 380
           |||||| | ||| |||||||||||||||||  | ||||| || ||||| ||||||||
Sbjct: 473 gaggatcaggccgacgatgagaccgtaaagtccaagcgcctccgcgaagatgagaat 417


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,155,643
Number of Sequences: 3902068
Number of extensions: 6155643
Number of successful extensions: 132332
Number of sequences better than 10.0: 252
Number of HSP's better than 10.0 without gapping: 247
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 131122
Number of HSP's gapped (non-prelim): 1161
length of query: 733
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 710
effective length of database: 17,143,297,704
effective search space: 12171741369840
effective search space used: 12171741369840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)
to top