ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags9c13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AM156907.1| Zea mays mRNA for transcription factor MYB39 (my... 303 4e-79
2ref|XM_466825.1| Oryza sativa (japonica cultivar-group), mRNA 291 2e-75
3dbj|AK112056.1| Oryza sativa (japonica cultivar-group) cDNA clon... 291 2e-75
4dbj|AB252147.1| Triticum aestivum Tamyb7 mRNA for myb-related pr... 256 9e-65
5gb|AY615199.1| Triticum aestivum transcription factor Myb2 (Myb2... 248 2e-62
6ref|XM_473184.1| Oryza sativa (japonica cultivar-group), predic... 232 1e-57
7gb|AY323484.1| Oryza sativa (japonica cultivar-group) myb-relate... 232 1e-57
8emb|Y11414.1|OSMYB1202 O.sativa mRNA for myb factor, 1202 bp 232 1e-57
9emb|X99973.1|HVMYB4TRF H.vulgare mRNA for myb4 transcription factor 232 1e-57
10gb|AF467733.1| Oryza sativa myb protein mRNA, complete cds 232 1e-57
11dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 206 7e-50
12dbj|AP006523.2| Oryza sativa (japonica cultivar-group) genomic D... 206 7e-50
13gb|AY178579.1| Lolium perenne R2R3 MYB protein MYB4 (Myb4) mRNA,... 192 1e-45
14ref|XM_467269.1| Oryza sativa (japonica cultivar-group), mRNA 168 2e-38
15ref|XM_506902.1| PREDICTED Oryza sativa (japonica cultivar-group... 168 2e-38
16dbj|AK111933.1| Oryza sativa (japonica cultivar-group) cDNA clon... 168 2e-38
17dbj|AK111720.1| Oryza sativa (japonica cultivar-group) cDNA clon... 168 2e-38
18dbj|AP005859.3| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
19dbj|AP004786.3| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
20emb|AM156905.1| Zea mays mRNA for transcription factor MYB8 (myb... 137 6e-29
21dbj|AK111960.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
22gb|AF099440.1|AF099440 Zea mays clone ZmMYBIQ32 R2R3MYB-domain p... 131 3e-27
23gb|AY110666.1| Zea mays CL332_1 mRNA sequence 127 5e-26
24ref|XM_483665.1| Oryza sativa (japonica cultivar-group), mRNA 125 2e-25
25emb|AJ311053.1|OSA311053 Oryza sativa mRNA for Myb15 protein (my... 125 2e-25
26emb|AJ311052.1|OSA311052 Oryza sativa mRNA for Myb13 protein (my... 125 2e-25
27dbj|AK121023.1| Oryza sativa (japonica cultivar-group) cDNA clon... 125 2e-25
28dbj|AK111740.1| Oryza sativa (japonica cultivar-group) cDNA clon... 125 2e-25
29dbj|AK106039.1| Oryza sativa (japonica cultivar-group) cDNA clon... 125 2e-25
30gb|AF099387.1|AF099387 Zea mays clone ZmMYBIF17 R2R3MYB-domain p... 121 3e-24
31dbj|AK063027.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 1e-23
32dbj|D88618.1| Oryza sativa mRNA for OSMYB2, complete cds 119 1e-23
33gb|AF470060.1| Sorghum bicolor P-type R2R3 Myb protein (Myb23) g... 117 5e-23
34emb|X70877.1|HVMYB1 H.vulgare myb1 mRNA 117 5e-23
35gb|AF470059.1| Sorghum bicolor P-type R2R3 Myb protein (Myb9) ge... 115 2e-22
36gb|AF474124.1| Zea mays typical P-type R2R3 Myb protein (Myb56) ... 113 8e-22
37emb|X70876.1|HVMYB2 H.vulgare myb2 mRNA 113 8e-22
38emb|AL731616.5|OSJN00262 Oryza sativa genomic DNA, chromosome 4,... 111 3e-21
39dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 111 3e-21
40dbj|AK111798.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 3e-21
41gb|AF470058.1| Sorghum bicolor P-type R2R3 Myb protein (Myb4) ge... 109 1e-20
42emb|AJ601377.1| Lolium multiflorum partial mRNA for putative R2R... 109 1e-20
43emb|AJ601381.1| Lolium multiflorum partial mRNA for putative R2R... 107 5e-20
44emb|X70879.1|HVMYB1G H.vulgare Myb1 gene 105 2e-19
45gb|AY108280.1| Zea mays PCO132931 mRNA sequence 105 2e-19
46emb|AM156906.1| Zea mays mRNA for transcription factor MYB31 (my... 105 2e-19
47ref|NM_190827.1| Oryza sativa (japonica cultivar-group), predic... 101 3e-18
48gb|AY615198.1| Triticum aestivum transcription factor Myb1 (Myb1... 101 3e-18
49gb|AY459336.1| Oryza sativa (japonica cultivar-group) clone CL03... 101 3e-18
50gb|BT009084.1| Triticum aestivum clone wkm1c.pk005.f4:fis, full ... 101 3e-18
51gb|AF474138.1| Oryza sativa typical P-type R2R3 Myb protein gene... 101 3e-18
52dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
53dbj|AP003912.3| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
54dbj|AK060684.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 3e-18
55gb|AY459342.1| Oryza sativa (japonica cultivar-group) clone CLC1... 100 1e-17
56gb|AF515725.1| Lolium perenne R2R3 MYB protein MYB3 (MYB3) gene,... 100 1e-17
57gb|AF474134.1| Oryza sativa typical P-type R2R3 Myb protein gene... 100 1e-17
58dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 100 1e-17
59dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 100 1e-17
60dbj|AP001552.1| Oryza sativa (japonica cultivar-group) geneomic ... 100 1e-17
61gb|AF099388.1|AF099388 Zea mays clone ZmMYBIF22 R2R3MYB-domain p... 100 1e-17
62gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 100 1e-17
63emb|AL732376.2|CNS08C8Z Oryza sativa chromosome 12, . BAC OSJNBa... 100 1e-17
64gb|AC130600.3| Oryza sativa (japonica cultivar-group) chromosome... 98 5e-17
65ref|XM_475269.1| Oryza sativa (japonica cultivar-group), predic... 98 5e-17
66gb|AF470090.1| Zea mays P-type R2R3 Myb protein (Myb49) gene, co... 98 5e-17
67dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 98 5e-17
68dbj|AK104053.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 5e-17
69dbj|AK099108.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 5e-17
70dbj|AK066834.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 5e-17
71emb|AM156904.1| Zea mays mRNA for transcription factor MYB2 (myb... 98 5e-17
72dbj|D88617.1| Oryza sativa mRNA for OSMYB1, complete cds 98 5e-17
73gb|AF474115.1| Zea mays typical P-type R2R3 Myb protein (Myb1) g... 96 2e-16
74ref|XM_463409.1| Oryza sativa (japonica cultivar-group), predic... 94 8e-16
75gb|AY459344.1| Oryza sativa (japonica cultivar-group) clone CL03... 94 8e-16
76emb|X70880.1|HVMYB2G H.vulgare Myb2 gene 94 8e-16
77gb|AF474140.1| Oryza sativa typical P-type R2R3 Myb protein gene... 94 8e-16
78dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 94 8e-16
79dbj|AP003373.3| Oryza sativa (japonica cultivar-group) genomic D... 94 8e-16
80dbj|AK108259.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 8e-16
81gb|AY108544.1| Zea mays PCO117007 mRNA sequence 94 8e-16
82dbj|D88620.1| Oryza sativa mRNA for OSMYB4, complete cds 94 8e-16
83gb|AF470077.1| Zea mays P-type R2R3 Myb protein (Myb14) gene, pa... 92 3e-15
84gb|AF474122.1| Zea mays typical P-type R2R3 Myb protein (Myb47) ... 92 3e-15
85gb|AF467734.1| Oryza sativa putative myb protein mRNA, partial cds 92 3e-15
86dbj|AP004669.3| Oryza sativa (japonica cultivar-group) genomic D... 92 3e-15
87dbj|AP003297.3| Oryza sativa (japonica cultivar-group) genomic D... 92 3e-15
88dbj|AP003922.2| Oryza sativa (japonica cultivar-group) genomic D... 92 3e-15
89gb|AY459335.1| Oryza sativa (japonica cultivar-group) clone CL02... 90 1e-14
90emb|AL731579.4|OSJN00225 Oryza sativa genomic DNA, chromosome 4,... 90 1e-14
91emb|AL662952.6|OSJN00151 Oryza sativa genomic DNA, chromosome 4,... 90 1e-14
92gb|AF099377.1|AF099377 Zea mays clone ZmMYB4H47 R2R3MYB-domain p... 90 1e-14
93emb|AL713900.4|CNS07YQ0 Oryza sativa chromosome 12, . BAC OJ1126... 90 1e-14
94gb|AF474117.1| Zea mays typical P-type R2R3 Myb protein (Myb18) ... 88 5e-14
95emb|X70881.1|HVMYB3G H.vulgare myb3 gene 88 5e-14
96emb|X70878.1|HVMYB3 H.vulgare myb3 mRNA 88 5e-14
97emb|AM156908.1| Zea mays mRNA for transcription factor MYB42 (my... 88 5e-14
98ref|XM_467636.1| Oryza sativa (japonica cultivar-group), mRNA 86 2e-13
99ref|NM_197015.1| Oryza sativa (japonica cultivar-group) putative... 86 2e-13
100emb|Y11350.1|OSMYB1084 O.sativa mRNA for myb factor, 1084 bp 86 2e-13
101dbj|AK109011.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 2e-13
102dbj|AK108709.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 2e-13
103dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
104dbj|AP006174.3| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
105dbj|AK111966.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 7e-13
106dbj|AK104457.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 7e-13
107dbj|AK104408.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 7e-13
108ref|XM_462805.1| Oryza sativa (japonica cultivar-group), mRNA 82 3e-12
109ref|XM_483052.1| Oryza sativa (japonica cultivar-group), mRNA 82 3e-12
110gb|AY459343.1| Oryza sativa (japonica cultivar-group) clone CL01... 82 3e-12
111gb|AF474139.1| Oryza sativa typical P-type R2R3 Myb protein gene... 82 3e-12
112dbj|AP004376.3| Oryza sativa (japonica cultivar-group) genomic D... 82 3e-12
113dbj|AP003339.4| Oryza sativa (japonica cultivar-group) genomic D... 82 3e-12
114dbj|AP002912.2| Oryza sativa (japonica cultivar-group) genomic D... 82 3e-12
115gb|AF474119.1| Zea mays typical P-type R2R3 Myb protein (Myb26) ... 80 1e-11
116dbj|AB252145.1| Triticum aestivum Tamyb2 mRNA for myb-related pr... 80 1e-11
117emb|X78846.1|ZM38G1 Z.Mays Zm38 gene, intron 1 78 4e-11
118dbj|AK107483.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 4e-11
119emb|AJ601382.1| Festuca arundinacea partial mRNA for putative R2... 76 2e-10
120gb|AY365034.1| Zea mays MYB-like protein 2 mRNA, complete cds 76 2e-10
121gb|AY365033.1| Zea mays MYB-like protein 1 mRNA, complete cds 76 2e-10
122gb|AY111641.1| Zea mays CL1341_1 mRNA sequence 76 2e-10
123gb|AY108777.1| Zea mays PCO139596 mRNA sequence 76 2e-10
124gb|AY672068.1| Hordeum vulgare subsp. vulgare myb transcription ... 74 7e-10
125gb|AF470076.1| Zea mays P-type R2R3 Myb protein (Myb9) gene, par... 74 7e-10
126gb|AF470071.1| Sorghum bicolor P-type R2R3 Myb protein (Myb68) g... 74 7e-10
127emb|AJ576024.1|EGU576024 Eucalyptus gunnii mRNA for MYB transcri... 74 7e-10
128gb|AF514783.1| Lolium perenne R2R3 MYB protein (Myb2) gene, part... 74 7e-10
129dbj|AP005092.3| Oryza sativa (japonica cultivar-group) genomic D... 74 7e-10
130dbj|AP005314.2| Oryza sativa (japonica cultivar-group) genomic D... 74 7e-10
131gb|AF099369.1|AF099369 Zea mays clone ZmMYB1H32 R2R3MYB-domain p... 72 3e-09
132ref|NM_187376.1| Oryza sativa (japonica cultivar-group), mRNA 70 1e-08
133gb|AF470072.1| Zea mays A-type R2R3 Myb protein (Myb5) gene, par... 70 1e-08
134gb|AF470068.1| Sorghum bicolor P-type R2R3 Myb protein (Myb41) g... 70 1e-08
135gb|AF474125.1| Sorghum bicolor typical A-type R2R3 Myb protein (... 70 1e-08
136gb|AY363141.1| Sorghum bicolor P-type R2R3 Myb protein (Myb48) g... 70 1e-08
137gb|AY363140.1| Sorghum bicolor P-type R2R3 Myb protein (Myb47) g... 70 1e-08
138gb|AY363139.1| Sorghum bicolor P-type R2R3 Myb protein (Myb43) g... 70 1e-08
139dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 70 1e-08
140gb|AF210619.1|AF210619S1 Zea mays subsp. parviglumis P-like prot... 70 1e-08
141dbj|AP004006.5| Oryza sativa (japonica cultivar-group) genomic D... 70 1e-08
142dbj|AP004259.2| Oryza sativa (japonica cultivar-group) genomic D... 70 1e-08
143dbj|AP005619.3| Oryza sativa (japonica cultivar-group) genomic D... 70 1e-08
144dbj|AP005527.3| Oryza sativa (japonica cultivar-group) genomic D... 70 1e-08
145dbj|AP005319.3| Oryza sativa (japonica cultivar-group) genomic D... 70 1e-08
146emb|X78845.1|ZM1G12 Z.Mays Zm1 gene, introns 1 and 2 70 1e-08
147ref|XM_482497.1| Oryza sativa (japonica cultivar-group), mRNA 68 4e-08
148ref|NM_189302.1| Oryza sativa (japonica cultivar-group), predic... 68 4e-08
149gb|AF470063.1| Sorghum bicolor P-type R2R3 Myb protein (Myb5) ge... 68 4e-08
150gb|BT009312.1| Triticum aestivum clone wlm1.pk0027.a5:fis, full ... 68 4e-08
151emb|AJ311051.1|OSA311051 Oryza sativa mRNA for Myb51 protein (my... 68 4e-08
152dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 68 4e-08
153gb|AC037425.7|AC037425 Oryza sativa chromosome 10 BAC OSJNBa0055... 68 4e-08
154dbj|AP002873.2| Oryza sativa (japonica cultivar-group) genomic D... 68 4e-08
155dbj|AP002871.2| Oryza sativa (japonica cultivar-group) genomic D... 68 4e-08
156dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic D... 68 4e-08
157dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic D... 68 4e-08
158gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 68 4e-08
159ref|XM_472754.1| Oryza sativa (japonica cultivar-group), predic... 66 2e-07
160emb|AJ601376.1| Lolium multiflorum partial mRNA for putative R2R... 66 2e-07
161gb|AY555190.1| Vitis vinifera Myb transcription factor (MybCs1) ... 66 2e-07
162gb|DQ277688.1| Vitis vinifera isolate GNF24 MYB-like protein mRN... 66 2e-07
163gb|DQ277687.1| Vitis vinifera isolate GNF22 MYB-like protein mRN... 66 2e-07
164gb|DQ277673.1| Vitis vinifera isolate GNS17 MYB-like protein mRN... 66 2e-07
165gb|AY899404.1| Vitis vinifera MYB5b mRNA, complete cds 66 2e-07
166ref|XM_473295.1| Oryza sativa (japonica cultivar-group), predic... 64 7e-07
167gb|AF470088.1| Zea mays P-type R2R3 Myb protein (Myb41) gene, pa... 64 7e-07
168gb|AF470084.1| Zea mays P-type R2R3 Myb protein (Myb34) gene, pa... 64 7e-07
169gb|AF470075.1| Zea mays A-type R2R3 Myb protein (Myb8) gene, par... 64 7e-07
170gb|AF470073.1| Zea mays A-type R2R3 Myb protein (Myb6) gene, par... 64 7e-07
171gb|AF474116.1| Zea mays typical P-type R2R3 Myb protein (Myb3) g... 64 7e-07
172emb|Z11879.1|ZMAYSPG Z.mays P gene 64 7e-07
173gb|AF427146.1|AF427146 Zea mays myb-like transcription factor (P... 64 7e-07
174gb|AY860968.1| Sorghum bicolor yellow seed1 (y1) gene, y1-rr all... 64 7e-07
175gb|AF210617.1|AF210617 Zea mays subsp. parviglumis P2-t protein ... 64 7e-07
176gb|AF099376.1|AF099376 Zea mays clone ZmMYB4H29 R2R3MYB-domain p... 64 7e-07
177gb|AY702552.1| Zea mays Myb-like transcription factor P1 (P1) ge... 64 7e-07
178gb|AY104089.1| Zea mays PCO146624 mRNA sequence 64 7e-07
179gb|U57002.1|ZMU57002 Zea mays P protein (P) mRNA, complete cds 64 7e-07
180gb|M73029.1|MZEPPRA Zea mays myb-like transcription factor (P) p... 64 7e-07
181gb|M73028.1|MZEPPR Zea mays protein homologous to the DNA-bindin... 64 7e-07
182ref|XM_478689.1| Oryza sativa (japonica cultivar-group), mRNA 62 3e-06
183gb|AF474133.1| Sorghum bicolor typical P-type R2R3 Myb protein (... 62 3e-06
184gb|AF474131.1| Sorghum bicolor typical P-type R2R3 Myb protein (... 62 3e-06
185gb|AF474130.1| Sorghum bicolor typical P-type R2R3 Myb protein (... 62 3e-06
186emb|Y11415.1|OSMYB1355 O.sativa mRNA for myb factor, 1355 bp 62 3e-06
187gb|AF210616.1|AF210616 Zea mays P2 protein (P2) gene, complete cds 62 3e-06
188gb|AF099402.1|AF099402 Zea mays clone ZmMYBIM16 R2R3MYB-domain p... 62 3e-06
189ref|NM_191815.1| Oryza sativa (japonica cultivar-group), predic... 60 1e-05
190gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genom... 60 1e-05
191gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 60 1e-05
192gb|AF474120.1| Zea mays typical P-type R2R3 Myb protein (Myb30) ... 60 1e-05
193dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 60 1e-05
194dbj|AP003229.3| Oryza sativa (japonica cultivar-group) genomic D... 60 1e-05
195dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 60 1e-05
196ref|XM_482584.1| Oryza sativa (japonica cultivar-group), mRNA 58 4e-05
197ref|NM_192221.1| Oryza sativa (japonica cultivar-group), predic... 58 4e-05
198ref|XM_470783.1| Oryza sativa (japonica cultivar-group), mRNA 58 4e-05
199gb|AC135794.3| Oryza sativa (japonica cultivar-group) chromosome... 58 4e-05
200gb|AC134044.4| Oryza sativa (japonica cultivar-group) chromosome... 58 4e-05
201gb|AC098833.2| Oryza sativa (japonica cultivar-group) chromosome... 58 4e-05
202gb|AC118285.2| Oryza sativa (japonica cultivar-group) chromosome... 58 4e-05
203gb|AF470061.1| Sorghum bicolor P-type R2R3 Myb protein (Myb44) g... 58 4e-05
204gb|AY363132.1| Sorghum bicolor P-type R2R3 Myb protein (Myb30) g... 58 4e-05
205gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genom... 58 4e-05
206emb|AL606460.3|OSJN00003 Oryza sativa genomic DNA, chromosome 4,... 58 4e-05
207emb|AJ601383.1| Festuca arundinacea partial mRNA for putative R2... 58 4e-05
208gb|AC165178.2| Zea mays clone ZMMBBb-272P17, complete sequence 58 4e-05
209gb|AF474137.1| Oryza sativa typical P-type R2R3 Myb protein gene... 58 4e-05
210dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 58 4e-05
211dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic D... 58 4e-05
212gb|DQ074467.1| Malus x domestica MYB19 mRNA, complete cds 58 4e-05
213dbj|AP005636.2| Oryza sativa (japonica cultivar-group) genomic D... 58 4e-05
214dbj|AP005159.3| Oryza sativa (japonica cultivar-group) genomic D... 58 4e-05
215dbj|AK111782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 4e-05
216gb|AF099422.1|AF099422 Zea mays clone ZmMYBIP148 R2R3MYB-domain ... 58 4e-05
217gb|AF111710.1|AF111710 Oryza sativa subsp. indica putative dnaJ-... 58 4e-05
218gb|DQ277686.1| Vitis vinifera isolate GNF21 MYB-like protein mRN... 58 4e-05
219gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 58 4e-05
220emb|AL731887.5|CNS08C8R Oryza sativa chromosome 12, . BAC OJ1559... 58 4e-05
221emb|AL831809.3|CNS08CAM Oryza sativa chromosome 12, . BAC OJ1268... 58 4e-05
222ref|XM_467854.1| Oryza sativa (japonica cultivar-group), mRNA 56 2e-04
223ref|XM_466994.1| Oryza sativa (japonica cultivar-group), mRNA 56 2e-04
224gb|BT008981.2| Triticum aestivum clone wdk2c.pk006.d4:fis, full ... 56 2e-04
225emb|Y11351.1|OSMYB1402 O.sativa mRNA for myb factor, 1402 bp 56 2e-04
226dbj|AP003723.3| Oryza sativa (japonica cultivar-group) genomic D... 56 2e-04
227dbj|AP005421.3| Oryza sativa (japonica cultivar-group) genomic D... 56 2e-04
228dbj|AP005321.2| Oryza sativa (japonica cultivar-group) genomic D... 56 2e-04
229dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic D... 56 2e-04
230dbj|AK111697.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 2e-04
231dbj|AK108621.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 2e-04
232dbj|AK069082.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 2e-04
233dbj|AK064679.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 2e-04
234ref|NM_184207.2| Oryza sativa (japonica cultivar-group), mRNA 54 6e-04
235ref|NM_183669.1| Oryza sativa (japonica cultivar-group), predic... 54 6e-04
236gb|AF470089.1| Zea mays P-type R2R3 Myb protein (Myb48) gene, pa... 54 6e-04
237gb|AF470086.1| Zea mays P-type R2R3 Myb protein (Myb36) gene, pa... 54 6e-04
238gb|AF470070.1| Sorghum bicolor P-type R2R3 Myb protein (Myb66) g... 54 6e-04
239gb|AF470069.1| Sorghum bicolor P-type R2R3 Myb protein (Myb46) g... 54 6e-04
240gb|AF474129.1| Sorghum bicolor typical P-type R2R3 Myb protein (... 54 6e-04
241gb|AF474127.1| Sorghum bicolor typical P-type R2R3 Myb protein (... 54 6e-04
242gb|AF474123.1| Zea mays typical P-type R2R3 Myb protein (Myb55) ... 54 6e-04
243gb|AY363161.1| Sorghum bicolor P-type R2R3 Myb protein (Myb86) g... 54 6e-04
244gb|AY363136.1| Sorghum bicolor P-type R2R3 Myb protein (Myb36) g... 54 6e-04
245gb|AY459337.1| Oryza sativa (japonica cultivar-group) clone CL00... 54 6e-04
246gb|AC137267.2| Genomic sequence for Oryza sativa, Nipponbare str... 54 6e-04
247gb|AF485899.1| Dendrobium sp. XMW-2002-8 MYB8 (MYB8) mRNA, compl... 54 6e-04
248emb|AJ495785.1|OSA495785 Oryza sativa (japonica cultivar-group) ... 54 6e-04
249gb|DQ075263.2| Oryza sativa (japonica cultivar-group) MYB transc... 54 6e-04
250gb|DQ075262.1| Oryza sativa (japonica cultivar-group) MYB transc... 54 6e-04
251gb|DQ075261.1| Oryza sativa (japonica cultivar-group) MYB transc... 54 6e-04
252gb|AF474141.1| Oryza sativa typical A-type R2R3 Myb protein gene... 54 6e-04
253dbj|AB073017.1| Vitis labrusca x Vitis vinifera VlmybB1-2 mRNA f... 54 6e-04
254dbj|AB073016.1| Vitis labrusca x Vitis vinifera VlmybB1-1 mRNA f... 54 6e-04
255gb|AC137697.2| Genomic sequence for Oryza sativa, Nipponbare str... 54 6e-04
256gb|AC122149.2| Oryza sativa (japonica cultivar-group) chromosome... 54 6e-04
257dbj|AP003140.2| Oryza sativa (japonica cultivar-group) genomic D... 54 6e-04
258dbj|AP002883.2| Oryza sativa (japonica cultivar-group) genomic D... 54 6e-04
259gb|AY178578.1| Lolium perenne R2R3 MYB protein MYB1 (Myb1) mRNA,... 54 6e-04
260dbj|AP006161.3| Oryza sativa (japonica cultivar-group) genomic D... 54 6e-04
261dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic D... 54 6e-04
262dbj|AP002860.1| Oryza sativa (japonica cultivar-group) genomic D... 54 6e-04
263dbj|AK107424.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 6e-04
264dbj|AK107214.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 6e-04
265gb|AF099428.1|AF099428 Zea mays clone ZmMYBIP29 R2R3MYB-domain p... 54 6e-04
266gb|AF099396.1|AF099396 Zea mays clone ZmMYBIF41 R2R3MYB-domain p... 54 6e-04
267gb|AY107263.1| Zea mays PCO113331 mRNA sequence 54 6e-04
268emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa... 54 6e-04
269ref|NM_112118.2| Arabidopsis thaliana DNA binding / transcriptio... 52 0.003
270ref|NM_120023.2| Arabidopsis thaliana MYB4; transcription factor... 52 0.003
271ref|XM_466772.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.003
272ref|XM_506868.1| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.003
273gb|AC135190.2| Oryza sativa (japonica cultivar-group) chromosome... 52 0.003
274gb|AC133450.6| Oryza sativa chromosome 3 BAC OSJNBa0072F13 genom... 52 0.003
275gb|AC136956.4| Oryza sativa (japonica cultivar-group) chromosome... 52 0.003
276gb|AY503574.1| Sorghum bicolor clone 0860-SC0706 RFLP probe pSB0860 52 0.003
277gb|AY503573.1| Sorghum bicolor clone 0860-SC0599 RFLP probe pSB0860 52 0.003
278gb|AY503572.1| Sorghum bicolor clone 0860-SC0326 RFLP probe pSB0860 52 0.003
279gb|AY503571.1| Sorghum bicolor clone 0860-SC0155 RFLP probe pSB0860 52 0.003
280gb|AY503570.1| Sorghum bicolor clone 0860-SC0033 RFLP probe pSB0860 52 0.003
281gb|AY503569.1| Sorghum bicolor clone 0860-BTx406 RFLP probe pSB0860 52 0.003
282gb|AY503568.1| Sorghum arundinaceum clone 0860-LWA8 RFLP probe p... 52 0.003
283gb|AY503567.1| Sorghum arundinaceum clone 0860-LWA4 RFLP probe p... 52 0.003
284gb|AY503566.1| Sorghum bicolor clone 0860-92381 RFLP probe pSB0860 52 0.003
285gb|AY503565.1| Sorghum bicolor clone 0860-82459 RFLP probe pSB0860 52 0.003
286gb|AY503564.1| Sorghum bicolor clone 0860-77034 RFLP probe pSB0860 52 0.003
287gb|AY503563.1| Sorghum bicolor clone 0860-56174 RFLP probe pSB0860 52 0.003
288gb|AY503562.1| Sorghum bicolor clone 0860-514605 RFLP probe pSB0860 52 0.003
289gb|AY503561.1| Sorghum bicolor clone 0860-51030 RFLP probe pSB0860 52 0.003
290gb|AY503560.1| Sorghum bicolor clone 0860-50875 RFLP probe pSB0860 52 0.003
291gb|AY503559.1| Sorghum bicolor clone 0860-267380 RFLP probe pSB0860 52 0.003
292gb|AY503558.1| Sorghum bicolor clone 0860-257595 RFLP probe pSB0860 52 0.003
293gb|AY503557.1| Sorghum bicolor clone 0860-246712 RFLP probe pSB0860 52 0.003
294gb|AY503556.1| Sorghum bicolor clone 0860-22913 RFLP probe pSB0860 52 0.003
295gb|AY503555.1| Sorghum arundinaceum clone 0860-225905 RFLP probe... 52 0.003
296gb|AY503554.1| Sorghum bicolor clone 0860-195684 RFLP probe pSB0860 52 0.003
297gb|AY503553.1| Sorghum bicolor clone 0860-152702 RFLP probe pSB0860 52 0.003
298gb|AY503552.1| Sorghum bicolor clone 0860-102069 RFLP probe pSB0860 52 0.003
299gb|AY503551.1| Sorghum bicolor clone 0860-RTx430 RFLP probe pSB0860 52 0.003
300gb|AY503550.1| Sorghum bicolor clone 0860-BTx3197 RFLP probe pSB... 52 0.003
301gb|AY519615.1| Arabidopsis thaliana MYB transcription factor (At... 52 0.003
302gb|AY519586.1| Arabidopsis thaliana MYB transcription factor (At... 52 0.003
303gb|AF470067.1| Sorghum bicolor P-type R2R3 Myb protein (Myb38) g... 52 0.003
304gb|AF470064.1| Sorghum bicolor P-type R2R3 Myb protein (Myb6) ge... 52 0.003
305gb|AF470062.1| Sorghum bicolor P-type R2R3 Myb protein (Myb64) g... 52 0.003
306gb|AY363160.1| Sorghum bicolor P-type R2R3 Myb protein (Myb85) g... 52 0.003
307gb|AY363159.1| Sorghum bicolor P-type R2R3 Myb protein (Myb84) g... 52 0.003
308gb|AY363158.1| Sorghum bicolor P-type R2R3 Myb protein (Myb83) g... 52 0.003
309gb|AY363157.1| Sorghum bicolor P-type R2R3 Myb protein (Myb82) g... 52 0.003
310gb|AY363156.1| Sorghum bicolor P-type R2R3 Myb protein (Myb81) g... 52 0.003
311gb|AY363155.1| Sorghum bicolor P-type R2R3 Myb protein (Myb80) g... 52 0.003
312gb|AY363154.1| Sorghum bicolor P-type R2R3 Myb protein (Myb78) g... 52 0.003
313gb|AY363153.1| Sorghum bicolor P-type R2R3 Myb protein (Myb77) g... 52 0.003
314gb|AY363150.1| Sorghum bicolor P-type R2R3 Myb protein (Myb74) g... 52 0.003
315gb|AY363146.1| Sorghum bicolor P-type R2R3 Myb protein (Myb56) g... 52 0.003
316gb|AY363144.1| Sorghum bicolor P-type R2R3 Myb protein (Myb52) g... 52 0.003
317gb|AY363143.1| Sorghum bicolor P-type R2R3 Myb protein (Myb50) g... 52 0.003
318gb|AY363142.1| Sorghum bicolor P-type R2R3 Myb protein (Myb49) g... 52 0.003
319gb|AY363138.1| Sorghum bicolor P-type R2R3 Myb protein (Myb40) g... 52 0.003
320gb|AY363137.1| Sorghum bicolor P-type R2R3 Myb protein (Myb39) g... 52 0.003
321gb|AY363135.1| Sorghum bicolor P-type R2R3 Myb protein (Myb35) g... 52 0.003
322gb|AY363134.1| Sorghum bicolor P-type R2R3 Myb protein (Myb33) g... 52 0.003
323gb|AY363133.1| Sorghum bicolor P-type R2R3 Myb protein (Myb32) g... 52 0.003
324gb|AY363130.1| Sorghum bicolor P-type R2R3 Myb protein (Myb26) g... 52 0.003
325gb|AY363129.1| Sorghum bicolor P-type R2R3 Myb protein (Myb24) g... 52 0.003
326gb|AY363126.1| Sorghum bicolor P-type R2R3 Myb protein (Myb17) g... 52 0.003
327gb|AY363124.1| Sorghum bicolor P-type R2R3 Myb protein (Myb15) g... 52 0.003
328gb|AY363123.1| Sorghum bicolor P-type R2R3 Myb protein (Myb14) g... 52 0.003
329gb|AY363122.1| Sorghum bicolor P-type R2R3 Myb protein (Myb11) g... 52 0.003
330gb|AY363121.1| Sorghum bicolor P-type R2R3 Myb protein (Myb10) g... 52 0.003
331gb|AY363120.1| Sorghum bicolor P-type R2R3 Myb protein (Myb8) ge... 52 0.003
332gb|AY363119.1| Sorghum bicolor P-type R2R3 Myb protein (Myb3) ge... 52 0.003
333gb|AY123004.1| Arabidopsis thaliana putative transcription facto... 52 0.003
334gb|AY070100.1| Arabidopsis thaliana putative transcription facto... 52 0.003
335emb|AL161593.2|ATCHRIV89 Arabidopsis thaliana DNA chromosome 4, ... 52 0.003
336emb|AL035656.1|ATT9A14 Arabidopsis thaliana DNA chromosome 4, BA... 52 0.003
337gb|AY140037.1| Arabidopsis thaliana putative transcription facto... 52 0.003
338gb|AY026332.1| Oryza sativa Myb transcription factor JAMyb mRNA,... 52 0.003
339gb|BT006302.1| Arabidopsis thaliana At4g38620 mRNA, complete cds 52 0.003
340gb|AC069558.5|AC069558 Genomic Sequence For Arabidopsis thaliana... 52 0.003
341gb|AC069327.7|AC069327 Genomic Sequence For Arabidopsis thaliana... 52 0.003
342dbj|AP003980.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.003
343dbj|AP004083.2| Oryza sativa (japonica cultivar-group) genomic D... 52 0.003
344dbj|AB024033.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 52 0.003
345dbj|AB044084.1| Triticum aestivum mRNA for GAMyb protein, partia... 52 0.003
346dbj|AK112018.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.003
347dbj|AK111807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.003
348dbj|AK110844.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.003
349dbj|AK099283.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.003
350gb|AF099431.1|AF099431 Zea mays clone ZmMYBIP39 R2R3MYB-domain p... 52 0.003
351gb|AF099414.1|AF099414 Zea mays clone ZmMYBIM66 R2R3MYB-domain p... 52 0.003
352gb|AF099407.1|AF099407 Zea mays clone ZmMYBIM42 R2R3MYB-domain p... 52 0.003
353gb|AF099378.1|AF099378 Zea mays clone ZmMYB4H48 R2R3MYB-domain p... 52 0.003
354gb|AF114162.1|AF114162 Lolium temulentum gibberellin MYB transcr... 52 0.003
355gb|AF062862.1|AF062862 Arabidopsis thaliana putative transcripti... 52 0.003
356gb|AF062860.1|AF062860 Arabidopsis thaliana putative transcripti... 52 0.003
357emb|AL731591.3|OSJN00240 Oryza sativa genomic DNA, chromosome 4,... 52 0.003
358emb|AL035540.1|ATF20M13 Arabidopsis thaliana DNA chromosome 4, B... 52 0.003
359ref|NM_113226.3| Arabidopsis thaliana DNA binding / transcriptio... 50 0.010
360ref|NM_001035670.1| Arabidopsis thaliana DNA binding AT3G23250 t... 50 0.010
361ref|XM_475870.1| Oryza sativa (japonica cultivar-group), predic... 50 0.010
362ref|NM_193333.1| Oryza sativa (japonica cultivar-group), predic... 50 0.010
363ref|XM_472336.1| Oryza sativa (japonica cultivar-group), predic... 50 0.010
364gb|AC137621.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.010
365gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome... 50 0.010
366gb|AC093956.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.010
367gb|AY550296.1| Arabidopsis thaliana MYB transcription factor (At... 50 0.010
368gb|AF474118.1| Zea mays typical P-type R2R3 Myb protein (Myb24) ... 50 0.010
369emb|Y14207.1|ATY14207 A.thaliana mRNA for AtMYB15 R2R3-MYB trans... 50 0.010
370emb|X90384.1|ATY19GENE A.thaliana DNA for Y19 gene 50 0.010
371emb|AJ495784.1|OSA495784 Oryza sativa (japonica cultivar-group) ... 50 0.010
372emb|BX823624.1|CNS0A5AL Arabidopsis thaliana Full-length cDNA Co... 50 0.010
373dbj|AP004232.4| Oryza sativa (japonica cultivar-group) genomic D... 50 0.010
374dbj|AP004231.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.010
375dbj|AP005849.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.010
376dbj|AP004046.2| Oryza sativa (japonica cultivar-group) genomic D... 50 0.010
377dbj|AK176693.1| Arabidopsis thaliana mRNA for putative myb-relat... 50 0.010
378dbj|AK176617.1| Arabidopsis thaliana mRNA for putative myb-relat... 50 0.010
379dbj|AB025608.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 50 0.010
380dbj|AK111821.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
381dbj|AK108452.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
382dbj|AK104345.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
383dbj|AK099636.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
384gb|AF099417.1|AF099417 Zea mays clone ZmMYBIP114 R2R3MYB-domain ... 50 0.010
385gb|AF099368.1|AF099368 Zea mays clone ZmMYB1G26 R2R3MYB-domain p... 50 0.010
386ref|NM_104495.1| Arabidopsis thaliana DNA binding / transcriptio... 48 0.040
387ref|NM_110979.2| Arabidopsis thaliana MYB106; DNA binding / tran... 48 0.040
388ref|NM_117888.2| Arabidopsis thaliana DNA binding / transcriptio... 48 0.040
389ref|XM_550262.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.040
390ref|XM_480122.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.040
391ref|NM_189493.1| Oryza sativa (japonica cultivar-group), predic... 48 0.040
392ref|XM_473120.1| Oryza sativa (japonica cultivar-group), predic... 48 0.040
393gb|L19495.1| Zea mays transcriptional activator gene, complete cds 48 0.040
394gb|DQ470841.1| Zea mays truncated Pl1 transcription factor (pl1)... 48 0.040
395gb|AY550297.1| Arabidopsis thaliana MYB transcription factor (At... 48 0.040
396gb|AY519581.1| Arabidopsis thaliana MYB transcription factor (At... 48 0.040
397gb|AF470087.1| Zea mays R2R3 Myb protein (Myb39) gene, partial cds 48 0.040
398gb|AF470080.1| Zea mays P-type R2R3 Myb protein (Myb23) gene, pa... 48 0.040
399gb|AY363147.1| Sorghum bicolor P-type R2R3 Myb protein (Myb60) g... 48 0.040
400gb|AY135019.1| Zea mays PL transcription factor (pl) mRNA, pl-W2... 48 0.040
401gb|AY135018.1| Zea mays PL transcription factor (pl) mRNA, pl-bo... 48 0.040
402gb|AY135017.1| Zea mays PL transcription factor (pl) gene, pl-bo... 48 0.040
403gb|AY135016.1| Zea mays PL transcription factor (pl) gene, pl-bo... 48 0.040
404gb|AC009894.2| Arabidopsis thaliana chromosome I BAC T6H22 genom... 48 0.040
405gb|AC008261.5|ATAC008261 Arabidopsis thaliana chromosome III BAC... 48 0.040
406gb|AY398581.1| Oryza sativa (indica cultivar-group) Myb factor p... 48 0.040
407gb|BT009536.1| Triticum aestivum clone wr1.pk0139.g11:fis, full ... 48 0.040
408gb|BT009018.1| Triticum aestivum clone wdk3c.pk006.n12:fis, full... 48 0.040
409emb|Z97344.2|ATFCA9 Arabidopsis thaliana DNA chromosome 4, ESSA ... 48 0.040
410emb|X67051.1|PPPP1RNA P.patens mRNA Pp1 48 0.040
411emb|AL663006.3|OSJN00204 Oryza sativa genomic DNA, chromosome 4,... 48 0.040
412emb|AL662969.3|OSJN00169 Oryza sativa genomic DNA, chromosome 4,... 48 0.040
413emb|AL161547.2|ATCHRIV47 Arabidopsis thaliana DNA chromosome 4, ... 48 0.040
414emb|AJ237661.1|OSA237661 Oryza sativa mRNA for Myb factor protei... 48 0.040
415gb|DQ394071.1| Zea mays non-functional purple plant 1 transcript... 48 0.040
416gb|DQ379502.1| Zea mays PL1 transcription factor-like (pl1) gene... 48 0.040
417gb|DQ379501.1| Zea mays PL1 transcription factor (pl1) gene, pl1... 48 0.040
418gb|DQ379500.1| Zea mays PL1 transcription factor (pl1) gene, pl1... 48 0.040
419gb|DQ379499.1| Zea mays PL1 transcription factor (pl1) gene, pl1... 48 0.040
420gb|AF249309.1|AF249309 Arabidopsis thaliana putative transcripti... 48 0.040
421gb|AF175989.1|AF175989 Arabidopsis thaliana putative transcripti... 48 0.040
422gb|AF292553.1|AF292553 Tripsacum dactyloides 1008.8c CI protein ... 48 0.040
423gb|AF292551.1|AF292551 Zea luxurians M018-1 CI protein (c1) gene... 48 0.040
424gb|AF292547.1|AF292547 Zea luxurians PI21879 CI protein (c1) gen... 48 0.040
425gb|AF292546.1|AF292546 Zea luxurians PI21866 CI protein (c1) gen... 48 0.040
426gb|AF320112.1|AF320112 Sorghum bicolor Myb1-like protein gene, p... 48 0.040
427emb|BX815211.1|CNS0AAGG Arabidopsis thaliana Full-length cDNA Co... 48 0.040
428gb|AC069159.8|AC069159 Arabidopsis thaliana chromosome 1 BAC F14... 48 0.040
429gb|BT005642.1| Arabidopsis thaliana clone U51012 putative MYB tr... 48 0.040
430dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.040
431gb|DQ108717.1| Arabidopsis thaliana clone 126147 mRNA sequence 48 0.040
432gb|AY569615.1| Oryza sativa (japonica cultivar-group) MYB transc... 48 0.040
433dbj|AP004133.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.040
434dbj|AP004461.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.040
435dbj|AK118728.1| Arabidopsis thaliana At4g17780 mRNA for putative... 48 0.040
436dbj|AK112117.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.040
437dbj|AK111808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.040
438emb|X96750.1|OSMYB71 O.sativa myb7 gene, clone myb71 48 0.040
439dbj|AK109620.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.040
440gb|AF099401.1|AF099401 Zea mays clone ZmMYBIF8 R2R3MYB-domain pr... 48 0.040
441gb|AF099393.1|AF099393 Zea mays clone ZmMYBIF33 R2R3MYB-domain p... 48 0.040
442gb|AF099370.1|AF099370 Zea mays clone ZmMYB1H48 R2R3MYB-domain p... 48 0.040
443gb|AY530952.1| Zea mays unknown (Z576C20.2), putative heme oxyge... 48 0.040
444dbj|AK066180.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.040
445dbj|AK061823.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.040
446gb|AY112586.1| Zea mays CL346_1 mRNA sequence 48 0.040
447gb|AF062905.1|AF062905 Arabidopsis thaliana putative transcripti... 48 0.040
448gb|AF015269.1|AF015269 Zea mays retrotransposon Magellan, comple... 48 0.040
449gb|AF015268.1|AF015268 Zea mays PL transcription factor (Pl) gen... 48 0.040
450gb|L13454.1|MZEPLBH Zea mays Pl-Bh (Blotched1) gene, complete cds 48 0.040
451gb|L19494.1|MZEPLTANSA Zea mays PL transcriptional activator gen... 48 0.040
452gb|L19496.1|MZETRACTB Zea mays transcriptional activator for ant... 48 0.040
453ref|NM_191052.1| Oryza sativa (japonica cultivar-group), predic... 46 0.16
454ref|XM_479227.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.16
455gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chr... 46 0.16
456gb|AY615200.1| Triticum aestivum transcription factor Myb3 (Myb3... 46 0.16
457gb|AY323480.1| Oryza sativa (japonica cultivar-group) putative m... 46 0.16
458emb|X98355.1|OSGAMYB O.sativa mRNA for transcription activator, ... 46 0.16
459emb|X96749.1|OSMYB72 O.sativa myb7 gene, clone myb72 46 0.16
460emb|X87690.1|HVRNAGAM1 H.vulgare mRNA for GAMyb protein 46 0.16
461dbj|AB214883.1| Triticum monococcum mRNA for transcription facto... 46 0.16
462dbj|AP003570.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.16
463gb|AY083610.1| Oryza sativa myb protein (Myb) mRNA, partial cds 46 0.16
464gb|AF329764.1|AF329764 Zea diploperennis isolate d2b transcripti... 46 0.16
465gb|AY008692.1| Hordeum vulgare transcription factor GAMyb (Gamyb... 46 0.16
466gb|AF521880.1| Zea mays R2R3 Myb transcription factor MYB-IF35 m... 46 0.16
467dbj|AP004306.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.16
468dbj|AP004260.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.16
469dbj|AP003247.4| Oryza sativa (japonica cultivar-group) genomic D... 46 0.16
470dbj|AP003488.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.16
471dbj|AP004727.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.16
472dbj|AP005747.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.16
473dbj|AP005686.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.16
474dbj|AK119607.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.16
475dbj|AK102841.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.16
476dbj|AK101674.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.16
477dbj|AK072403.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.16
478gb|AF099441.1|AF099441 Zea mays clone ZmMYBIQ68 R2R3MYB-domain p... 46 0.16
479gb|AF099436.1|AF099436 Zea mays clone ZmMYBIP59 R2R3MYB-domain p... 46 0.16
480gb|AF099410.1|AF099410 Zea mays clone ZmMYBIM49 R2R3MYB-domain p... 46 0.16
481gb|AF099408.1|AF099408 Zea mays clone ZmMYBIM44 R2R3MYB-domain p... 46 0.16
482gb|AF099394.1|AF099394 Zea mays clone ZmMYBIF35 R2R3MYB-domain p... 46 0.16
483dbj|AK063951.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.16
484gb|AY112591.1| Zea mays CL1320_1 mRNA sequence 46 0.16
485emb|AL928753.3|CNS08CBQ Oryza sativa chromosome 12, . BAC OSJNBb... 46 0.16
486ref|XM_483655.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.62
487ref|XM_483654.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.62
488ref|XM_480985.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.62
489ref|XM_463865.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.62
490ref|XM_470731.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.62
491gb|AC108872.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.62
492gb|AF470074.1| Zea mays A-type R2R3 Myb protein (Myb7) gene, par... 44 0.62
493gb|AF474128.1| Sorghum bicolor typical P-type R2R3 Myb protein (... 44 0.62
494gb|AY363149.1| Sorghum bicolor P-type R2R3 Myb protein (Myb65) g... 44 0.62
495gb|AC137751.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.62
496gb|AY459340.1| Oryza sativa (japonica cultivar-group) clone CL00... 44 0.62
497gb|AC155341.1| Brassica rapa subsp. pekinensis chromosome 6 clon... 44 0.62
498gb|AF485898.1| Dendrobium sp. XMW-2002-7 MYB7 (MYB7) mRNA, parti... 44 0.62
499emb|AL592402.12| Human DNA sequence from clone RP11-554K11 on ch... 44 0.62
500gb|AC123525.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.62

>emb|AM156907.1| Zea mays mRNA for transcription factor MYB39 (myb39 gene)
          Length = 1078

 Score =  303 bits (153), Expect = 4e-79
 Identities = 228/252 (90%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
           |||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 495 cgcttcttgaggtgggtgtgccagacgttcttgatctcgttgtccgtcctccccggcagc 436

                                                                       
Query: 501 ctggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccc 560
           ||||| || || || ||||||||||||||||||||   ||||||||| ||||||||| ||
Sbjct: 435 ctggcagcgattgtcgaccatctgttgccgagcatttggtggagctgtatgatggcgtcc 376

                                                                       
Query: 561 tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
           |||||||| | | ||||||||||||||||||||||||||||| |||||||||||||| ||
Sbjct: 375 tcctcctcccggctgaagttgccgcgcttgatgtcggggcgc-aggtagttgatccagcg 317

                                                                       
Query: 621 gaggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagtt 680
           |||||| ||||||||||||||||| |||| ||| ||||| || |||||||| ||||||||
Sbjct: 316 gaggcggcagctcttgccgcagcggagcaggcccgcctgcttgggcagcgcgcgccagtt 257

                       
Query: 681 gctgtggccgtg 692
           ||||||||||||
Sbjct: 256 gctgtggccgtg 245



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 84  gcctgcatgaacagtctgacccagaagtccacctcgtcgttgctggacgagggcg 138
           ||||||||||||||  ||| |||||||||||  ||||||||| | ||||| ||||
Sbjct: 888 gcctgcatgaacagcttgagccagaagtccatgtcgtcgttggtcgacgacggcg 834



to top

>ref|XM_466825.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1038

 Score =  291 bits (147), Expect = 2e-75
 Identities = 241/270 (89%), Gaps = 2/270 (0%)
 Strand = Plus / Minus

                                                                       
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
           |||||||||||||| |||||||| || |||||||||||||||||||||||||| || |||
Sbjct: 466 cgcttcttgaggtgagtgtgccacacattcttgatctcgttgtccgtcctccccggcagc 407

                                                                       
Query: 501 ctggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccc 560
           || || ||||| | |||||||| ||||||||| | | ||||||| |||||||||||| ||
Sbjct: 406 ctcgctgcaatcgcggaccatcggttgccgagaaggtcgtggaggtggatgatggcgtcc 347

                                                                       
Query: 561 tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
           |||||||||| ||||||||||||||||||||||||||||||  |||||||||||||||||
Sbjct: 346 tcctcctcgcgggtgaagttgccgcgcttgatgtcggggcg-gaggtagttgatccaccg 288

                                                                       
Query: 621 gaggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagtt 680
           |||||| ||||||||||||||||| || | |||||||||  |||||||||| ||||||||
Sbjct: 287 gaggcggcagctcttgccgcagcggagaaggccggcctgcctcggcagcgcgcgccagtt 228

                                         
Query: 681 gctgtggccgtgctgcttcgatgtgagcca 710
           |||||| |||||| || |||||||| ||||
Sbjct: 227 gctgtgcccgtgccgc-tcgatgtgcgcca 199



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 193 tgtccaccgtcattgcaagtgtctccgaccaaaagctgtcctcaatctgaaactcctcc 251
           |||||||||||||||| || ||||||||||| |||||||| || ||||| |||||||||
Sbjct: 750 tgtccaccgtcattgccagcgtctccgaccagaagctgtcgtcgatctggaactcctcc 692



to top

>dbj|AK112056.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-110-C03, full
           insert sequence
          Length = 1038

 Score =  291 bits (147), Expect = 2e-75
 Identities = 241/270 (89%), Gaps = 2/270 (0%)
 Strand = Plus / Minus

                                                                       
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
           |||||||||||||| |||||||| || |||||||||||||||||||||||||| || |||
Sbjct: 466 cgcttcttgaggtgagtgtgccacacattcttgatctcgttgtccgtcctccccggcagc 407

                                                                       
Query: 501 ctggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccc 560
           || || ||||| | |||||||| ||||||||| | | ||||||| |||||||||||| ||
Sbjct: 406 ctcgctgcaatcgcggaccatcggttgccgagaaggtcgtggaggtggatgatggcgtcc 347

                                                                       
Query: 561 tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
           |||||||||| ||||||||||||||||||||||||||||||  |||||||||||||||||
Sbjct: 346 tcctcctcgcgggtgaagttgccgcgcttgatgtcggggcg-gaggtagttgatccaccg 288

                                                                       
Query: 621 gaggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagtt 680
           |||||| ||||||||||||||||| || | |||||||||  |||||||||| ||||||||
Sbjct: 287 gaggcggcagctcttgccgcagcggagaaggccggcctgcctcggcagcgcgcgccagtt 228

                                         
Query: 681 gctgtggccgtgctgcttcgatgtgagcca 710
           |||||| |||||| || |||||||| ||||
Sbjct: 227 gctgtgcccgtgccgc-tcgatgtgcgcca 199



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 193 tgtccaccgtcattgcaagtgtctccgaccaaaagctgtcctcaatctgaaactcctcc 251
           |||||||||||||||| || ||||||||||| |||||||| || ||||| |||||||||
Sbjct: 750 tgtccaccgtcattgccagcgtctccgaccagaagctgtcgtcgatctggaactcctcc 692



to top

>dbj|AB252147.1| Triticum aestivum Tamyb7 mRNA for myb-related protein, complete cds
          Length = 876

 Score =  256 bits (129), Expect = 9e-65
 Identities = 222/252 (88%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
           |||||||||||||| |||||||| ||||||||||||||||||||||||||||| || |||
Sbjct: 366 cgcttcttgaggtgggtgtgccacacgttcttgatctcgttgtccgtcctccccggcagc 307

                                                                       
Query: 501 ctggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccc 560
           | ||||||||| | ||||||||||||||||||||    ||| ||||||||||| |    |
Sbjct: 306 cgggcggcaatcgcggaccatctgttgccgagcagctggtgcagctggatgattgactgc 247

                                                                       
Query: 561 tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
           |||||||||  |||||||||||||||||||||||| || ||| |||||||||||||||||
Sbjct: 246 tcctcctcgtcggtgaagttgccgcgcttgatgtccggccgc-aggtagttgatccaccg 188

                                                                       
Query: 621 gaggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagtt 680
           ||| || |||||||||||||| ||||||| |||||| || || |||||||| ||||||||
Sbjct: 187 gagccggcagctcttgccgcaccgcagcaggccggcttgcttaggcagcgcgcgccagtt 128

                       
Query: 681 gctgtggccgtg 692
           ||||||||||||
Sbjct: 127 gctgtggccgtg 116



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 213 gtctccgaccaaaagctgtcctcaatctgaaactcctccga 253
           ||||||||||| ||||| || || ||||| |||||||||||
Sbjct: 687 gtctccgaccagaagctctcgtcgatctggaactcctccga 647



to top

>gb|AY615199.1| Triticum aestivum transcription factor Myb2 (Myb2) mRNA, complete
           cds
          Length = 1044

 Score =  248 bits (125), Expect = 2e-62
 Identities = 221/252 (87%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
           |||||||||||||| |||||||| ||||||||||||||||||||||||||||| || |||
Sbjct: 411 cgcttcttgaggtgggtgtgccacacgttcttgatctcgttgtccgtcctccccggcagc 352

                                                                       
Query: 501 ctggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccc 560
           | ||||||||| | ||||||||||||||||||||    ||| ||||||||||| |    |
Sbjct: 351 cgggcggcaatcgcggaccatctgttgccgagcagctggtgcagctggatgattgactgc 292

                                                                       
Query: 561 tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
           |||||||||  |||||||||||||||||||||||| || ||| |||||||||||||||||
Sbjct: 291 tcctcctcgtcggtgaagttgccgcgcttgatgtccggccgc-aggtagttgatccaccg 233

                                                                       
Query: 621 gaggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagtt 680
           ||| || |||||||||||||| ||||||| |||||| || || |||||||| ||||||||
Sbjct: 232 gagccggcagctcttgccgcaccgcagcaggccggcttgcttgggcagcgcgcgccagtt 173

                       
Query: 681 gctgtggccgtg 692
           || |||||||||
Sbjct: 172 gccgtggccgtg 161



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 213 gtctccgaccaaaagctgtcctcaatctgaaactcctccga 253
           ||||||||||| ||||| || || ||||| |||||||||||
Sbjct: 741 gtctccgaccagaagctctcgtcgatctggaactcctccga 701



to top

>ref|XM_473184.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 774

 Score =  232 bits (117), Expect = 1e-57
 Identities = 219/252 (86%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
           |||||||||||||| |||||||| ||||||||||||||||||||||||||||| || | |
Sbjct: 344 cgcttcttgaggtgggtgtgccacacgttcttgatctcgttgtccgtcctcccgggcaac 285

                                                                       
Query: 501 ctggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccc 560
           ||||||||||| | |||||| |||||||| ||||   ||||||| |||||||||| | ||
Sbjct: 284 ctggcggcaattgcggaccacctgttgccaagcagctcgtggagatggatgatggtgtcc 225

                                                                       
Query: 561 tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
           ||||||||  ||| ||||||||| ||||||||||| || ||| |||||||||||||||||
Sbjct: 224 tcctcctccttggagaagttgccccgcttgatgtccggccgc-aggtagttgatccaccg 166

                                                                       
Query: 621 gaggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagtt 680
           ||| || |||||||||||||| |||||||  ||||| || || ||||| || ||||||||
Sbjct: 165 gagccggcagctcttgccgcaacgcagcagcccggcttgcttgggcagggcgcgccagtt 106

                       
Query: 681 gctgtggccgtg 692
           || |||||||||
Sbjct: 105 gccgtggccgtg 94



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 213 gtctccgaccaaaagctgtcctcaatctgaaactcctc 250
           ||||||||||| |||||||| || ||||| ||||||||
Sbjct: 632 gtctccgaccagaagctgtcgtcgatctggaactcctc 595



to top

>gb|AY323484.1| Oryza sativa (japonica cultivar-group) myb-related protein (LTR1)
           mRNA, complete cds
          Length = 1207

 Score =  232 bits (117), Expect = 1e-57
 Identities = 219/252 (86%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
           |||||||||||||| |||||||| ||||||||||||||||||||||||||||| || | |
Sbjct: 432 cgcttcttgaggtgggtgtgccacacgttcttgatctcgttgtccgtcctcccgggcaac 373

                                                                       
Query: 501 ctggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccc 560
           ||||||||||| | |||||| |||||||| ||||   ||||||| |||||||||| | ||
Sbjct: 372 ctggcggcaattgcggaccacctgttgccaagcagctcgtggagatggatgatggtgtcc 313

                                                                       
Query: 561 tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
           ||||||||  ||| ||||||||| ||||||||||| || ||| |||||||||||||||||
Sbjct: 312 tcctcctccttggagaagttgccccgcttgatgtccggccgc-aggtagttgatccaccg 254

                                                                       
Query: 621 gaggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagtt 680
           ||| || |||||||||||||| |||||||  ||||| || || ||||| || ||||||||
Sbjct: 253 gagccggcagctcttgccgcaacgcagcagcccggcttgcttgggcagggcgcgccagtt 194

                       
Query: 681 gctgtggccgtg 692
           || |||||||||
Sbjct: 193 gccgtggccgtg 182



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 213 gtctccgaccaaaagctgtcctcaatctgaaactcctc 250
           ||||||||||| |||||||| || ||||| ||||||||
Sbjct: 720 gtctccgaccagaagctgtcgtcgatctggaactcctc 683



to top

>emb|Y11414.1|OSMYB1202 O.sativa mRNA for myb factor, 1202 bp
          Length = 1202

 Score =  232 bits (117), Expect = 1e-57
 Identities = 219/252 (86%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
           |||||||||||||| |||||||| ||||||||||||||||||||||||||||| || | |
Sbjct: 422 cgcttcttgaggtgggtgtgccacacgttcttgatctcgttgtccgtcctcccgggcaac 363

                                                                       
Query: 501 ctggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccc 560
           ||||||||||| | |||||| |||||||| ||||   ||||||| |||||||||| | ||
Sbjct: 362 ctggcggcaattgcggaccacctgttgccaagcagctcgtggagatggatgatggtgtcc 303

                                                                       
Query: 561 tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
           ||||||||  ||| ||||||||| ||||||||||| || ||| |||||||||||||||||
Sbjct: 302 tcctcctccttggagaagttgccccgcttgatgtccggccgc-aggtagttgatccaccg 244

                                                                       
Query: 621 gaggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagtt 680
           ||| || |||||||||||||| |||||||  ||||| || || ||||| || ||||||||
Sbjct: 243 gagccggcagctcttgccgcaacgcagcagcccggcttgcttgggcagggcgcgccagtt 184

                       
Query: 681 gctgtggccgtg 692
           || |||||||||
Sbjct: 183 gccgtggccgtg 172



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 213 gtctccgaccaaaagctgtcctcaatctgaaactcctc 250
           ||||||||||| |||||||| || ||||| ||||||||
Sbjct: 710 gtctccgaccagaagctgtcgtcgatctggaactcctc 673



to top

>emb|X99973.1|HVMYB4TRF H.vulgare mRNA for myb4 transcription factor
          Length = 1180

 Score =  232 bits (117), Expect = 1e-57
 Identities = 219/252 (86%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
           |||||||||||||| |||||||| ||||||||||||||||||||||||||||| || |||
Sbjct: 340 cgcttcttgaggtgggtgtgccacacgttcttgatctcgttgtccgtcctccccggcagc 281

                                                                       
Query: 501 ctggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccc 560
           ||||||||||| | ||||||||||||||||||||    ||| ||||||||||| |    |
Sbjct: 280 ctggcggcaatcgcggaccatctgttgccgagcagctggtgcagctggatgattgactgc 221

                                                                       
Query: 561 tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
           |||||||||  || ||||||||||||||||||||| || ||| |||||||||||||||||
Sbjct: 220 tcctcctcgtcggagaagttgccgcgcttgatgtccggccgc-aggtagttgatccaccg 162

                                                                       
Query: 621 gaggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagtt 680
           ||| || |||||||||||||| ||||| |  ||||| || || |||||||| ||||||||
Sbjct: 161 gagccggcagctcttgccgcaccgcagaagcccggcttgcttgggcagcgcgcgccagtt 102

                       
Query: 681 gctgtggccgtg 692
           || |||||||||
Sbjct: 101 gccgtggccgtg 90



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 213 gtctccgaccaaaagctgtcctcaatctgaaactcctccga 253
           ||||||||||| ||||| || || ||||| |||||||||||
Sbjct: 688 gtctccgaccagaagctctcgtcgatctggaactcctccga 648



to top

>gb|AF467733.1| Oryza sativa myb protein mRNA, complete cds
          Length = 673

 Score =  232 bits (117), Expect = 1e-57
 Identities = 219/252 (86%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
           |||||||||||||| |||||||| ||||||||||||||||||||||||||||| || | |
Sbjct: 422 cgcttcttgaggtgggtgtgccacacgttcttgatctcgttgtccgtcctcccgggcaac 363

                                                                       
Query: 501 ctggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccc 560
           ||||||||||| | |||||| |||||||| ||||   ||||||| |||||||||| | ||
Sbjct: 362 ctggcggcaattgcggaccacctgttgccaagcagctcgtggagatggatgatggtgtcc 303

                                                                       
Query: 561 tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
           ||||||||  ||| ||||||||| ||||||||||| || ||| |||||||||||||||||
Sbjct: 302 tcctcctccttggagaagttgccccgcttgatgtccggccgc-aggtagttgatccaccg 244

                                                                       
Query: 621 gaggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagtt 680
           ||| || |||||||||||||| |||||||  ||||| || || ||||| || ||||||||
Sbjct: 243 gagccggcagctcttgccgcaacgcagcagcccggcttgcttgggcagggcgcgccagtt 184

                       
Query: 681 gctgtggccgtg 692
           || |||||||||
Sbjct: 183 gccgtggccgtg 172



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  206 bits (104), Expect = 7e-50
 Identities = 168/187 (89%), Gaps = 2/187 (1%)
 Strand = Plus / Plus

                                                                            
Query: 524      gttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgcc 583
                ||||||||| | | ||||||| |||||||||||| |||||||||||| ||||||||||||
Sbjct: 24898043 gttgccgagaaggtcgtggaggtggatgatggcgtcctcctcctcgcgggtgaagttgcc 24898102

                                                                            
Query: 584      gcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagc 643
                |||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||
Sbjct: 24898103 gcgcttgatgtcggggcgga-ggtagttgatccaccggaggcggcagctcttgccgcagc 24898161

                                                                            
Query: 644      gcagcangccggcctgattcggcagcgcccgccagttgctgtggccgtgctgcttcgatg 703
                | || | |||||||||  |||||||||| |||||||||||||| |||||| || ||||||
Sbjct: 24898162 ggagaaggccggcctgcctcggcagcgcgcgccagttgctgtgcccgtgccgc-tcgatg 24898220

                       
Query: 704      tgagcca 710
                || ||||
Sbjct: 24898221 tgcgcca 24898227



 Score =  139 bits (70), Expect = 1e-29
 Identities = 136/157 (86%), Gaps = 1/157 (0%)
 Strand = Plus / Plus

                                                                            
Query: 538      cgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcgg 597
                |||| |||| |||||||| | ||||||| |||  |||||||||||||||||| | |||||
Sbjct: 28578094 cgtgcagcttgatgatggtgtcctcctcgtcggcggtgaagttgccgcgcttcaggtcgg 28578153

                                                                            
Query: 598      ggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangccggcc 657
                |||||| |||||||||||||||||||||| |||||||||||||| |||||||  ||||||
Sbjct: 28578154 ggcgca-ggtagttgatccaccggaggcggcagctcttgccgcaccgcagcaatccggcc 28578212

                                                     
Query: 658      tgattcggcagcgcccgccagttgctgtggccgtgct 694
                || || || || || |||||||||  |||||||||||
Sbjct: 28578213 tgcttggggagggctcgccagttggcgtggccgtgct 28578249



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 75/84 (89%)
 Strand = Plus / Plus

                                                                            
Query: 441      cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
                |||||||||||||| |||||||| || |||||||||||||||||||||||||| || |||
Sbjct: 24897842 cgcttcttgaggtgagtgtgccacacattcttgatctcgttgtccgtcctccccggcagc 24897901

                                        
Query: 501      ctggcggcaatggtggaccatctg 524
                || || ||||| | ||||||||||
Sbjct: 24897902 ctcgctgcaatcgcggaccatctg 24897925



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                            
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
                |||||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||| 
Sbjct: 30558949 cttcttgatgtgggtgttccagtggttcttgatctcgttgtccgtcctcccggggagccg 30559008

                                       
Query: 503      ggcggcaatggtggaccatctgt 525
                 || |||||  ||||||||||||
Sbjct: 30559009 tgccgcaatcttggaccatctgt 30559031



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                                   
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
                |||||| ||||| |||| ||| |||||||||||||||||||||||||||||
Sbjct: 28577904 cttcttcaggtgggtgttccacacgttcttgatctcgttgtccgtcctccc 28577954



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                           
Query: 193      tgtccaccgtcattgcaagtgtctccgaccaaaagctgtcctcaatctgaaactcctcc 251
                |||||||||||||||| || ||||||||||| |||||||| || ||||| |||||||||
Sbjct: 24897558 tgtccaccgtcattgccagcgtctccgaccagaagctgtcgtcgatctggaactcctcc 24897616



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                                
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcct 490
                |||||| |||||||||| ||||  |||||||||||||||||| |||||
Sbjct: 31744105 cttcttcaggtgtgtgttccagtagttcttgatctcgttgtcagtcct 31744152



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                               
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcc 489
                |||||| ||||| |||| ||||  |||||||||||||||||||||||
Sbjct: 22288683 cttcttcaggtgcgtgttccagtagttcttgatctcgttgtccgtcc 22288637



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 467      gttcttgatctcgttgtccgtcctcccagg 496
                |||||||||||||||||||||||| |||||
Sbjct: 24600785 gttcttgatctcgttgtccgtcctgccagg 24600814



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 89/106 (83%), Gaps = 3/106 (2%)
 Strand = Plus / Minus

                                                                            
Query: 537      gcgtggagctggatgatggcgccctcctcctcgctg-gtgaagttgccgcgcttgatgtc 595
                |||||||||||||||||||    |||||||| || | ||||| ||||| | |||||||||
Sbjct: 22287687 gcgtggagctggatgatggtctgctcctcct-gcagcgtgaacttgcccctcttgatgtc 22287629

                                                              
Query: 596      ggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
                 || || |||||||||  |||||||||| || ||||||||||||||
Sbjct: 22287628 cggccg-aaggtagttcgtccaccggagccggcagctcttgccgca 22287584



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 572     ggtgaagttgccgcgcttgatgtcggggc 600
               |||||||||||||||||||| ||||||||
Sbjct: 4966958 ggtgaagttgccgcgcttgaggtcggggc 4966930



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                                
Query: 442      gcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcc 489
                ||||||||||||| |||| |||   |||||||||||||||||| ||||
Sbjct: 25798352 gcttcttgaggtgagtgttccaatagttcttgatctcgttgtcggtcc 25798305



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 96/119 (80%), Gaps = 1/119 (0%)
 Strand = Plus / Minus

                                                                            
Query: 523      tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
                |||||||||  ||| |||||||||||| |||||    || |||||||  |||||||   |
Sbjct: 25797494 tgttgccgacgatgccgtggagctggacgatggacttctgctcctcggcggtgaagggcc 25797435

                                                                           
Query: 583      cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
                ||||||||||||| || || | |||||||  ||||||| || || ||||||||||||||
Sbjct: 25797434 cgcgcttgatgtccggccgga-ggtagttcgtccaccgcagccggcagctcttgccgca 25797377



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 467    gttcttgatctcgttgtccgtcctcccagg 496
              |||||| | |||||||||||||||||||||
Sbjct: 790170 gttcttcacctcgttgtccgtcctcccagg 790199



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 604      aggtagttgatccaccggaggcgacagctctt 635
                ||||||||||||||||| || || ||||||||
Sbjct: 25778988 aggtagttgatccaccgcagccggcagctctt 25778957



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                  
Query: 603    aaggtagttgatccaccggaggcgacagctcttgcc 638
              ||||||||||||||| || || || |||||||||||
Sbjct: 790521 aaggtagttgatccaacgcagccggcagctcttgcc 790556



to top

>dbj|AP006523.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1215B07
          Length = 165957

 Score =  206 bits (104), Expect = 7e-50
 Identities = 168/187 (89%), Gaps = 2/187 (1%)
 Strand = Plus / Plus

                                                                         
Query: 524   gttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgcc 583
             ||||||||| | | ||||||| |||||||||||| |||||||||||| ||||||||||||
Sbjct: 59326 gttgccgagaaggtcgtggaggtggatgatggcgtcctcctcctcgcgggtgaagttgcc 59385

                                                                         
Query: 584   gcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagc 643
             |||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||
Sbjct: 59386 gcgcttgatgtcggggcgga-ggtagttgatccaccggaggcggcagctcttgccgcagc 59444

                                                                         
Query: 644   gcagcangccggcctgattcggcagcgcccgccagttgctgtggccgtgctgcttcgatg 703
             | || | |||||||||  |||||||||| |||||||||||||| |||||| || ||||||
Sbjct: 59445 ggagaaggccggcctgcctcggcagcgcgcgccagttgctgtgcccgtgccgc-tcgatg 59503

                    
Query: 704   tgagcca 710
             || ||||
Sbjct: 59504 tgcgcca 59510



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 75/84 (89%)
 Strand = Plus / Plus

                                                                         
Query: 441   cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
             |||||||||||||| |||||||| || |||||||||||||||||||||||||| || |||
Sbjct: 59125 cgcttcttgaggtgagtgtgccacacattcttgatctcgttgtccgtcctccccggcagc 59184

                                     
Query: 501   ctggcggcaatggtggaccatctg 524
             || || ||||| | ||||||||||
Sbjct: 59185 ctcgctgcaatcgcggaccatctg 59208



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                        
Query: 193   tgtccaccgtcattgcaagtgtctccgaccaaaagctgtcctcaatctgaaactcctcc 251
             |||||||||||||||| || ||||||||||| |||||||| || ||||| |||||||||
Sbjct: 58841 tgtccaccgtcattgccagcgtctccgaccagaagctgtcgtcgatctggaactcctcc 58899



to top

>gb|AY178579.1| Lolium perenne R2R3 MYB protein MYB4 (Myb4) mRNA, partial cds
          Length = 330

 Score =  192 bits (97), Expect = 1e-45
 Identities = 193/224 (86%), Gaps = 1/224 (0%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           ||||||||||||||||||||||||||| || |||||||| || || |  |||||||||||
Sbjct: 318 gttcttgatctcgttgtccgtcctccccggcagcctggcagcgatcgctgaccatctgtt 259

                                                                       
Query: 527 gccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcg 586
           ||||||||    ||||||||||||||| |    ||||||||||  || ||||||||||||
Sbjct: 258 gccgagcagctggtggagctggatgattgactgctcctcctcgtcggagaagttgccgcg 199

                                                                       
Query: 587 cttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           ||||||||| || |||| ||||||||||||||||||| || |||||||||||||| ||||
Sbjct: 198 cttgatgtccggccgca-ggtagttgatccaccggagccggcagctcttgccgcaccgca 140

                                                       
Query: 647 gcangccggcctgattcggcagcgcccgccagttgctgtggccg 690
           ||| |||||| || || |||||||| |||||||||| |||||||
Sbjct: 139 gcaggccggcttgcttgggcagcgcgcgccagttgccgtggccg 96



to top

>ref|XM_467269.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1528

 Score =  168 bits (85), Expect = 2e-38
 Identities = 211/252 (83%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||| ||||| |||| ||| ||||||||||||||||||||||||||||| || || | 
Sbjct: 420 cttcttcaggtgggtgttccacacgttcttgatctcgttgtccgtcctcccgggcaggca 361

                                                                       
Query: 503 ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
            |  || ||  |||||||  |||| ||||| | | |||| |||| |||||||| | ||||
Sbjct: 360 cgacgcgatcttggaccacttgttcccgagtaggccgtgcagcttgatgatggtgtcctc 301

                                                                       
Query: 563 ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
           ||| |||  |||||||||||||||||| | ||||||||||| ||||||||||||||||||
Sbjct: 300 ctcgtcggcggtgaagttgccgcgcttcaggtcggggcgca-ggtagttgatccaccgga 242

                                                                       
Query: 623 ggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagttgc 682
           |||| |||||||||||||| |||||||  |||||||| || || || || ||||||||| 
Sbjct: 241 ggcggcagctcttgccgcaccgcagcaatccggcctgcttggggagggctcgccagttgg 182

                       
Query: 683 tgtggccgtgct 694
            |||||||||||
Sbjct: 181 cgtggccgtgct 170



to top

>ref|XM_506902.1| PREDICTED Oryza sativa (japonica cultivar-group), P0017H11.31 mRNA
          Length = 1664

 Score =  168 bits (85), Expect = 2e-38
 Identities = 211/252 (83%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||| ||||| |||| ||| ||||||||||||||||||||||||||||| || || | 
Sbjct: 517 cttcttcaggtgggtgttccacacgttcttgatctcgttgtccgtcctcccgggcaggca 458

                                                                       
Query: 503 ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
            |  || ||  |||||||  |||| ||||| | | |||| |||| |||||||| | ||||
Sbjct: 457 cgacgcgatcttggaccacttgttcccgagtaggccgtgcagcttgatgatggtgtcctc 398

                                                                       
Query: 563 ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
           ||| |||  |||||||||||||||||| | ||||||||||| ||||||||||||||||||
Sbjct: 397 ctcgtcggcggtgaagttgccgcgcttcaggtcggggcgca-ggtagttgatccaccgga 339

                                                                       
Query: 623 ggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagttgc 682
           |||| |||||||||||||| |||||||  |||||||| || || || || ||||||||| 
Sbjct: 338 ggcggcagctcttgccgcaccgcagcaatccggcctgcttggggagggctcgccagttgg 279

                       
Query: 683 tgtggccgtgct 694
            |||||||||||
Sbjct: 278 cgtggccgtgct 267



to top

>dbj|AK111933.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B10, full
           insert sequence
          Length = 1528

 Score =  168 bits (85), Expect = 2e-38
 Identities = 211/252 (83%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||| ||||| |||| ||| ||||||||||||||||||||||||||||| || || | 
Sbjct: 420 cttcttcaggtgggtgttccacacgttcttgatctcgttgtccgtcctcccgggcaggca 361

                                                                       
Query: 503 ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
            |  || ||  |||||||  |||| ||||| | | |||| |||| |||||||| | ||||
Sbjct: 360 cgacgcgatcttggaccacttgttcccgagtaggccgtgcagcttgatgatggtgtcctc 301

                                                                       
Query: 563 ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
           ||| |||  |||||||||||||||||| | ||||||||||| ||||||||||||||||||
Sbjct: 300 ctcgtcggcggtgaagttgccgcgcttcaggtcggggcgca-ggtagttgatccaccgga 242

                                                                       
Query: 623 ggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagttgc 682
           |||| |||||||||||||| |||||||  |||||||| || || || || ||||||||| 
Sbjct: 241 ggcggcagctcttgccgcaccgcagcaatccggcctgcttggggagggctcgccagttgg 182

                       
Query: 683 tgtggccgtgct 694
            |||||||||||
Sbjct: 181 cgtggccgtgct 170



to top

>dbj|AK111720.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023030I19, full
           insert sequence
          Length = 1665

 Score =  168 bits (85), Expect = 2e-38
 Identities = 211/252 (83%), Gaps = 1/252 (0%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||| ||||| |||| ||| ||||||||||||||||||||||||||||| || || | 
Sbjct: 518 cttcttcaggtgggtgttccacacgttcttgatctcgttgtccgtcctcccgggcaggca 459

                                                                       
Query: 503 ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
            |  || ||  |||||||  |||| ||||| | | |||| |||| |||||||| | ||||
Sbjct: 458 cgacgcgatcttggaccacttgttcccgagtaggccgtgcagcttgatgatggtgtcctc 399

                                                                       
Query: 563 ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
           ||| |||  |||||||||||||||||| | ||||||||||| ||||||||||||||||||
Sbjct: 398 ctcgtcggcggtgaagttgccgcgcttcaggtcggggcgca-ggtagttgatccaccgga 340

                                                                       
Query: 623 ggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagttgc 682
           |||| |||||||||||||| |||||||  |||||||| || || || || ||||||||| 
Sbjct: 339 ggcggcagctcttgccgcaccgcagcaatccggcctgcttggggagggctcgccagttgg 280

                       
Query: 683 tgtggccgtgct 694
            |||||||||||
Sbjct: 279 cgtggccgtgct 268



to top

>dbj|AP005859.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1053A04
          Length = 144321

 Score =  139 bits (70), Expect = 1e-29
 Identities = 136/157 (86%), Gaps = 1/157 (0%)
 Strand = Plus / Plus

                                                                         
Query: 538   cgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcgg 597
             |||| |||| |||||||| | ||||||| |||  |||||||||||||||||| | |||||
Sbjct: 42107 cgtgcagcttgatgatggtgtcctcctcgtcggcggtgaagttgccgcgcttcaggtcgg 42166

                                                                         
Query: 598   ggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangccggcc 657
             |||||| |||||||||||||||||||||| |||||||||||||| |||||||  ||||||
Sbjct: 42167 ggcgca-ggtagttgatccaccggaggcggcagctcttgccgcaccgcagcaatccggcc 42225

                                                  
Query: 658   tgattcggcagcgcccgccagttgctgtggccgtgct 694
             || || || || || |||||||||  |||||||||||
Sbjct: 42226 tgcttggggagggctcgccagttggcgtggccgtgct 42262



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                                
Query: 443   cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
             |||||| ||||| |||| ||| |||||||||||||||||||||||||||||
Sbjct: 41917 cttcttcaggtgggtgttccacacgttcttgatctcgttgtccgtcctccc 41967



to top

>dbj|AP004786.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0017H11
          Length = 158374

 Score =  139 bits (70), Expect = 1e-29
 Identities = 136/157 (86%), Gaps = 1/157 (0%)
 Strand = Plus / Plus

                                                                          
Query: 538    cgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcgg 597
              |||| |||| |||||||| | ||||||| |||  |||||||||||||||||| | |||||
Sbjct: 146935 cgtgcagcttgatgatggtgtcctcctcgtcggcggtgaagttgccgcgcttcaggtcgg 146994

                                                                          
Query: 598    ggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangccggcc 657
              |||||| |||||||||||||||||||||| |||||||||||||| |||||||  ||||||
Sbjct: 146995 ggcgca-ggtagttgatccaccggaggcggcagctcttgccgcaccgcagcaatccggcc 147053

                                                   
Query: 658    tgattcggcagcgcccgccagttgctgtggccgtgct 694
              || || || || || |||||||||  |||||||||||
Sbjct: 147054 tgcttggggagggctcgccagttggcgtggccgtgct 147090



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                                 
Query: 443    cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
              |||||| ||||| |||| ||| |||||||||||||||||||||||||||||
Sbjct: 146745 cttcttcaggtgggtgttccacacgttcttgatctcgttgtccgtcctccc 146795



to top

>emb|AM156905.1| Zea mays mRNA for transcription factor MYB8 (myb8 gene)
          Length = 1082

 Score =  137 bits (69), Expect = 6e-29
 Identities = 174/208 (83%), Gaps = 1/208 (0%)
 Strand = Plus / Minus

                                                                       
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcctggc 505
           ||||| ||| |||| ||||  ||||||||||||||||||||||| ||| || |||  |||
Sbjct: 523 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtccgccccggcagctgggc 464

                                                                       
Query: 506 ggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctc 565
           ||| ||    |||||  |||| ||||| |    |||||||| ||||||| || | |||||
Sbjct: 463 ggcgatcagcgaccacttgtttccgaggacctggtggagcttgatgatgacgtcgtcctc 404

                                                                       
Query: 566 ctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggc 625
           |||   |||||||||||||||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 403 ctcctgggtgaagttgccgcgcttgaggtcggggcgca-ggtagttgatccaccggaggc 345

                                       
Query: 626 gacagctcttgccgcagcgcagcangcc 653
           | |||||||||||||||||||||| |||
Sbjct: 344 ggcagctcttgccgcagcgcagcaggcc 317



to top

>dbj|AK111960.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-D02, full
           insert sequence
          Length = 1637

 Score =  135 bits (68), Expect = 2e-28
 Identities = 206/251 (82%), Gaps = 1/251 (0%)
 Strand = Plus / Minus

                                                                       
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
           |||||||||||||| |||| ||||||||||||||||||||||||||||||||| || || 
Sbjct: 477 cgcttcttgaggtgcgtgttccagacgttcttgatctcgttgtccgtcctccccggcagg 418

                                                                       
Query: 501 ctggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccc 560
           |  |  || ||  | |||||  |||||||||| | | |||| |||| ||||||||   ||
Sbjct: 417 cacgacgcgatcttcgaccacttgttgccgagaaggccgtgaagcttgatgatggtctcc 358

                                                                       
Query: 561 tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
           |||||||||  |||||||||||||||||||| ||| || ||  |||||||||||||||||
Sbjct: 357 tcctcctcggcggtgaagttgccgcgcttgaggtccggccg-gaggtagttgatccaccg 299

                                                                       
Query: 621 gaggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagtt 680
           ||| || |||||||| ||||| || ||||  || || || || ||||| || ||||||||
Sbjct: 298 gagtcggcagctcttcccgcaccggagcaaacctgcttgcttgggcagggcgcgccagtt 239

                      
Query: 681 gctgtggccgt 691
           |  ||||||||
Sbjct: 238 ggcgtggccgt 228



to top

>gb|AF099440.1|AF099440 Zea mays clone ZmMYBIQ32 R2R3MYB-domain protein mRNA, partial cds
          Length = 129

 Score =  131 bits (66), Expect = 3e-27
 Identities = 115/130 (88%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 485 cgtcctcccaggaagcctggcggcaatggtggaccatctgttgccgagcatggcgtggag 544
           ||||||||| || |||||||| || || || ||||||||||||||||||||   ||||||
Sbjct: 129 cgtcctccccggcagcctggcagcgattgtcgaccatctgttgccgagcatttggtggag 70

                                                                       
Query: 545 ctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaa 604
           ||| ||||||||| |||||||||| | | ||||||||||||||||||||||||||||| |
Sbjct: 69  ctgtatgatggcgtcctcctcctcccggctgaagttgccgcgcttgatgtcggggcgc-a 11

                     
Query: 605 ggtagttgat 614
           ||||||||||
Sbjct: 10  ggtagttgat 1



to top

>gb|AY110666.1| Zea mays CL332_1 mRNA sequence
          Length = 927

 Score =  127 bits (64), Expect = 5e-26
 Identities = 152/180 (84%), Gaps = 1/180 (0%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           |||||||||||||||||||||||| || || |||||  |||| ||   ||||||  ||||
Sbjct: 392 gttcttgatctcgttgtccgtcctgcccggcagccttccggcgatcagggaccacttgtt 333

                                                                       
Query: 527 gccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcg 586
           |||||| | |  |||||||| |||||||    | ||||||||    ||||||||||||||
Sbjct: 332 gccgaggaggctgtggagcttgatgatgagctcgtcctcctcctccgtgaagttgccgcg 273

                                                                       
Query: 587 cttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           ||||| ||||||||||| |||||||||||||||||||||| |||||||||||||||||||
Sbjct: 272 cttgaggtcggggcgca-ggtagttgatccaccggaggcggcagctcttgccgcagcgca 214



to top

>ref|XM_483665.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 732

 Score =  125 bits (63), Expect = 2e-25
 Identities = 159/190 (83%), Gaps = 1/190 (0%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           ||||||||||||||||||||||||||| || ||||| || || ||    |||||  ||||
Sbjct: 318 gttcttgatctcgttgtccgtcctccccggcagcctcgccgcgatcagagaccacttgtt 259

                                                                       
Query: 527 gccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcg 586
           |||||| | |  |||||||| |||||||  | | ||||| |||  |||||||||||||||
Sbjct: 258 gccgaggaggctgtggagcttgatgatgaggtcgtcctcgtcggcggtgaagttgccgcg 199

                                                                       
Query: 587 cttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           ||||| ||||||||| | ||||||||||||| |||||||| ||||||||||||||||| |
Sbjct: 198 cttgaggtcggggcgga-ggtagttgatccagcggaggcggcagctcttgccgcagcgga 140

                     
Query: 647 gcangccggc 656
           | | ||||||
Sbjct: 139 ggaggccggc 130



to top

>emb|AJ311053.1|OSA311053 Oryza sativa mRNA for Myb15 protein (myb15 gene)
          Length = 1380

 Score =  125 bits (63), Expect = 2e-25
 Identities = 172/207 (83%), Gaps = 1/207 (0%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||||| ||| |||| ||||  |||||||||||||||||||||||| || || ||| |
Sbjct: 417 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcctgcccggtagctt 358

                                                                       
Query: 503 ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
           ||| |||||  |||||||||||||||||||| |||||||||| | ||||| |     |||
Sbjct: 357 ggcagcaatcttggaccatctgttgccgagcttggcgtggaggtcgatgacgagctgctc 298

                                                                       
Query: 563 ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
           |||  ||  ||||| |  ||||||||||| |||||||||  ||||||||  |||||||||
Sbjct: 297 ctcggcgtcggtgaggaggccgcgcttgaggtcggggcg-gaggtagtttgtccaccgga 239

                                      
Query: 623 ggcgacagctcttgccgcagcgcagca 649
           |||| ||||||||||||||||| ||||
Sbjct: 238 ggcggcagctcttgccgcagcggagca 212



to top

>emb|AJ311052.1|OSA311052 Oryza sativa mRNA for Myb13 protein (myb13 gene)
          Length = 1429

 Score =  125 bits (63), Expect = 2e-25
 Identities = 172/207 (83%), Gaps = 1/207 (0%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||||| ||| |||| ||||  |||||||||||||||||||||||| || || ||| |
Sbjct: 518 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcctgcccggtagctt 459

                                                                       
Query: 503 ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
           ||| |||||  |||||||||||||||||||| |||||||||| | ||||| |     |||
Sbjct: 458 ggcagcaatcttggaccatctgttgccgagcttggcgtggaggtcgatgacgagctgctc 399

                                                                       
Query: 563 ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
           |||  ||  ||||| |  ||||||||||| |||||||||  ||||||||  |||||||||
Sbjct: 398 ctcggcgtcggtgaggaggccgcgcttgaggtcggggcg-gaggtagtttgtccaccgga 340

                                      
Query: 623 ggcgacagctcttgccgcagcgcagca 649
           |||| ||||||||||||||||| ||||
Sbjct: 339 ggcggcagctcttgccgcagcggagca 313



to top

>dbj|AK121023.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023049M10, full
            insert sequence
          Length = 4669

 Score =  125 bits (63), Expect = 2e-25
 Identities = 172/207 (83%), Gaps = 1/207 (0%)
 Strand = Plus / Minus

                                                                        
Query: 443  cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
            |||||||| ||| |||| ||||  |||||||||||||||||||||||| || || ||| |
Sbjct: 4474 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcctgcccggtagctt 4415

                                                                        
Query: 503  ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
            ||| |||||  |||||||||||||||||||| |||||||||| | ||||| |     |||
Sbjct: 4414 ggcagcaatcttggaccatctgttgccgagcttggcgtggaggtcgatgacgagctgctc 4355

                                                                        
Query: 563  ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
            |||  ||  ||||| |  ||||||||||| |||||||||  ||||||||  |||||||||
Sbjct: 4354 ctcggcgtcggtgaggaggccgcgcttgaggtcggggcg-gaggtagtttgtccaccgga 4296

                                       
Query: 623  ggcgacagctcttgccgcagcgcagca 649
            |||| ||||||||||||||||| ||||
Sbjct: 4295 ggcggcagctcttgccgcagcggagca 4269



to top

>dbj|AK111740.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023047I22, full
           insert sequence
          Length = 1450

 Score =  125 bits (63), Expect = 2e-25
 Identities = 172/207 (83%), Gaps = 1/207 (0%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||||| ||| |||| ||||  |||||||||||||||||||||||| || || ||| |
Sbjct: 529 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcctgcccggtagctt 470

                                                                       
Query: 503 ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
           ||| |||||  |||||||||||||||||||| |||||||||| | ||||| |     |||
Sbjct: 469 ggcagcaatcttggaccatctgttgccgagcttggcgtggaggtcgatgacgagctgctc 410

                                                                       
Query: 563 ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
           |||  ||  ||||| |  ||||||||||| |||||||||  ||||||||  |||||||||
Sbjct: 409 ctcggcgtcggtgaggaggccgcgcttgaggtcggggcg-gaggtagtttgtccaccgga 351

                                      
Query: 623 ggcgacagctcttgccgcagcgcagca 649
           |||| ||||||||||||||||| ||||
Sbjct: 350 ggcggcagctcttgccgcagcggagca 324



to top

>dbj|AK106039.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-D11, full
           insert sequence
          Length = 1139

 Score =  125 bits (63), Expect = 2e-25
 Identities = 172/207 (83%), Gaps = 1/207 (0%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||||| ||| |||| ||||  |||||||||||||||||||||||| || || ||| |
Sbjct: 528 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcctgcccggtagctt 469

                                                                       
Query: 503 ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
           ||| |||||  |||||||||||||||||||| |||||||||| | ||||| |     |||
Sbjct: 468 ggcagcaatcttggaccatctgttgccgagcttggcgtggaggtcgatgacgagctgctc 409

                                                                       
Query: 563 ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
           |||  ||  ||||| |  ||||||||||| |||||||||  ||||||||  |||||||||
Sbjct: 408 ctcggcgtcggtgaggaggccgcgcttgaggtcggggcg-gaggtagtttgtccaccgga 350

                                      
Query: 623 ggcgacagctcttgccgcagcgcagca 649
           |||| ||||||||||||||||| ||||
Sbjct: 349 ggcggcagctcttgccgcagcggagca 323



to top

>gb|AF099387.1|AF099387 Zea mays clone ZmMYBIF17 R2R3MYB-domain protein mRNA, partial cds
          Length = 129

 Score =  121 bits (61), Expect = 3e-24
 Identities = 113/129 (87%), Gaps = 1/129 (0%)
 Strand = Plus / Minus

                                                                       
Query: 486 gtcctcccaggaagcctggcggcaatggtggaccatctgttgccgagcatggcgtggagc 545
           |||||||| || |||||||| || || |  ||||||||||||||||||||   |||||| 
Sbjct: 128 gtcctccccggcagcctggcagcgattgccgaccatctgttgccgagcatttggtggagt 69

                                                                       
Query: 546 tggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaag 605
           |||||||  ||| |||||||||||| ||||||||||||||||||||||||||||||| ||
Sbjct: 68  tggatgactgcgtcctcctcctcgcgggtgaagttgccgcgcttgatgtcggggcgc-ag 10

                    
Query: 606 gtagttgat 614
           |||||||||
Sbjct: 9   gtagttgat 1



to top

>dbj|AK063027.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-110-B12, full
           insert sequence
          Length = 1027

 Score =  119 bits (60), Expect = 1e-23
 Identities = 169/204 (82%), Gaps = 1/204 (0%)
 Strand = Plus / Minus

                                                                       
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcctggc 505
           ||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||||  |
Sbjct: 396 cttgatgtgggtgttccagtagttcttgatctcgttgtccgtcctccccggcagcctccc 337

                                                                       
Query: 506 ggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctc 565
           ||| ||    |||||  |||||||||| |   ||||||||| |||||||    | || ||
Sbjct: 336 ggcgatcagcgaccacttgttgccgaggagctcgtggagcttgatgatgagctcgtcttc 277

                                                                       
Query: 566 ctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggc 625
           ||||  |||||||||||||||||||| ||||||||| | |||||||||||||||||||||
Sbjct: 276 ctcgtcggtgaagttgccgcgcttgaggtcggggcgga-ggtagttgatccaccggaggc 218

                                   
Query: 626 gacagctcttgccgcagcgcagca 649
           | |||||||| ||||| |||||||
Sbjct: 217 ggcagctcttcccgcaacgcagca 194



to top

>dbj|D88618.1| Oryza sativa mRNA for OSMYB2, complete cds
          Length = 1069

 Score =  119 bits (60), Expect = 1e-23
 Identities = 169/204 (82%), Gaps = 1/204 (0%)
 Strand = Plus / Minus

                                                                       
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcctggc 505
           ||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||||  |
Sbjct: 446 cttgatgtgggtgttccagtagttcttgatctcgttgtccgtcctccccggcagcctccc 387

                                                                       
Query: 506 ggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctc 565
           ||| ||    |||||  |||||||||| |   ||||||||| |||||||    | || ||
Sbjct: 386 ggcgatcagcgaccacttgttgccgaggagctcgtggagcttgatgatgagctcgtcttc 327

                                                                       
Query: 566 ctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggc 625
           ||||  |||||||||||||||||||| ||||||||| | |||||||||||||||||||||
Sbjct: 326 ctcgtcggtgaagttgccgcgcttgaggtcggggcgga-ggtagttgatccaccggaggc 268

                                   
Query: 626 gacagctcttgccgcagcgcagca 649
           | |||||||| ||||| |||||||
Sbjct: 267 ggcagctcttcccgcaacgcagca 244



to top

>gb|AF470060.1| Sorghum bicolor P-type R2R3 Myb protein (Myb23) gene, partial cds
          Length = 2028

 Score =  117 bits (59), Expect = 5e-23
 Identities = 77/82 (93%), Gaps = 1/82 (1%)
 Strand = Plus / Minus

                                                                        
Query: 572  ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
            |||||||||||||||||||| ||||||||| | |||||||||||||||||||||| ||||
Sbjct: 1554 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttgatccaccggaggcggcagc 1496

                                  
Query: 632  tcttgccgcagcgcagcangcc 653
            |||||||||||||||||| |||
Sbjct: 1495 tcttgccgcagcgcagcaggcc 1474



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 467  gttcttgatctcgttgtccgtcc 489
            |||||||||||||||||||||||
Sbjct: 1781 gttcttgatctcgttgtccgtcc 1759



to top

>emb|X70877.1|HVMYB1 H.vulgare myb1 mRNA
          Length = 1284

 Score =  117 bits (59), Expect = 5e-23
 Identities = 158/190 (83%), Gaps = 1/190 (0%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           ||||||||||||||||||||||||||| || || ||  |||| ||   ||||||| ||||
Sbjct: 529 gttcttgatctcgttgtccgtcctccccggcagtctcccggctatcagggaccatttgtt 470

                                                                       
Query: 527 gccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcg 586
            || || | |  |||||||| |||||||    | |||||||||  | |||||||||||||
Sbjct: 469 tcccaggaggctgtggagcttgatgatgagctcgtcctcctcgtggctgaagttgccgcg 410

                                                                       
Query: 587 cttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           ||||| ||||||||| | ||||||||||||| |||||||| ||||||||||||||||| |
Sbjct: 409 cttgaggtcggggcgga-ggtagttgatccagcggaggcggcagctcttgccgcagcgga 351

                     
Query: 647 gcangccggc 656
           ||| ||||||
Sbjct: 350 gcaggccggc 341



to top

>gb|AF470059.1| Sorghum bicolor P-type R2R3 Myb protein (Myb9) gene, partial cds
          Length = 2159

 Score =  115 bits (58), Expect = 2e-22
 Identities = 92/102 (90%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                        
Query: 548  gatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggt 607
            |||||||||| |||| |||||  || |||||||||||||||||||||| ||||||| |||
Sbjct: 1718 gatgatggcgtcctcttcctccttgctgaagttgccgcgcttgatgtccgggcgca-ggt 1660

                                                      
Query: 608  agttgatccaccggaggcgacagctcttgccgcagcgcagca 649
            |||||||||||||||| || |||||||||||||| |||||||
Sbjct: 1659 agttgatccaccggagccggcagctcttgccgcaccgcagca 1618



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 664  ggcagcgcccgccagttgctgtggccg 690
            |||||||| ||||||||||||||||||
Sbjct: 1505 ggcagcgcgcgccagttgctgtggccg 1479



to top

>gb|AF474124.1| Zea mays typical P-type R2R3 Myb protein (Myb56) gene, partial cds
          Length = 1739

 Score =  113 bits (57), Expect = 8e-22
 Identities = 72/76 (94%), Gaps = 1/76 (1%)
 Strand = Plus / Minus

                                                                        
Query: 578  gttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgc 637
            |||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||||||
Sbjct: 1395 gttgccgcgcttgaggtcggggcgca-ggtagttgatccaccggaggcggcagctcttgc 1337

                            
Query: 638  cgcagcgcagcangcc 653
            |||||||||||| |||
Sbjct: 1336 cgcagcgcagcaggcc 1321



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 446  cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcc 489
            ||||| ||| |||| ||||  |||||||||||||||||||||||
Sbjct: 1639 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcc 1596



to top

>emb|X70876.1|HVMYB2 H.vulgare myb2 mRNA
          Length = 1102

 Score =  113 bits (57), Expect = 8e-22
 Identities = 171/208 (82%), Gaps = 1/208 (0%)
 Strand = Plus / Minus

                                                                       
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcctggc 505
           ||||| ||| |||| ||||  |||||||||||||||||||||||| || || |||  | |
Sbjct: 382 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctgcccggcagctggcc 323

                                                                       
Query: 506 ggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctc 565
           ||| |||   |||||  |||||||||||| |  ||||||  ||||||||    | |||||
Sbjct: 322 ggcgatgagagaccacttgttgccgagcaggctgtggaggcggatgatgagctcgtcctc 263

                                                                       
Query: 566 ctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggc 625
            |||  |||||||||||||||||||| ||||||||| | ||||||| ||||| |||||||
Sbjct: 262 gtcgtcggtgaagttgccgcgcttgaggtcggggcgga-ggtagttcatccagcggaggc 204

                                       
Query: 626 gacagctcttgccgcagcgcagcangcc 653
           | |||||||||||||||||||||| |||
Sbjct: 203 ggcagctcttgccgcagcgcagcaggcc 176



to top

>emb|AL731616.5|OSJN00262 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073E02,
             complete sequence
          Length = 139080

 Score =  111 bits (56), Expect = 3e-21
 Identities = 99/112 (88%), Gaps = 1/112 (0%)
 Strand = Plus / Plus

                                                                         
Query: 538   cgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcgg 597
             ||||||| |||||||||| | ||||||||||  ||| ||||||||| ||||||||||| |
Sbjct: 35291 cgtggagatggatgatggtgtcctcctcctccttggagaagttgccccgcttgatgtccg 35350

                                                                 
Query: 598   ggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgcagca 649
             | |||| ||||||||||||||||||| || |||||||||||||| |||||||
Sbjct: 35351 gccgca-ggtagttgatccaccggagccggcagctcttgccgcaacgcagca 35401



 Score =  103 bits (52), Expect = 8e-19
 Identities = 73/80 (91%)
 Strand = Plus / Plus

                                                                         
Query: 441   cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
             |||||||||||||| |||||||| ||||||||||||||||||||||||||||| || | |
Sbjct: 34648 cgcttcttgaggtgggtgtgccacacgttcttgatctcgttgtccgtcctcccgggcaac 34707

                                 
Query: 501   ctggcggcaatggtggacca 520
             ||||||||||| | ||||||
Sbjct: 34708 ctggcggcaattgcggacca 34727



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 213   gtctccgaccaaaagctgtcctcaatctgaaactcctc 250
             ||||||||||| |||||||| || ||||| ||||||||
Sbjct: 34360 gtctccgaccagaagctgtcgtcgatctggaactcctc 34397



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  111 bits (56), Expect = 3e-21
 Identities = 99/112 (88%), Gaps = 1/112 (0%)
 Strand = Plus / Plus

                                                                            
Query: 538      cgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcgg 597
                ||||||| |||||||||| | ||||||||||  ||| ||||||||| ||||||||||| |
Sbjct: 25817881 cgtggagatggatgatggtgtcctcctcctccttggagaagttgccccgcttgatgtccg 25817940

                                                                    
Query: 598      ggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgcagca 649
                | |||| ||||||||||||||||||| || |||||||||||||| |||||||
Sbjct: 25817941 gccgca-ggtagttgatccaccggagccggcagctcttgccgcaacgcagca 25817991



 Score =  103 bits (52), Expect = 8e-19
 Identities = 73/80 (91%)
 Strand = Plus / Plus

                                                                            
Query: 441      cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
                |||||||||||||| |||||||| ||||||||||||||||||||||||||||| || | |
Sbjct: 25817238 cgcttcttgaggtgggtgtgccacacgttcttgatctcgttgtccgtcctcccgggcaac 25817297

                                    
Query: 501      ctggcggcaatggtggacca 520
                ||||||||||| | ||||||
Sbjct: 25817298 ctggcggcaattgcggacca 25817317



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 51/53 (96%)
 Strand = Plus / Plus

                                                                     
Query: 441      cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
                |||||||||||||| |||| |||||||||||||||||||||||||||||||||
Sbjct: 30003199 cgcttcttgaggtgcgtgttccagacgttcttgatctcgttgtccgtcctccc 30003251



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 101/119 (84%), Gaps = 1/119 (0%)
 Strand = Plus / Plus

                                                                            
Query: 523      tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
                |||||||||| | | |||| |||| ||||||||   |||||||||||  |||||||||||
Sbjct: 30003385 tgttgccgagaaggccgtgaagcttgatgatggtctcctcctcctcggcggtgaagttgc 30003444

                                                                           
Query: 583      cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
                ||||||||| ||| || || | ||||||||||||||||||| || |||||||| |||||
Sbjct: 30003445 cgcgcttgaggtccggccgga-ggtagttgatccaccggagtcggcagctcttcccgca 30003502



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 62/70 (88%), Gaps = 1/70 (1%)
 Strand = Plus / Plus

                                                                            
Query: 575      gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
                ||||||||||||   |||||||||||| | |||||||| |||| |||||||| |||||||
Sbjct: 29970150 gaagttgccgcggcggatgtcggggcgga-ggtagttggtccagcggaggcggcagctct 29970208

                          
Query: 635      tgccgcagcg 644
                ||||||||||
Sbjct: 29970209 tgccgcagcg 29970218



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                   
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
                |||||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 29969834 cttcttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 29969884



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 101/121 (83%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                            
Query: 522      ctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctgg-tgaagtt 580
                ||||||||||| | ||||||||||||||||||||    |||||||| || || |||| ||
Sbjct: 22999347 ctgttgccgagaagggcgtggagctggatgatggtctgctcctcct-gcaggctgaactt 22999289

                                                                            
Query: 581      gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
                ||| | ||||||||| || ||  ||||||||  |||||||||| || |||||||||||||
Sbjct: 22999288 gcccctcttgatgtccggccg-gaggtagttcgtccaccggagtcggcagctcttgccgc 22999230

                 
Query: 641      a 641
                |
Sbjct: 22999229 a 22999229



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                               
Query: 441      cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgt 487
                |||||||| ||||| |||| ||||  |||||||||||||||||||||
Sbjct: 23000337 cgcttctttaggtgcgtgttccagtagttcttgatctcgttgtccgt 23000291



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 66/78 (84%), Gaps = 1/78 (1%)
 Strand = Plus / Plus

                                                                            
Query: 572      ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
                |||||||||||||||||||| ||||||||   |||||||| |||||  ||||||  ||||
Sbjct: 19617696 ggtgaagttgccgcgcttgaggtcggggc-tgaggtagttcatccagtggaggcagcagc 19617754

                                  
Query: 632      tcttgccgcagcgcagca 649
                |||| | |||||| ||||
Sbjct: 19617755 tctttcggcagcggagca 19617772



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 52/60 (86%), Gaps = 1/60 (1%)
 Strand = Plus / Minus

                                                                            
Query: 582      ccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
                |||||||||||||| || |||| |||||||  ||||||| || || ||||||||||||||
Sbjct: 26633780 ccgcgcttgatgtccggccgca-ggtagttcgtccaccgcagccggcagctcttgccgca 26633722



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 467      gttcttgatctcgttgtccgtcct 490
                ||||||||||||||||||||||||
Sbjct: 25379355 gttcttgatctcgttgtccgtcct 25379378



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 468      ttcttgatctcgttgtccgtcc 489
                ||||||||||||||||||||||
Sbjct: 26634256 ttcttgatctcgttgtccgtcc 26634235



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 213      gtctccgaccaaaagctgtcctcaatctgaaactcctc 250
                ||||||||||| |||||||| || ||||| ||||||||
Sbjct: 25816950 gtctccgaccagaagctgtcgtcgatctggaactcctc 25816987



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                 
Query: 523      tgttgccgagcatggcgtggagctggatgatgg 555
                |||||||||  |||||||||||||||| |||||
Sbjct: 26633839 tgttgccgacgatggcgtggagctggaggatgg 26633807



to top

>dbj|AK111798.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023105H16, full
           insert sequence
          Length = 1836

 Score =  111 bits (56), Expect = 3e-21
 Identities = 99/112 (88%), Gaps = 1/112 (0%)
 Strand = Plus / Minus

                                                                       
Query: 538 cgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcgg 597
           ||||||| |||||||||| | ||||||||||  ||| ||||||||| ||||||||||| |
Sbjct: 431 cgtggagatggatgatggtgtcctcctcctccttggagaagttgccccgcttgatgtccg 372

                                                               
Query: 598 ggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgcagca 649
           | |||| ||||||||||||||||||| || |||||||||||||| |||||||
Sbjct: 371 gccgca-ggtagttgatccaccggagccggcagctcttgccgcaacgcagca 321



 Score =  103 bits (52), Expect = 8e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                        
Query: 441  cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagc 500
            |||||||||||||| |||||||| ||||||||||||||||||||||||||||| || | |
Sbjct: 1074 cgcttcttgaggtgggtgtgccacacgttcttgatctcgttgtccgtcctcccgggcaac 1015

                                
Query: 501  ctggcggcaatggtggacca 520
            ||||||||||| | ||||||
Sbjct: 1014 ctggcggcaattgcggacca 995



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 213  gtctccgaccaaaagctgtcctcaatctgaaactcctc 250
            ||||||||||| |||||||| || ||||| ||||||||
Sbjct: 1362 gtctccgaccagaagctgtcgtcgatctggaactcctc 1325



to top

>gb|AF470058.1| Sorghum bicolor P-type R2R3 Myb protein (Myb4) gene, partial cds
          Length = 1958

 Score =  109 bits (55), Expect = 1e-20
 Identities = 110/127 (86%), Gaps = 1/127 (0%)
 Strand = Plus / Minus

                                                                        
Query: 523  tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
            |||||||||||||||||||||||| ||||||||   ||||||| |||  |||||||||||
Sbjct: 1688 tgttgccgagcatggcgtggagcttgatgatggtctcctcctcgtcggcggtgaagttgc 1629

                                                                        
Query: 583  cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcag 642
            ||||||| | ||| |||||  ||||||||||||||||| || || |||||||| ||||| 
Sbjct: 1628 cgcgcttcaggtccgggcg-gaggtagttgatccaccgcagccggcagctcttcccgcac 1570

                   
Query: 643  cgcagca 649
            |||||||
Sbjct: 1569 cgcagca 1563



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 456  gtgtgccagacgttcttgatctcgttgtccgtcct 490
            |||| ||||||||||||||||||||||||||||||
Sbjct: 1911 gtgttccagacgttcttgatctcgttgtccgtcct 1877



to top

>emb|AJ601377.1| Lolium multiflorum partial mRNA for putative R2R3 MYB transcription
           factor (myb2 gene)
          Length = 166

 Score =  109 bits (55), Expect = 1e-20
 Identities = 128/151 (84%), Gaps = 1/151 (0%)
 Strand = Plus / Minus

                                                                       
Query: 479 gttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgttgccgagcatggc 538
           |||||| |||||||| || ||||||||||| || |  |||||||||||||||||||    
Sbjct: 159 gttgtctgtcctccccggcagcctggcggcgatcgctgaccatctgttgccgagcagctg 100

                                                                       
Query: 539 gtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcggg 598
           ||||||||||||||| |    ||||||||||  || ||||||||||||||||||||| ||
Sbjct: 99  gtggagctggatgattgactgctcctcctcgtcggagaagttgccgcgcttgatgtccgg 40

                                          
Query: 599 gcgcaaggtagttgatccaccggaggcgaca 629
            ||| |||||||||||||||||||| |||||
Sbjct: 39  ccgc-aggtagttgatccaccggagccgaca 10



to top

>emb|AJ601381.1| Lolium multiflorum partial mRNA for putative R2R3 MYB transcription
           factor (myb6 gene)
          Length = 170

 Score =  107 bits (54), Expect = 5e-20
 Identities = 130/154 (84%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 479 gttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgttgccgagcatggc 538
           |||||| |||||||| || |||||||| || |||   |||||  |||||||||||| |||
Sbjct: 162 gttgtcggtcctccccggcagcctggccgcgatgagcgaccacttgttgccgagcacggc 103

                                                                       
Query: 539 gtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcggg 598
           |||||||| || ||||  | | ||||| |||| |||||||||||||||||||| ||||||
Sbjct: 102 gtggagcttgacgatgaggtcgtcctcgtcgcgggtgaagttgccgcgcttgaggtcggg 43

                                             
Query: 599 gcgcaaggtagttgatccaccggaggcgacagct 632
           |||  |||||||||||||| |||||||| |||||
Sbjct: 42  gcg-gaggtagttgatccagcggaggcggcagct 10



to top

>emb|X70879.1|HVMYB1G H.vulgare Myb1 gene
          Length = 2587

 Score =  105 bits (53), Expect = 2e-19
 Identities = 86/96 (89%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                        
Query: 561  tcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccg 620
            |||||||||  | |||||||||||||||||| ||||||||| | ||||||||||||| ||
Sbjct: 1225 tcctcctcgtggctgaagttgccgcgcttgaggtcggggcgga-ggtagttgatccagcg 1167

                                                
Query: 621  gaggcgacagctcttgccgcagcgcagcangccggc 656
            |||||| ||||||||||||||||| |||| ||||||
Sbjct: 1166 gaggcggcagctcttgccgcagcggagcaggccggc 1131



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 467  gttcttgatctcgttgtccgtcctccc 493
            |||||||||||||||||||||||||||
Sbjct: 1465 gttcttgatctcgttgtccgtcctccc 1439



to top

>gb|AY108280.1| Zea mays PCO132931 mRNA sequence
          Length = 1372

 Score =  105 bits (53), Expect = 2e-19
 Identities = 77/84 (91%), Gaps = 1/84 (1%)
 Strand = Plus / Minus

                                                                       
Query: 573 gtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagct 632
           ||||||||||||||||||| ||||||||| | ||||||||||||| |||||||| |||||
Sbjct: 350 gtgaagttgccgcgcttgaggtcggggcgga-ggtagttgatccagcggaggcggcagct 292

                                   
Query: 633 cttgccgcagcgcagcangccggc 656
           ||||||||||||||| | ||||||
Sbjct: 291 cttgccgcagcgcaggaggccggc 268



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 467 gttcttgatctcgttgtccgtcct 490
           ||||||||||||||||||||||||
Sbjct: 456 gttcttgatctcgttgtccgtcct 433



to top

>emb|AM156906.1| Zea mays mRNA for transcription factor MYB31 (myb31 gene)
          Length = 1264

 Score =  105 bits (53), Expect = 2e-19
 Identities = 77/84 (91%), Gaps = 1/84 (1%)
 Strand = Plus / Minus

                                                                       
Query: 573 gtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagct 632
           ||||||||||||||||||| ||||||||| | ||||||||||||| |||||||| |||||
Sbjct: 352 gtgaagttgccgcgcttgaggtcggggcgga-ggtagttgatccagcggaggcggcagct 294

                                   
Query: 633 cttgccgcagcgcagcangccggc 656
           ||||||||||||||| | ||||||
Sbjct: 293 cttgccgcagcgcaggaggccggc 270



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 467 gttcttgatctcgttgtccgtcct 490
           ||||||||||||||||||||||||
Sbjct: 458 gttcttgatctcgttgtccgtcct 435



to top

>ref|NM_190827.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 864

 Score =  101 bits (51), Expect = 3e-18
 Identities = 163/199 (81%), Gaps = 1/199 (0%)
 Strand = Plus / Minus

                                                                       
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcctggc 505
           ||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||    |
Sbjct: 339 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccccggcagctgccc 280

                                                                       
Query: 506 ggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctc 565
            |||||    |||||  |||||||||| | ||||||||||| |||||||    | || ||
Sbjct: 279 cgcaatcaacgaccacttgttgccgagaagggcgtggagcttgatgatgagctcgtcgtc 220

                                                                       
Query: 566 ctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggc 625
            |||  |||||||||||||||||||| ||||||||| | ||||||| ||||| |||||||
Sbjct: 219 gtcgtcggtgaagttgccgcgcttgaggtcggggcgga-ggtagttcatccagcggaggc 161

                              
Query: 626 gacagctcttgccgcagcg 644
           | |||||||||||||||||
Sbjct: 160 ggcagctcttgccgcagcg 142



to top

>gb|AY615198.1| Triticum aestivum transcription factor Myb1 (Myb1) mRNA, complete
           cds
          Length = 849

 Score =  101 bits (51), Expect = 3e-18
 Identities = 151/183 (82%), Gaps = 1/183 (0%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           ||||||||||||||||||||||||||| || || ||  |||| ||    |||||| ||||
Sbjct: 357 gttcttgatctcgttgtccgtcctccctgggagtctcccggctatcagagaccatttgtt 298

                                                                       
Query: 527 gccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcg 586
           ||| || | |  |||||||| |||||||    | ||||||||   | |||||||||||||
Sbjct: 297 gcccaggaggctgtggagcttgatgatgagctcgtcctcctcatcgctgaagttgccgcg 238

                                                                       
Query: 587 cttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           ||||| ||||||||| | ||||||||||||| |||||||| ||||||||||||||||| |
Sbjct: 237 cttgaggtcggggcgga-ggtagttgatccagcggaggcggcagctcttgccgcagcgga 179

              
Query: 647 gca 649
           |||
Sbjct: 178 gca 176



to top

>gb|AY459336.1| Oryza sativa (japonica cultivar-group) clone CL034244.2 R2R3-MYB gene
             region
          Length = 65993

 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                         
Query: 539   gtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcggg 598
             |||||||| |||||||  | | ||||| |||  |||||||||||||||||||| ||||||
Sbjct: 46683 gtggagcttgatgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttgaggtcggg 46742

                                                                       
Query: 599   gcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangccggc 656
             ||| | ||||||||||||| |||||||| ||||||||||||||||| || | ||||||
Sbjct: 46743 gcgga-ggtagttgatccagcggaggcggcagctcttgccgcagcggaggaggccggc 46799



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                 
Query: 467   gttcttgatctcgttgtccgtcctcccaggaagcct 502
             ||||||||||||||||||||||||||| || |||||
Sbjct: 46535 gttcttgatctcgttgtccgtcctccccggcagcct 46570



to top

>gb|BT009084.1| Triticum aestivum clone wkm1c.pk005.f4:fis, full insert mRNA
           sequence
          Length = 1183

 Score =  101 bits (51), Expect = 3e-18
 Identities = 151/183 (82%), Gaps = 1/183 (0%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           ||||||||||||||||||||||||||| || || ||  |||| ||    |||||| ||||
Sbjct: 444 gttcttgatctcgttgtccgtcctccctgggagtctcccggctatcagagaccatttgtt 385

                                                                       
Query: 527 gccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcg 586
           ||| || | |  |||||||| |||||||    | ||||||||   | |||||||||||||
Sbjct: 384 gcccaggaggctgtggagcttgatgatgagctcgtcctcctcatcgctgaagttgccgcg 325

                                                                       
Query: 587 cttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           ||||| ||||||||| | ||||||||||||| |||||||| ||||||||||||||||| |
Sbjct: 324 cttgaggtcggggcgga-ggtagttgatccagcggaggcggcagctcttgccgcagcgga 266

              
Query: 647 gca 649
           |||
Sbjct: 265 gca 263



to top

>gb|AF474138.1| Oryza sativa typical P-type R2R3 Myb protein gene, partial cds
          Length = 1252

 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 539 gtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcggg 598
           |||||||| |||||||  | | ||||| |||  |||||||||||||||||||| ||||||
Sbjct: 517 gtggagcttgatgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttgaggtcggg 576

                                                                     
Query: 599 gcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangccggc 656
           ||| | ||||||||||||| |||||||| ||||||||||||||||| || | ||||||
Sbjct: 577 gcgga-ggtagttgatccagcggaggcggcagctcttgccgcagcggaggaggccggc 633



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcct 502
           ||||||||||||||||||||||||||| || |||||
Sbjct: 369 gttcttgatctcgttgtccgtcctccccggcagcct 404



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                            
Query: 539      gtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcggg 598
                |||||||| |||||||  | | ||||| |||  |||||||||||||||||||| ||||||
Sbjct: 27541643 gtggagcttgatgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttgaggtcggg 27541702

                                                                          
Query: 599      gcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangccggc 656
                ||| | ||||||||||||| |||||||| ||||||||||||||||| || | ||||||
Sbjct: 27541703 gcgga-ggtagttgatccagcggaggcggcagctcttgccgcagcggaggaggccggc 27541759



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                     
Query: 441      cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
                |||||||||||||| |||| ||||| |||||||||||||||||||||||||||
Sbjct: 24045196 cgcttcttgaggtgcgtgttccagaagttcttgatctcgttgtccgtcctccc 24045248



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                      
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccagg 496
                |||||||| ||| |||| ||||  ||||||||||||||||||||||||||||||
Sbjct: 20593966 cttcttgatgtgagtgttccagtggttcttgatctcgttgtccgtcctcccagg 20593913



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                                 
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctc 491
                |||||||||||| |||| ||||  ||||||||| |||||||||||||||
Sbjct: 21234175 cttcttgaggtgcgtgttccagtagttcttgatgtcgttgtccgtcctc 21234127



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                    
Query: 467      gttcttgatctcgttgtccgtcctcccaggaagcct 502
                ||||||||||||||||||||||||||| || |||||
Sbjct: 27541495 gttcttgatctcgttgtccgtcctccccggcagcct 27541530



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                               
Query: 604     aggtagttgatccaccggaggcgacagctctt 635
               |||||||||||||||||||| || ||||||||
Sbjct: 2944467 aggtagttgatccaccggagccggcagctctt 2944498



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                         
Query: 436     ggagtcgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
               |||||| |||||| || | ||||| ||||  ||||||||  |||||||||||||||||
Sbjct: 9063509 ggagtctcttcttcagctttgtgttccagtagttcttgacatcgttgtccgtcctccc 9063452



to top

>dbj|AP003912.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1479_B11
          Length = 105702

 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                         
Query: 539   gtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcggg 598
             |||||||| |||||||  | | ||||| |||  |||||||||||||||||||| ||||||
Sbjct: 23933 gtggagcttgatgatgaggtcgtcctcgtcggcggtgaagttgccgcgcttgaggtcggg 23992

                                                                       
Query: 599   gcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangccggc 656
             ||| | ||||||||||||| |||||||| ||||||||||||||||| || | ||||||
Sbjct: 23993 gcgga-ggtagttgatccagcggaggcggcagctcttgccgcagcggaggaggccggc 24049



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                 
Query: 467   gttcttgatctcgttgtccgtcctcccaggaagcct 502
             ||||||||||||||||||||||||||| || |||||
Sbjct: 23785 gttcttgatctcgttgtccgtcctccccggcagcct 23820



to top

>dbj|AK060684.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-F12, full
           insert sequence
          Length = 1037

 Score =  101 bits (51), Expect = 3e-18
 Identities = 163/199 (81%), Gaps = 1/199 (0%)
 Strand = Plus / Minus

                                                                       
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcctggc 505
           ||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||    |
Sbjct: 435 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccccggcagctgccc 376

                                                                       
Query: 506 ggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctc 565
            |||||    |||||  |||||||||| | ||||||||||| |||||||    | || ||
Sbjct: 375 cgcaatcaacgaccacttgttgccgagaagggcgtggagcttgatgatgagctcgtcgtc 316

                                                                       
Query: 566 ctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggc 625
            |||  |||||||||||||||||||| ||||||||| | ||||||| ||||| |||||||
Sbjct: 315 gtcgtcggtgaagttgccgcgcttgaggtcggggcgga-ggtagttcatccagcggaggc 257

                              
Query: 626 gacagctcttgccgcagcg 644
           | |||||||||||||||||
Sbjct: 256 ggcagctcttgccgcagcg 238



to top

>gb|AY459342.1| Oryza sativa (japonica cultivar-group) clone CLC13210-1 R2R3-MYB
           gene region
          Length = 5648

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 105/122 (86%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                       
Query: 523 tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
           ||||||||||  |||||||||| |||||||||  || |||||| |||  || ||||  ||
Sbjct: 938 tgttgccgagggtggcgtggaggtggatgatgaggcgctcctcgtcgtcggagaagccgc 879

                                                                       
Query: 583 cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcag 642
           ||||||||||||| ||||| | |||||||| ||||||||||||| |||||||||||||||
Sbjct: 878 cgcgcttgatgtcagggcgga-ggtagttggtccaccggaggcggcagctcttgccgcag 820

             
Query: 643 cg 644
           ||
Sbjct: 819 cg 818



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 449  gaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
            |||||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 1104 gaggtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 1060



to top

>gb|AF515725.1| Lolium perenne R2R3 MYB protein MYB3 (MYB3) gene, partial cds
          Length = 277

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 66/70 (94%), Gaps = 1/70 (1%)
 Strand = Plus / Minus

                                                                       
Query: 575 gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
           ||||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||
Sbjct: 247 gaagttgccgcgcttgatgtcggggcgga-ggtagttgttccaccggaggcggcagctct 189

                     
Query: 635 tgccgcagcg 644
           ||||||||||
Sbjct: 188 tgccgcagcg 179



to top

>gb|AF474134.1| Oryza sativa typical P-type R2R3 Myb protein gene, partial cds
          Length = 2951

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 105/122 (86%), Gaps = 1/122 (0%)
 Strand = Plus / Plus

                                                                       
Query: 523 tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
           ||||||||||  |||||||||| |||||||||  || |||||| |||  || ||||  ||
Sbjct: 463 tgttgccgagggtggcgtggaggtggatgatgaggcgctcctcgtcgtcggagaagccgc 522

                                                                       
Query: 583 cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcag 642
           ||||||||||||| ||||| | |||||||| ||||||||||||| |||||||||||||||
Sbjct: 523 cgcgcttgatgtcagggcgga-ggtagttggtccaccggaggcggcagctcttgccgcag 581

             
Query: 643 cg 644
           ||
Sbjct: 582 cg 583



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 449 gaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
           |||||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 297 gaggtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 341



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 72/78 (92%), Gaps = 1/78 (1%)
 Strand = Plus / Minus

                                                                           
Query: 572     ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
               |||||||||||||||||||| ||||||||| | |||||||||||||||||||||| ||||
Sbjct: 3840340 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttgatccaccggaggcggcagc 3840282

                                 
Query: 632     tcttgccgcagcgcagca 649
               |||| ||||| |||||||
Sbjct: 3840281 tcttcccgcaacgcagca 3840264



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 61/65 (93%), Gaps = 1/65 (1%)
 Strand = Plus / Plus

                                                                            
Query: 581      gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
                ||||||||||| ||||||||| | |||||||||||||||||||||| |||||||||||||
Sbjct: 20034912 gccgcgcttgaggtcggggcgga-ggtagttgatccaccggaggcggcagctcttgccgc 20034970

                     
Query: 641      agcgc 645
                |||||
Sbjct: 20034971 agcgc 20034975



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                         
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgcagcg 644
                |||||||||| ||| |||||||| |||||||||||||||||
Sbjct: 27188237 aggtagttgagccagcggaggcggcagctcttgccgcagcg 27188197



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                        
Query: 446     cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
               ||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||||
Sbjct: 3840542 cttgatgtgggtgttccagtagttcttgatctcgttgtccgtcctccccggcagcct 3840486



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                   
Query: 604      aggtagttgatccaccggaggcgacagctcttgcc 638
                |||||||||| |||||||||||| |||||||||||
Sbjct: 23360189 aggtagttgacccaccggaggcggcagctcttgcc 23360223



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 467      gttcttgatctcgttgtccgtcctccc 493
                |||||||||||||||||| ||||||||
Sbjct: 23169402 gttcttgatctcgttgtcggtcctccc 23169428



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                         
Query: 443     cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
               |||||||||||| |||| ||||  ||||||||| ||||||||
Sbjct: 1200382 cttcttgaggtgggtgttccagtagttcttgatgtcgttgtc 1200423



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 461      ccagacgttcttgatctcgttgtc 484
                ||||| ||||||||||||||||||
Sbjct: 20033046 ccagaagttcttgatctcgttgtc 20033069



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
              complete sequence
          Length = 30731886

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 105/122 (86%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                          
Query: 523    tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
              ||||||||||  |||||||||| |||||||||  || |||||| |||  || ||||  ||
Sbjct: 716084 tgttgccgagggtggcgtggaggtggatgatgaggcgctcctcgtcgtcggagaagccgc 716025

                                                                          
Query: 583    cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcag 642
              ||||||||||||| ||||| | |||||||| ||||||||||||| |||||||||||||||
Sbjct: 716024 cgcgcttgatgtcagggcgga-ggtagttggtccaccggaggcggcagctcttgccgcag 715966

                
Query: 643    cg 644
              ||
Sbjct: 715965 cg 715964



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                                  
Query: 443     cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
               |||||||| |||||||| ||||  |||||||||||||||||||||||||||
Sbjct: 8262564 cttcttgatgtgtgtgttccagtggttcttgatctcgttgtccgtcctccc 8262514



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                           
Query: 449    gaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
              |||||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 716250 gaggtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 716206



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                            
Query: 467      gttcttgatctcgttgtccgtcctccca 494
                ||||||||||||||||||||||||||||
Sbjct: 27888555 gttcttgatctcgttgtccgtcctccca 27888582



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                               
Query: 615      ccaccggaggcgacagctcttgccgcagcgc 645
                |||||||||||| ||||||||||||||||||
Sbjct: 27888788 ccaccggaggcggcagctcttgccgcagcgc 27888818



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                      
Query: 443     cttcttgaggtgtgtgtgccagacgttcttgatctcgtt 481
               |||| ||||||| |||| ||||| |||||||||||||||
Sbjct: 6251362 cttcctgaggtgggtgttccagaagttcttgatctcgtt 6251324



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 619      cggaggcgacagctcttgccgcagcg 644
                |||||||| |||||||||||||||||
Sbjct: 23625783 cggaggcggcagctcttgccgcagcg 23625808



to top

>dbj|AP001552.1| Oryza sativa (japonica cultivar-group) geneomic DNA, chromosome 6, PAC
              clone:P0029D06
          Length = 150120

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 105/122 (86%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                          
Query: 523    tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
              ||||||||||  |||||||||| |||||||||  || |||||| |||  || ||||  ||
Sbjct: 122512 tgttgccgagggtggcgtggaggtggatgatgaggcgctcctcgtcgtcggagaagccgc 122453

                                                                          
Query: 583    cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcag 642
              ||||||||||||| ||||| | |||||||| ||||||||||||| |||||||||||||||
Sbjct: 122452 cgcgcttgatgtcagggcgga-ggtagttggtccaccggaggcggcagctcttgccgcag 122394

                
Query: 643    cg 644
              ||
Sbjct: 122393 cg 122392



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                           
Query: 449    gaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
              |||||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 122678 gaggtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 122634



to top

>gb|AF099388.1|AF099388 Zea mays clone ZmMYBIF22 R2R3MYB-domain protein mRNA, partial cds
          Length = 129

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 111/130 (85%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 485 cgtcctcccaggaagcctggcggcaatggtggaccatctgttgccgagcatggcgtggag 544
           ||||| ||| || ||||||||||| |||| |||||| ||||||||||||    |||||||
Sbjct: 129 cgtccgcccgggcagcctggcggcgatggcggaccacctgttgccgagctgctcgtggag 70

                                                                       
Query: 545 ctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaa 604
              |||||||||| ||||||||||  || |||||||||||||||||||||| |||||| |
Sbjct: 69  gctgatgatggcgtcctcctcctccttgctgaagttgccgcgcttgatgtccgggcgc-a 11

                     
Query: 605 ggtagttgat 614
           ||||||||||
Sbjct: 10  ggtagttgat 1



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 72/78 (92%), Gaps = 1/78 (1%)
 Strand = Plus / Minus

                                                                           
Query: 572     ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
               |||||||||||||||||||| ||||||||| | |||||||||||||||||||||| ||||
Sbjct: 3840314 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttgatccaccggaggcggcagc 3840256

                                 
Query: 632     tcttgccgcagcgcagca 649
               |||| ||||| |||||||
Sbjct: 3840255 tcttcccgcaacgcagca 3840238



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 61/65 (93%), Gaps = 1/65 (1%)
 Strand = Plus / Plus

                                                                            
Query: 581      gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
                ||||||||||| ||||||||| | |||||||||||||||||||||| |||||||||||||
Sbjct: 19961126 gccgcgcttgaggtcggggcgga-ggtagttgatccaccggaggcggcagctcttgccgc 19961184

                     
Query: 641      agcgc 645
                |||||
Sbjct: 19961185 agcgc 19961189



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                         
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgcagcg 644
                |||||||||| ||| |||||||| |||||||||||||||||
Sbjct: 27113837 aggtagttgagccagcggaggcggcagctcttgccgcagcg 27113797



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                        
Query: 446     cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
               ||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||||
Sbjct: 3840516 cttgatgtgggtgttccagtagttcttgatctcgttgtccgtcctccccggcagcct 3840460



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                   
Query: 604      aggtagttgatccaccggaggcgacagctcttgcc 638
                |||||||||| |||||||||||| |||||||||||
Sbjct: 23288380 aggtagttgacccaccggaggcggcagctcttgcc 23288414



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 467      gttcttgatctcgttgtccgtcctccc 493
                |||||||||||||||||| ||||||||
Sbjct: 23097593 gttcttgatctcgttgtcggtcctccc 23097619



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                         
Query: 443     cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
               |||||||||||| |||| ||||  ||||||||| ||||||||
Sbjct: 1200382 cttcttgaggtgggtgttccagtagttcttgatgtcgttgtc 1200423



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 461      ccagacgttcttgatctcgttgtc 484
                ||||| ||||||||||||||||||
Sbjct: 19959260 ccagaagttcttgatctcgttgtc 19959283



to top

>emb|AL732376.2|CNS08C8Z Oryza sativa chromosome 12, . BAC OSJNBa0086B10 of library OSJNBa
            from chromosome 12 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 152090

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 72/78 (92%), Gaps = 1/78 (1%)
 Strand = Plus / Minus

                                                                        
Query: 572  ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
            |||||||||||||||||||| ||||||||| | |||||||||||||||||||||| ||||
Sbjct: 2316 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttgatccaccggaggcggcagc 2258

                              
Query: 632  tcttgccgcagcgcagca 649
            |||| ||||| |||||||
Sbjct: 2257 tcttcccgcaacgcagca 2240



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 446  cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
            ||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||||
Sbjct: 2518 cttgatgtgggtgttccagtagttcttgatctcgttgtccgtcctccccggcagcct 2462



to top

>gb|AC130600.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0048I21, complete sequence
          Length = 137650

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 68/73 (93%), Gaps = 1/73 (1%)
 Strand = Plus / Plus

                                                                         
Query: 572   ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
             |||||||||||||||||||| ||||||||| | ||||||| |||||||||||||| ||||
Sbjct: 82767 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagc 82825

                          
Query: 632   tcttgccgcagcg 644
             |||||||||||||
Sbjct: 82826 tcttgccgcagcg 82838



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                             
Query: 446   cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
             ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 82541 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 82588



to top

>ref|XM_475269.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 783

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 68/73 (93%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||| ||||||||| | ||||||| |||||||||||||| ||||
Sbjct: 213 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagc 155

                        
Query: 632 tcttgccgcagcg 644
           |||||||||||||
Sbjct: 154 tcttgccgcagcg 142



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
           ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 339 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 292



to top

>gb|AF470090.1| Zea mays P-type R2R3 Myb protein (Myb49) gene, complete cds
          Length = 773

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 68/73 (93%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           ||||||||||||||||||||||||||||||  ||||||||| |||| |||||||| ||||
Sbjct: 397 ggtgaagttgccgcgcttgatgtcggggcg-gaggtagttggtccagcggaggcggcagc 339

                        
Query: 632 tcttgccgcagcg 644
           |||||||||||||
Sbjct: 338 tcttgccgcagcg 326



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 467 gttcttgatctcgttgtccgtcc 489
           |||||||||||||||||||||||
Sbjct: 615 gttcttgatctcgttgtccgtcc 593



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 68/73 (93%), Gaps = 1/73 (1%)
 Strand = Plus / Plus

                                                                            
Query: 572      ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
                |||||||||||||||||||| ||||||||| | ||||||| |||||||||||||| ||||
Sbjct: 20955989 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagc 20956047

                             
Query: 632      tcttgccgcagcg 644
                |||||||||||||
Sbjct: 20956048 tcttgccgcagcg 20956060



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                                 
Query: 461      ccagacgttcttgatctcgttgtccgtcctccc 493
                ||||| |||||||||||||||||||||||||||
Sbjct: 26781404 ccagaagttcttgatctcgttgtccgtcctccc 26781372



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                                
Query: 446      cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
                ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 20955763 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 20955810



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                         
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgcagcg 644
                |||||||||| ||||||||| |  |||||||||||||||||
Sbjct: 27305473 aggtagttgagccaccggagcctgcagctcttgccgcagcg 27305513



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 468     ttcttgatctcgttgtccgtcctcccagg 496
               ||||||||||||||||| |||||||||||
Sbjct: 2253557 ttcttgatctcgttgtcagtcctcccagg 2253529



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                      
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgca 641
                ||||||||||||||||| || |  ||||||||||||||
Sbjct: 26781137 aggtagttgatccaccgcagcctgcagctcttgccgca 26781100



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 460    gccagacgttcttgatctcgttgtc 484
              |||||| ||||||||||||||||||
Sbjct: 771198 gccagaagttcttgatctcgttgtc 771174



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                   
Query: 604     aggtagttgatccaccggaggcgacagctcttgccg 639
               |||||||| | ||||||||| || ||||||||||||
Sbjct: 1848300 aggtagttcagccaccggagacggcagctcttgccg 1848335



to top

>dbj|AK104053.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-G03, full
           insert sequence
          Length = 1042

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 68/73 (93%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||| ||||||||| | ||||||| |||||||||||||| ||||
Sbjct: 346 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagc 288

                        
Query: 632 tcttgccgcagcg 644
           |||||||||||||
Sbjct: 287 tcttgccgcagcg 275



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
           ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 472 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 425



to top

>dbj|AK099108.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023030O22, full
           insert sequence
          Length = 1023

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 68/73 (93%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||| ||||||||| | ||||||| |||||||||||||| ||||
Sbjct: 355 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagc 297

                        
Query: 632 tcttgccgcagcg 644
           |||||||||||||
Sbjct: 296 tcttgccgcagcg 284



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
           ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 481 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 434



to top

>dbj|AK066834.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013083O13, full
           insert sequence
          Length = 1069

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 68/73 (93%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||| ||||||||| | ||||||| |||||||||||||| ||||
Sbjct: 351 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagc 293

                        
Query: 632 tcttgccgcagcg 644
           |||||||||||||
Sbjct: 292 tcttgccgcagcg 280



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
           ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 477 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 430



to top

>emb|AM156904.1| Zea mays mRNA for transcription factor MYB2 (myb2 gene)
          Length = 1339

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 68/73 (93%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           ||||||||||||||||||||||||||||||  ||||||||| |||| |||||||| ||||
Sbjct: 290 ggtgaagttgccgcgcttgatgtcggggcg-gaggtagttggtccagcggaggcggcagc 232

                        
Query: 632 tcttgccgcagcg 644
           |||||||||||||
Sbjct: 231 tcttgccgcagcg 219



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 467 gttcttgatctcgttgtccgtcc 489
           |||||||||||||||||||||||
Sbjct: 395 gttcttgatctcgttgtccgtcc 373



to top

>dbj|D88617.1| Oryza sativa mRNA for OSMYB1, complete cds
          Length = 1176

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 68/73 (93%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||| ||||||||| | ||||||| |||||||||||||| ||||
Sbjct: 338 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagc 280

                        
Query: 632 tcttgccgcagcg 644
           |||||||||||||
Sbjct: 279 tcttgccgcagcg 267



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
           ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 464 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 417



to top

>gb|AF474115.1| Zea mays typical P-type R2R3 Myb protein (Myb1) gene, partial cds
          Length = 2399

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 160/196 (81%), Gaps = 1/196 (0%)
 Strand = Plus / Minus

                                                                        
Query: 449  gaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcctggcggc 508
            |||||| |||| ||||  |||||||||||||||||| || |  || || ||| ||| |||
Sbjct: 2112 gaggtgcgtgttccagtagttcttgatctcgttgtcggtgcggccggggagcttggtggc 2053

                                                                        
Query: 509  aatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctcctc 568
             |||| ||||||  |||||||||| | || |||||| |||| ||||  | | ||||| ||
Sbjct: 2052 gatggaggaccacttgttgccgaggagggagtggaggtggacgatgaggtcttcctcgtc 1993

                                                                        
Query: 569  gctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgac 628
            |  ||||||  ||||||||||||||||||||||  ||||||||| |||| || ||||| |
Sbjct: 1992 gtcggtgaacctgccgcgcttgatgtcggggcg-gaggtagttggtccatcgcaggcggc 1934

                            
Query: 629  agctcttgccgcagcg 644
            ||||||||||||||||
Sbjct: 1933 agctcttgccgcagcg 1918



to top

>ref|XM_463409.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 828

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 65/70 (92%), Gaps = 1/70 (1%)
 Strand = Plus / Minus

                                                                       
Query: 584 gcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagc 643
           |||||||||||||||||| | ||||||| |||||||||||||| ||||||||||||||||
Sbjct: 225 gcgcttgatgtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgcagc 167

                     
Query: 644 gcagcangcc 653
           |||||| |||
Sbjct: 166 gcagcaggcc 157



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 467 gttcttgatctcgttgtccgt 487
           |||||||||||||||||||||
Sbjct: 342 gttcttgatctcgttgtccgt 322



to top

>gb|AY459344.1| Oryza sativa (japonica cultivar-group) clone CL034867.1 R2R3-MYB gene
            region
          Length = 49192

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 65/70 (92%), Gaps = 1/70 (1%)
 Strand = Plus / Plus

                                                                        
Query: 584  gcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagc 643
            |||||||||||||||||| | ||||||| |||||||||||||| ||||||||||||||||
Sbjct: 7885 gcgcttgatgtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgcagc 7943

                      
Query: 644  gcagcangcc 653
            |||||| |||
Sbjct: 7944 gcagcaggcc 7953



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 467  gttcttgatctcgttgtccgt 487
            |||||||||||||||||||||
Sbjct: 7675 gttcttgatctcgttgtccgt 7695



to top

>emb|X70880.1|HVMYB2G H.vulgare Myb2 gene
          Length = 1093

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 74/82 (90%), Gaps = 1/82 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           ||||||||||||||| |||| ||||||||| | ||||||| ||||| |||||||| ||||
Sbjct: 858 ggtgaagttgccgcgtttgaggtcggggcgga-ggtagttcatccagcggaggcggcagc 800

                                 
Query: 632 tcttgccgcagcgcagcangcc 653
           |||||||||||||||||| |||
Sbjct: 799 tcttgccgcagcgcagcaggcc 778



to top

>gb|AF474140.1| Oryza sativa typical P-type R2R3 Myb protein gene, partial cds
          Length = 1021

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 65/70 (92%), Gaps = 1/70 (1%)
 Strand = Plus / Plus

                                                                       
Query: 584 gcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagc 643
           |||||||||||||||||| | ||||||| |||||||||||||| ||||||||||||||||
Sbjct: 368 gcgcttgatgtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgcagc 426

                     
Query: 644 gcagcangcc 653
           |||||| |||
Sbjct: 427 gcagcaggcc 436



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 467 gttcttgatctcgttgtccgt 487
           |||||||||||||||||||||
Sbjct: 158 gttcttgatctcgttgtccgt 178



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 65/70 (92%), Gaps = 1/70 (1%)
 Strand = Plus / Minus

                                                                            
Query: 584      gcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagc 643
                |||||||||||||||||| | ||||||| |||||||||||||| ||||||||||||||||
Sbjct: 28790048 gcgcttgatgtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgcagc 28789990

                          
Query: 644      gcagcangcc 653
                |||||| |||
Sbjct: 28789989 gcagcaggcc 28789980



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 104/122 (85%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                            
Query: 523      tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
                |||||||||| | ||||||||||| |||||||    | || || |||  |||||||||||
Sbjct: 37925870 tgttgccgagaagggcgtggagcttgatgatgagctcgtcgtcgtcgtcggtgaagttgc 37925811

                                                                            
Query: 583      cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcag 642
                ||||||||| ||||||||| | ||||||| ||||| |||||||| |||||||||||||||
Sbjct: 37925810 cgcgcttgaggtcggggcgga-ggtagttcatccagcggaggcggcagctcttgccgcag 37925752

                  
Query: 643      cg 644
                ||
Sbjct: 37925751 cg 37925750



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 60/65 (92%), Gaps = 1/65 (1%)
 Strand = Plus / Minus

                                                                           
Query: 581     gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
               ||||||||||| ||||||||| | ||||||| |||||||||||||| |||||||||||||
Sbjct: 3532086 gccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgc 3532028

                    
Query: 641     agcgc 645
               |||||
Sbjct: 3532027 agcgc 3532023



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                     
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangccggc 656
                ||||||||||||||||| || |  |||||||||||||||||||||| ||||||
Sbjct: 11348867 aggtagttgatccaccgaagcctgcagctcttgccgcagcgcagcaggccggc 11348815



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                      
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgca 641
                |||||||||| |||||||||||| ||||||||||||||
Sbjct: 30110983 aggtagttgagccaccggaggcggcagctcttgccgca 30110946



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                                 
Query: 461      ccagacgttcttgatctcgttgtccgtcctccc 493
                ||||| |||||||||||||||||||||||||||
Sbjct: 29126331 ccagaagttcttgatctcgttgtccgtcctccc 29126363



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                                
Query: 446      cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
                ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 37926029 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 37925982



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/92 (85%), Gaps = 3/92 (3%)
 Strand = Plus / Plus

                                                                            
Query: 551      gatggcgccctcctcctcgctg-gtgaagttgccgcgcttgatgtcggggcgcaaggtag 609
                ||||||| ||||||||| |||| | |||| |||| ||||| | ||||||||||| |||||
Sbjct: 29126542 gatggcgtcctcctcct-gctgcgagaagctgccccgcttcaggtcggggcgca-ggtag 29126599

                                                
Query: 610      ttgatccaccggaggcgacagctcttgccgca 641
                ||||||||||| || |  ||||||||||||||
Sbjct: 29126600 ttgatccaccgcagcctgcagctcttgccgca 29126631



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                           
Query: 467      gttcttgatctcgttgtccgtcctccc 493
                |||||||||||||||||||||||||||
Sbjct: 10933408 gttcttgatctcgttgtccgtcctccc 10933382



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                          
Query: 467     gttcttgatctcgttgtccgtcctccc 493
               |||||||||||||||||||||||||||
Sbjct: 1549325 gttcttgatctcgttgtccgtcctccc 1549351



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                         
Query: 461     ccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
               ||||| |||||||||||||||||||| |||||| || |||||
Sbjct: 3532314 ccagaagttcttgatctcgttgtccgacctccccggcagcct 3532273



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                             
Query: 461      ccagacgttcttgatctcgttgtccgtcc 489
                ||||| |||||||||||||||||||||||
Sbjct: 20237742 ccagaagttcttgatctcgttgtccgtcc 20237770



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                                
Query: 516      gaccatctgttgccgagcatggcgtggagctg 547
                ||||| |||||||||||| |||||||||||||
Sbjct: 43089446 gaccacctgttgccgagcttggcgtggagctg 43089415



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                                
Query: 604      aggtagttgatccaccggaggcgacagctctt 635
                |||||||||| |||||||||||| ||||||||
Sbjct: 10933272 aggtagttgagccaccggaggcggcagctctt 10933241



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 467     gttcttgatctcgttgtccgtcct 490
               ||||||||||||||||||||||||
Sbjct: 3520252 gttcttgatctcgttgtccgtcct 3520275



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 615      ccaccggaggcgacagctcttgccgca 641
                |||||||||||| ||||||||||||||
Sbjct: 34502922 ccaccggaggcggcagctcttgccgca 34502896



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 467      gttcttgatctcgttgtccgt 487
                |||||||||||||||||||||
Sbjct: 28790258 gttcttgatctcgttgtccgt 28790238



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 45/52 (86%), Gaps = 1/52 (1%)
 Strand = Plus / Plus

                                                                   
Query: 590     gatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
               |||||||||||| | ||||||||| |||||| || |  ||||||||||||||
Sbjct: 4917796 gatgtcggggcgga-ggtagttgagccaccgcagcctgcagctcttgccgca 4917846



to top

>dbj|AP003373.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
            clone:OJ1116_H09
          Length = 110086

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 65/70 (92%), Gaps = 1/70 (1%)
 Strand = Plus / Minus

                                                                        
Query: 584  gcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagc 643
            |||||||||||||||||| | ||||||| |||||||||||||| ||||||||||||||||
Sbjct: 8091 gcgcttgatgtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgcagc 8033

                      
Query: 644  gcagcangcc 653
            |||||| |||
Sbjct: 8032 gcagcaggcc 8023



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 467  gttcttgatctcgttgtccgt 487
            |||||||||||||||||||||
Sbjct: 8301 gttcttgatctcgttgtccgt 8281



to top

>dbj|AK108259.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-A12, full
           insert sequence
          Length = 1031

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 65/70 (92%), Gaps = 1/70 (1%)
 Strand = Plus / Minus

                                                                       
Query: 584 gcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagc 643
           |||||||||||||||||| | ||||||| |||||||||||||| ||||||||||||||||
Sbjct: 266 gcgcttgatgtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgcagc 208

                     
Query: 644 gcagcangcc 653
           |||||| |||
Sbjct: 207 gcagcaggcc 198



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 467 gttcttgatctcgttgtccgt 487
           |||||||||||||||||||||
Sbjct: 383 gttcttgatctcgttgtccgt 363



to top

>gb|AY108544.1| Zea mays PCO117007 mRNA sequence
          Length = 410

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 74/82 (90%), Gaps = 1/82 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||| ||| ||||| | ||||||||||||| || ||||| ||||
Sbjct: 247 ggtgaagttgccgcgcttgaggtccgggcgga-ggtagttgatccagcgcaggcggcagc 189

                                 
Query: 632 tcttgccgcagcgcagcangcc 653
           |||||||||||||||||| |||
Sbjct: 188 tcttgccgcagcgcagcaggcc 167



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 467 gttcttgatctcgttgtccgtcc 489
           |||||||||||||||||||||||
Sbjct: 353 gttcttgatctcgttgtccgtcc 331



to top

>dbj|D88620.1| Oryza sativa mRNA for OSMYB4, complete cds
          Length = 1014

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 65/70 (92%), Gaps = 1/70 (1%)
 Strand = Plus / Minus

                                                                       
Query: 584 gcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagc 643
           |||||||||||||||||| | ||||||| |||||||||||||| ||||||||||||||||
Sbjct: 279 gcgcttgatgtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgcagc 221

                     
Query: 644 gcagcangcc 653
           |||||| |||
Sbjct: 220 gcagcaggcc 211



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 467 gttcttgatctcgttgtccgt 487
           |||||||||||||||||||||
Sbjct: 396 gttcttgatctcgttgtccgt 376



to top

>gb|AF470077.1| Zea mays P-type R2R3 Myb protein (Myb14) gene, partial cds
          Length = 2268

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 71/78 (91%), Gaps = 1/78 (1%)
 Strand = Plus / Minus

                                                                        
Query: 572  ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
            |||||||||||||||||||| ||| ||||||| |||||||||||||||| || || ||||
Sbjct: 1805 ggtgaagttgccgcgcttgaggtccgggcgca-ggtagttgatccaccgcagccggcagc 1747

                              
Query: 632  tcttgccgcagcgcagca 649
            |||| |||||||||||||
Sbjct: 1746 tcttcccgcagcgcagca 1729



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 446  cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcct 490
            ||||| ||| |||| ||||  ||||||||||||||||||||||||
Sbjct: 2011 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcct 1967



to top

>gb|AF474122.1| Zea mays typical P-type R2R3 Myb protein (Myb47) gene, partial cds
          Length = 923

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 71/78 (91%), Gaps = 1/78 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||| ||| ||||||| |||||||||||||||| || || ||||
Sbjct: 460 ggtgaagttgccgcgcttgaggtccgggcgca-ggtagttgatccaccgcagccggcagc 402

                             
Query: 632 tcttgccgcagcgcagca 649
           |||| |||||||||||||
Sbjct: 401 tcttcccgcagcgcagca 384



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcct 490
           ||||| ||| |||| ||||  ||||||||||||||||||||||||
Sbjct: 666 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcct 622



to top

>gb|AF467734.1| Oryza sativa putative myb protein mRNA, partial cds
          Length = 600

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 104/122 (85%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                       
Query: 523 tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
           |||||||||| | ||||||||||| |||||||    | || || |||  |||||||||||
Sbjct: 334 tgttgccgagaagggcgtggagcttgatgatgagctcgtcgtcgtcgtcggtgaagttgc 275

                                                                       
Query: 583 cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcag 642
           ||||||||| ||||||||| | ||||||| ||||| |||||||| |||||||||||||||
Sbjct: 274 cgcgcttgaggtcggggcgga-ggtagttcatccagcggaggcggcagctcttgccgcag 216

             
Query: 643 cg 644
           ||
Sbjct: 215 cg 214



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 42/48 (87%), Gaps = 1/48 (2%)
 Strand = Plus / Minus

                                                           
Query: 446 cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
           ||||| ||| |||| ||||  ||||||||||||| |||||||||||||
Sbjct: 409 cttgatgtgcgtgttccagtagttcttgatctcg-tgtccgtcctccc 363



to top

>dbj|AP004669.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0491F11
          Length = 152274

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 104/122 (85%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                          
Query: 523    tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
              |||||||||| | ||||||||||| |||||||    | || || |||  |||||||||||
Sbjct: 147226 tgttgccgagaagggcgtggagcttgatgatgagctcgtcgtcgtcgtcggtgaagttgc 147167

                                                                          
Query: 583    cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcag 642
              ||||||||| ||||||||| | ||||||| ||||| |||||||| |||||||||||||||
Sbjct: 147166 cgcgcttgaggtcggggcgga-ggtagttcatccagcggaggcggcagctcttgccgcag 147108

                
Query: 643    cg 644
              ||
Sbjct: 147107 cg 147106



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 446    cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
              ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 147385 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 147338



to top

>dbj|AP003297.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0698A10
          Length = 137348

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 104/122 (85%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                        
Query: 523  tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
            |||||||||| | ||||||||||| |||||||    | || || |||  |||||||||||
Sbjct: 6814 tgttgccgagaagggcgtggagcttgatgatgagctcgtcgtcgtcgtcggtgaagttgc 6755

                                                                        
Query: 583  cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcag 642
            ||||||||| ||||||||| | ||||||| ||||| |||||||| |||||||||||||||
Sbjct: 6754 cgcgcttgaggtcggggcgga-ggtagttcatccagcggaggcggcagctcttgccgcag 6696

              
Query: 643  cg 644
            ||
Sbjct: 6695 cg 6694



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 446  cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
            ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 6973 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 6926



to top

>dbj|AP003922.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0648C09
          Length = 107522

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 104/122 (85%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                         
Query: 523   tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
             |||||||||| | ||||||||||| |||||||    | || || |||  |||||||||||
Sbjct: 22146 tgttgccgagaagggcgtggagcttgatgatgagctcgtcgtcgtcgtcggtgaagttgc 22087

                                                                         
Query: 583   cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcag 642
             ||||||||| ||||||||| | ||||||| ||||| |||||||| |||||||||||||||
Sbjct: 22086 cgcgcttgaggtcggggcgga-ggtagttcatccagcggaggcggcagctcttgccgcag 22028

               
Query: 643   cg 644
             ||
Sbjct: 22027 cg 22026



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                             
Query: 446   cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
             ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 22305 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 22258



to top

>gb|AY459335.1| Oryza sativa (japonica cultivar-group) clone CL026180.5 R2R3-MYB gene
             region
          Length = 24910

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 67/73 (91%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                         
Query: 572   ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
             |||||||||||||||||||| ||||||||| | ||||||| ||||| |||||||| ||||
Sbjct: 20785 ggtgaagttgccgcgcttgaggtcggggcgga-ggtagttcatccagcggaggcggcagc 20727

                          
Query: 632   tcttgccgcagcg 644
             |||||||||||||
Sbjct: 20726 tcttgccgcagcg 20714



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                             
Query: 446   cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
             ||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 20993 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 20946



to top

>emb|AL731579.4|OSJN00225 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0006A01,
             complete sequence
          Length = 143157

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 51/53 (96%)
 Strand = Plus / Plus

                                                                  
Query: 441   cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
             |||||||||||||| |||| |||||||||||||||||||||||||||||||||
Sbjct: 42881 cgcttcttgaggtgcgtgttccagacgttcttgatctcgttgtccgtcctccc 42933



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 101/119 (84%), Gaps = 1/119 (0%)
 Strand = Plus / Plus

                                                                         
Query: 523   tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
             |||||||||| | | |||| |||| ||||||||   |||||||||||  |||||||||||
Sbjct: 43067 tgttgccgagaaggccgtgaagcttgatgatggtctcctcctcctcggcggtgaagttgc 43126

                                                                        
Query: 583   cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
             ||||||||| ||| || ||  |||||||||||||||||||| || |||||||| |||||
Sbjct: 43127 cgcgcttgaggtccggccg-gaggtagttgatccaccggagtcggcagctcttcccgca 43184



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 62/70 (88%), Gaps = 1/70 (1%)
 Strand = Plus / Plus

                                                                        
Query: 575  gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
            ||||||||||||   |||||||||||| | |||||||| |||| |||||||| |||||||
Sbjct: 9832 gaagttgccgcggcggatgtcggggcgga-ggtagttggtccagcggaggcggcagctct 9890

                      
Query: 635  tgccgcagcg 644
            ||||||||||
Sbjct: 9891 tgccgcagcg 9900



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 443  cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
            |||||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 9516 cttcttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 9566



to top

>emb|AL662952.6|OSJN00151 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0009P12,
              complete sequence
          Length = 179644

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 51/53 (96%)
 Strand = Plus / Plus

                                                                   
Query: 441    cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
              |||||||||||||| |||| |||||||||||||||||||||||||||||||||
Sbjct: 139951 cgcttcttgaggtgcgtgttccagacgttcttgatctcgttgtccgtcctccc 140003



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 101/119 (84%), Gaps = 1/119 (0%)
 Strand = Plus / Plus

                                                                          
Query: 523    tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
              |||||||||| | | |||| |||| ||||||||   |||||||||||  |||||||||||
Sbjct: 140137 tgttgccgagaaggccgtgaagcttgatgatggtctcctcctcctcggcggtgaagttgc 140196

                                                                         
Query: 583    cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
              ||||||||| ||| || || | ||||||||||||||||||| || |||||||| |||||
Sbjct: 140197 cgcgcttgaggtccggccgga-ggtagttgatccaccggagtcggcagctcttcccgca 140254



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 62/70 (88%), Gaps = 1/70 (1%)
 Strand = Plus / Plus

                                                                          
Query: 575    gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
              ||||||||||||   |||||||||||| | |||||||| |||| |||||||| |||||||
Sbjct: 106902 gaagttgccgcggcggatgtcggggcgga-ggtagttggtccagcggaggcggcagctct 106960

                        
Query: 635    tgccgcagcg 644
              ||||||||||
Sbjct: 106961 tgccgcagcg 106970



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                 
Query: 443    cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
              |||||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 106586 cttcttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccc 106636



to top

>gb|AF099377.1|AF099377 Zea mays clone ZmMYB4H47 R2R3MYB-domain protein mRNA, partial cds
          Length = 129

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 88/101 (87%), Gaps = 1/101 (0%)
 Strand = Plus / Minus

                                                                       
Query: 514 tggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctgg 573
           |||||||  |||| ||||||| | ||||||||| |||||||||  |||||||||||  ||
Sbjct: 100 tggaccacttgttcccgagcaagccgtggagcttgatgatggcctcctcctcctcggcgg 41

                                                    
Query: 574 tgaagttgccgcgcttgatgtcggggcgcaaggtagttgat 614
           |||||||||||||||||| ||| |||||| |||||||||||
Sbjct: 40  tgaagttgccgcgcttgaggtccgggcgc-aggtagttgat 1



to top

>emb|AL713900.4|CNS07YQ0 Oryza sativa chromosome 12, . BAC OJ1126_F07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 99791

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 61/65 (93%), Gaps = 1/65 (1%)
 Strand = Plus / Plus

                                                                         
Query: 581   gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
             ||||||||||| ||||||||| | |||||||||||||||||||||| |||||||||||||
Sbjct: 15074 gccgcgcttgaggtcggggcgga-ggtagttgatccaccggaggcggcagctcttgccgc 15132

                  
Query: 641   agcgc 645
             |||||
Sbjct: 15133 agcgc 15137



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 461   ccagacgttcttgatctcgttgtc 484
             ||||| ||||||||||||||||||
Sbjct: 13208 ccagaagttcttgatctcgttgtc 13231



to top

>gb|AF474117.1| Zea mays typical P-type R2R3 Myb protein (Myb18) gene, partial cds
          Length = 1900

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 159/196 (81%), Gaps = 1/196 (0%)
 Strand = Plus / Minus

                                                                        
Query: 449  gaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcctggcggc 508
            |||||| |||| ||||  |||||||||||||||||| |||| ||| |  ||| ||| |||
Sbjct: 1782 gaggtgcgtgttccagtagttcttgatctcgttgtcggtccgcccggacagcttggtggc 1723

                                                                        
Query: 509  aatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctcctc 568
            ||||| | ||||| |||| ||||| | || |||||| ||||| |||     |||||| ||
Sbjct: 1722 aatggcgcaccatttgttcccgaggagggagtggaggtggataatgagcttctcctcgtc 1663

                                                                        
Query: 569  gctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgac 628
            |  |||||||  ||||||||| ||||| ||||| | |||||||| |||| |||||||| |
Sbjct: 1662 gtcggtgaagcggccgcgcttaatgtccgggcgga-ggtagttggtccagcggaggcggc 1604

                            
Query: 629  agctcttgccgcagcg 644
            ||||||||||||||||
Sbjct: 1603 agctcttgccgcagcg 1588



to top

>emb|X70881.1|HVMYB3G H.vulgare myb3 gene
          Length = 3241

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 60/64 (93%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                        
Query: 581  gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
            ||||||||||| ||||||||| | |||||||||||||||||||||| |||||||||||||
Sbjct: 1274 gccgcgcttgaggtcggggcgga-ggtagttgatccaccggaggcggcagctcttgccgc 1216

                
Query: 641  agcg 644
            ||||
Sbjct: 1215 agcg 1212



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 461  ccagacgttcttgatctcgttgtccgtcc 489
            ||||| |||||||||||||||||||||||
Sbjct: 1548 ccagaagttcttgatctcgttgtccgtcc 1520



to top

>emb|X70878.1|HVMYB3 H.vulgare myb3 mRNA
          Length = 1270

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 60/64 (93%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                       
Query: 581 gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
           ||||||||||| ||||||||| | |||||||||||||||||||||| |||||||||||||
Sbjct: 274 gccgcgcttgaggtcggggcgga-ggtagttgatccaccggaggcggcagctcttgccgc 216

               
Query: 641 agcg 644
           ||||
Sbjct: 215 agcg 212



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 461 ccagacgttcttgatctcgttgtccgtcc 489
           ||||| |||||||||||||||||||||||
Sbjct: 394 ccagaagttcttgatctcgttgtccgtcc 366



to top

>emb|AM156908.1| Zea mays mRNA for transcription factor MYB42 (myb42 gene)
          Length = 1129

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 152/187 (81%), Gaps = 1/187 (0%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           ||||||||||||||||||||||| ||| || ||||  ||||| |||   |||||  ||||
Sbjct: 420 gttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgaccacttgtt 361

                                                                       
Query: 527 gccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcg 586
            ||||| | |  ||| |||| || ||||  | | ||||| |||  |||||||||||| ||
Sbjct: 360 cccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaagttgcctcg 301

                                                                       
Query: 587 cttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           ||||| ||| ||||| | ||||||||||||| || ||||| |||||||||||||||||||
Sbjct: 300 cttgaggtccgggcgga-ggtagttgatccagcgcaggcggcagctcttgccgcagcgca 242

                  
Query: 647 gcangcc 653
           ||| |||
Sbjct: 241 gcaggcc 235



to top

>ref|XM_467636.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1031

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 79/91 (86%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||| 
Sbjct: 428 cttcttgatgtgggtgttccagtggttcttgatctcgttgtccgtcctcccggggagccg 369

                                          
Query: 503 ggcggcaatggtggaccatctgttgccgagc 533
            || |||||  ||||||||||||||||||||
Sbjct: 368 tgccgcaatcttggaccatctgttgccgagc 338



to top

>ref|NM_197015.1| Oryza sativa (japonica cultivar-group) putative myb factor
           (OSJNBa0055P24.4), mRNA
          Length = 831

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 199/250 (79%), Gaps = 1/250 (0%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||||||||| |||||||| |||||||||||||||||||| || |  || || | |  
Sbjct: 342 cttcttgaggtgagtgtgccacacgttcttgatctcgttgtcagtgcgacccggcatctg 283

                                                                       
Query: 503 ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
           |||||| ||||  ||||| |||||||||||   |  ||||||  ||| ||||  | ||||
Sbjct: 282 ggcggcgatggctgaccacctgttgccgagggagttgtggaggcggacgatgaggtcctc 223

                                                                       
Query: 563 ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
           ||| |||  ||||||||| || ||||||||||| || ||  ||||||||||||||||| |
Sbjct: 222 ctcgtcggcggtgaagttcccccgcttgatgtccggccg-gaggtagttgatccaccgca 164

                                                                       
Query: 623 ggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagttgc 682
           | |  |||||||| |||||||| || |  ||||| || || || ||||| ||||||||| 
Sbjct: 163 gcctgcagctcttcccgcagcggagaagcccggcttgcttggggagcgcgcgccagttgg 104

                     
Query: 683 tgtggccgtg 692
            |||||||||
Sbjct: 103 ggtggccgtg 94



to top

>emb|Y11350.1|OSMYB1084 O.sativa mRNA for myb factor, 1084 bp
          Length = 1084

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 199/250 (79%), Gaps = 1/250 (0%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||||||||| |||||||| |||||||||||||||||||| || |  || || | |  
Sbjct: 468 cttcttgaggtgagtgtgccacacgttcttgatctcgttgtcagtgcgacccggcatctg 409

                                                                       
Query: 503 ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
           |||||| ||||  ||||| |||||||||||   |  ||||||  ||| ||||  | ||||
Sbjct: 408 ggcggcgatggctgaccacctgttgccgagggagttgtggaggcggacgatgaggtcctc 349

                                                                       
Query: 563 ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
           ||| |||  ||||||||| || ||||||||||| || ||  ||||||||||||||||| |
Sbjct: 348 ctcgtcggcggtgaagttcccccgcttgatgtccggccg-gaggtagttgatccaccgca 290

                                                                       
Query: 623 ggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagttgc 682
           | |  |||||||| |||||||| || |  ||||| || || || ||||| ||||||||| 
Sbjct: 289 gcctgcagctcttcccgcagcggagaagcccggcttgcttggggagcgcgcgccagttgg 230

                     
Query: 683 tgtggccgtg 692
            |||||||||
Sbjct: 229 ggtggccgtg 220



to top

>dbj|AK109011.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-H11, full
           insert sequence
          Length = 1326

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 199/250 (79%), Gaps = 1/250 (0%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||||||||| |||||||| |||||||||||||||||||| || |  || || | |  
Sbjct: 594 cttcttgaggtgagtgtgccacacgttcttgatctcgttgtcagtgcgacccggcatctg 535

                                                                       
Query: 503 ggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctc 562
           |||||| ||||  ||||| |||||||||||   |  ||||||  ||| ||||  | ||||
Sbjct: 534 ggcggcgatggctgaccacctgttgccgagggagttgtggaggcggacgatgaggtcctc 475

                                                                       
Query: 563 ctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgga 622
           ||| |||  ||||||||| || ||||||||||| || ||  ||||||||||||||||| |
Sbjct: 474 ctcgtcggcggtgaagttcccccgcttgatgtccggccg-gaggtagttgatccaccgca 416

                                                                       
Query: 623 ggcgacagctcttgccgcagcgcagcangccggcctgattcggcagcgcccgccagttgc 682
           | |  |||||||| |||||||| || |  ||||| || || || ||||| ||||||||| 
Sbjct: 415 gcctgcagctcttcccgcagcggagaagcccggcttgcttggggagcgcgcgccagttgg 356

                     
Query: 683 tgtggccgtg 692
            |||||||||
Sbjct: 355 ggtggccgtg 346



to top

>dbj|AK108709.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-150-A10, full
           insert sequence
          Length = 1031

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 79/91 (86%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||| 
Sbjct: 428 cttcttgatgtgggtgttccagtggttcttgatctcgttgtccgtcctcccggggagccg 369

                                          
Query: 503 ggcggcaatggtggaccatctgttgccgagc 533
            || |||||  ||||||||||||||||||||
Sbjct: 368 tgccgcaatcttggaccatctgttgccgagc 338



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 75/85 (88%), Gaps = 1/85 (1%)
 Strand = Plus / Plus

                                                                            
Query: 572      ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
                |||||||||||||||||||| ||| || || | |||||||||||||||||||||| ||||
Sbjct: 20889038 ggtgaagttgccgcgcttgaggtcaggccgga-ggtagttgatccaccggaggcggcagc 20889096

                                         
Query: 632      tcttgccgcagcgcagcangccggc 656
                ||||||| ||||| || | ||||||
Sbjct: 20889097 tcttgccacagcggaggaggccggc 20889121



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 62/69 (89%), Gaps = 1/69 (1%)
 Strand = Plus / Plus

                                                                            
Query: 581      gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
                ||||||||||| ||||||||| | |||||||  ||||||||||||| |||||||||||||
Sbjct: 20618026 gccgcgcttgaggtcggggcgga-ggtagtttgtccaccggaggcggcagctcttgccgc 20618084

                         
Query: 641      agcgcagca 649
                |||| ||||
Sbjct: 20618085 agcggagca 20618093



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 70/82 (85%)
 Strand = Plus / Plus

                                                                            
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
                |||||||| ||| |||| ||||  |||||||||||||||||||||||| || || ||| |
Sbjct: 20614959 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcctgcccggtagctt 20615018

                                      
Query: 503      ggcggcaatggtggaccatctg 524
                ||| |||||  |||||||||||
Sbjct: 20615019 ggcagcaatcttggaccatctg 20615040



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                                 
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctc 491
                |||||||||||| |||| ||||  ||||||||| |||||||||||||||
Sbjct: 14721309 cttcttgaggtgcgtgttccagtagttcttgatgtcgttgtccgtcctc 14721261



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                                
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcct 490
                |||||||| ||| |||| ||||  ||||||||||||||||||||||||
Sbjct: 13975440 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcct 13975393



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 467      gttcttgatctcgttgtccgtcctccc 493
                ||||||||| |||||||||||||||||
Sbjct: 15717645 gttcttgatgtcgttgtccgtcctccc 15717671



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgca 641
                |||||||||| |||||| || || ||||||||||||||
Sbjct: 15717890 aggtagttgagccaccgcagccggcagctcttgccgca 15717927



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 467      gttcttgatctcgttgtccgt 487
                |||||||||||||||||||||
Sbjct: 20888776 gttcttgatctcgttgtccgt 20888796



to top

>dbj|AP006174.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0229B10
          Length = 114509

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 75/85 (88%), Gaps = 1/85 (1%)
 Strand = Plus / Plus

                                                                         
Query: 572   ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
             |||||||||||||||||||| ||| || || | |||||||||||||||||||||| ||||
Sbjct: 81264 ggtgaagttgccgcgcttgaggtcaggccgga-ggtagttgatccaccggaggcggcagc 81322

                                      
Query: 632   tcttgccgcagcgcagcangccggc 656
             ||||||| ||||| || | ||||||
Sbjct: 81323 tcttgccacagcggaggaggccggc 81347



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 467   gttcttgatctcgttgtccgt 487
             |||||||||||||||||||||
Sbjct: 81002 gttcttgatctcgttgtccgt 81022



to top

>dbj|AK111966.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-H01, full
           insert sequence
          Length = 1052

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 75/85 (88%), Gaps = 1/85 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||| ||| || || | |||||||||||||||||||||| ||||
Sbjct: 308 ggtgaagttgccgcgcttgaggtcaggccgga-ggtagttgatccaccggaggcggcagc 250

                                    
Query: 632 tcttgccgcagcgcagcangccggc 656
           ||||||| ||||| || | ||||||
Sbjct: 249 tcttgccacagcggaggaggccggc 225



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 467 gttcttgatctcgttgtccgt 487
           |||||||||||||||||||||
Sbjct: 413 gttcttgatctcgttgtccgt 393



to top

>dbj|AK104457.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-B02, full
           insert sequence
          Length = 1048

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 75/85 (88%), Gaps = 1/85 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||| ||| || || | |||||||||||||||||||||| ||||
Sbjct: 306 ggtgaagttgccgcgcttgaggtcaggccgga-ggtagttgatccaccggaggcggcagc 248

                                    
Query: 632 tcttgccgcagcgcagcangccggc 656
           ||||||| ||||| || | ||||||
Sbjct: 247 tcttgccacagcggaggaggccggc 223



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 467 gttcttgatctcgttgtccgt 487
           |||||||||||||||||||||
Sbjct: 411 gttcttgatctcgttgtccgt 391



to top

>dbj|AK104408.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E04, full
           insert sequence
          Length = 1054

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 75/85 (88%), Gaps = 1/85 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||| ||| || || | |||||||||||||||||||||| ||||
Sbjct: 306 ggtgaagttgccgcgcttgaggtcaggccgga-ggtagttgatccaccggaggcggcagc 248

                                    
Query: 632 tcttgccgcagcgcagcangccggc 656
           ||||||| ||||| || | ||||||
Sbjct: 247 tcttgccacagcggaggaggccggc 223



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 467 gttcttgatctcgttgtccgt 487
           |||||||||||||||||||||
Sbjct: 411 gttcttgatctcgttgtccgt 391



to top

>ref|XM_462805.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 783

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 60/65 (92%), Gaps = 1/65 (1%)
 Strand = Plus / Minus

                                                                       
Query: 581 gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
           ||||||||||| ||||||||| | ||||||| |||||||||||||| |||||||||||||
Sbjct: 228 gccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgc 170

                
Query: 641 agcgc 645
           |||||
Sbjct: 169 agcgc 165



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 461 ccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           ||||| |||||||||||||||||||| |||||| || |||||
Sbjct: 348 ccagaagttcttgatctcgttgtccgacctccccggcagcct 307



to top

>ref|XM_483052.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1074

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
           |||||||||||||| |||| ||||| |||||||||||||||||||||||||||
Sbjct: 344 cgcttcttgaggtgcgtgttccagaagttcttgatctcgttgtccgtcctccc 292



to top

>gb|AY459343.1| Oryza sativa (japonica cultivar-group) clone CL018501.1 R2R3-MYB gene
            region
          Length = 18906

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 60/65 (92%), Gaps = 1/65 (1%)
 Strand = Plus / Plus

                                                                        
Query: 581  gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
            ||||||||||| ||||||||| | ||||||| |||||||||||||| |||||||||||||
Sbjct: 6018 gccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgc 6076

                 
Query: 641  agcgc 645
            |||||
Sbjct: 6077 agcgc 6081



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 461  ccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
            ||||| |||||||||||||||||||| |||||| || |||||
Sbjct: 5790 ccagaagttcttgatctcgttgtccgacctccccggcagcct 5831



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 467   gttcttgatctcgttgtccgtcct 490
             ||||||||||||||||||||||||
Sbjct: 17854 gttcttgatctcgttgtccgtcct 17831



to top

>gb|AF474139.1| Oryza sativa typical P-type R2R3 Myb protein gene, partial cds
          Length = 1034

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 60/65 (92%), Gaps = 1/65 (1%)
 Strand = Plus / Minus

                                                                       
Query: 581 gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
           ||||||||||| ||||||||| | ||||||| |||||||||||||| |||||||||||||
Sbjct: 510 gccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgc 452

                
Query: 641 agcgc 645
           |||||
Sbjct: 451 agcgc 447



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 461 ccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           ||||| |||||||||||||||||||| |||||| || |||||
Sbjct: 738 ccagaagttcttgatctcgttgtccgacctccccggcagcct 697



to top

>dbj|AP004376.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0481F05
          Length = 139739

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                  
Query: 441   cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
             |||||||||||||| |||| ||||| |||||||||||||||||||||||||||
Sbjct: 72596 cgcttcttgaggtgcgtgttccagaagttcttgatctcgttgtccgtcctccc 72648



to top

>dbj|AP003339.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OJ1276_B06
          Length = 175174

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 60/65 (92%), Gaps = 1/65 (1%)
 Strand = Plus / Minus

                                                                          
Query: 581    gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
              ||||||||||| ||||||||| | ||||||| |||||||||||||| |||||||||||||
Sbjct: 100154 gccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgc 100096

                   
Query: 641    agcgc 645
              |||||
Sbjct: 100095 agcgc 100091



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 461    ccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
              ||||| |||||||||||||||||||| |||||| || |||||
Sbjct: 100382 ccagaagttcttgatctcgttgtccgacctccccggcagcct 100341



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 467   gttcttgatctcgttgtccgtcct 490
             ||||||||||||||||||||||||
Sbjct: 88320 gttcttgatctcgttgtccgtcct 88343



to top

>dbj|AP002912.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0028E10
          Length = 140791

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 60/65 (92%), Gaps = 1/65 (1%)
 Strand = Plus / Minus

                                                                          
Query: 581    gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
              ||||||||||| ||||||||| | ||||||| |||||||||||||| |||||||||||||
Sbjct: 118846 gccgcgcttgaggtcggggcgga-ggtagttcatccaccggaggcggcagctcttgccgc 118788

                   
Query: 641    agcgc 645
              |||||
Sbjct: 118787 agcgc 118783



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 461    ccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
              ||||| |||||||||||||||||||| |||||| || |||||
Sbjct: 119074 ccagaagttcttgatctcgttgtccgacctccccggcagcct 119033



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 467    gttcttgatctcgttgtccgtcct 490
              ||||||||||||||||||||||||
Sbjct: 107012 gttcttgatctcgttgtccgtcct 107035



to top

>gb|AF474119.1| Zea mays typical P-type R2R3 Myb protein (Myb26) gene, partial cds
          Length = 605

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 91/107 (85%), Gaps = 1/107 (0%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||| | |||||| || | |||||||||||||||| || || ||||
Sbjct: 251 ggtgaagttgccgcgcttcaggtcgggccgga-ggtagttgatccaccgcagccggcagc 193

                                                          
Query: 632 tcttgccgcagcgcagcangccggcctgattcggcagcgcccgccag 678
           |||||||||| ||||||| ||| |||   || ||||||| |||||||
Sbjct: 192 tcttgccgcaccgcagcaggcccgccgccttgggcagcgaccgccag 146



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 467 gttcttgatctcgttgtccgtcc 489
           |||||||||||||||||||||||
Sbjct: 537 gttcttgatctcgttgtccgtcc 515



to top

>dbj|AB252145.1| Triticum aestivum Tamyb2 mRNA for myb-related protein, complete cds
          Length = 1010

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 59/64 (92%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                       
Query: 581 gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
           |||||||||||  |||||||| | |||||||||||||||||||||| |||||||||||||
Sbjct: 314 gccgcgcttgagatcggggcgga-ggtagttgatccaccggaggcggcagctcttgccgc 256

               
Query: 641 agcg 644
           ||||
Sbjct: 255 agcg 252



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 461 ccagacgttcttgatctcgttgtccgtcc 489
           ||||| |||||||||||||||||||||||
Sbjct: 434 ccagaagttcttgatctcgttgtccgtcc 406



to top

>emb|X78846.1|ZM38G1 Z.Mays Zm38 gene, intron 1
          Length = 3045

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/82 (87%), Gaps = 1/82 (1%)
 Strand = Plus / Minus

                                                                        
Query: 572  ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
            |||||||||||||||||| | |||||| || | |||||||||||||||| || || ||||
Sbjct: 2102 ggtgaagttgccgcgcttcaggtcgggccgga-ggtagttgatccaccgcagccggcagc 2044

                                  
Query: 632  tcttgccgcagcgcagcangcc 653
            |||||||||| ||||||| |||
Sbjct: 2043 tcttgccgcaccgcagcaggcc 2022



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 467  gttcttgatctcgttgtccgtcc 489
            |||||||||||||||||||||||
Sbjct: 2373 gttcttgatctcgttgtccgtcc 2351



to top

>dbj|AK107483.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-129-C06, full
           insert sequence
          Length = 1163

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
           |||||||| |||||||| ||||  ||||||||||||||||||||||||||| || |||| 
Sbjct: 520 cttcttgatgtgtgtgttccagtggttcttgatctcgttgtccgtcctcccggggagccg 461

                                          
Query: 503 ggcggcaatggtggaccatctgttgccgagc 533
            || || ||  ||||||| ||||||||||||
Sbjct: 460 cgccgcgatcttggaccacctgttgccgagc 430



to top

>emb|AJ601382.1| Festuca arundinacea partial mRNA for putative R2R3 MYB
           transcription factor (myb1 gene)
          Length = 170

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 109/130 (83%), Gaps = 7/130 (5%)
 Strand = Plus / Minus

                                                                       
Query: 515 ggaccatctgttgccgagcatggcgtggagctggatgatgg---cgccctcctcctcgct 571
           ||||||| |||||||||| | |  |||||||| |||||||    || |||||||||||||
Sbjct: 126 ggaccatttgttgccgaggaggctgtggagcttgatgatgagctcgtcctcctcctcgct 67

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |   |||||||||||||||| |||||| ||| |||||||||||||||||||| || ||||
Sbjct: 66  g---aagttgccgcgcttgaggtcgggccgc-aggtagttgatccaccggagacggcagc 11

                     
Query: 632 tcttgccgca 641
           | || |||||
Sbjct: 10  tttttccgca 1



to top

>gb|AY365034.1| Zea mays MYB-like protein 2 mRNA, complete cds
          Length = 1164

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           |||||||||||||||||| ||||| || || ||| |||| |||||  | |||||||||||
Sbjct: 502 gttcttgatctcgttgtcagtcctgcccggtagcttggcagcaatcttcgaccatctgtt 443

                             
Query: 527 gccgagcatggcgtggag 544
           ||||||| ||||||||||
Sbjct: 442 gccgagcttggcgtggag 425



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 66/75 (88%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                       
Query: 582 ccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
           |||||||||| ||| ||||| | |||||||| |||| || ||||| ||||||||||||||
Sbjct: 387 ccgcgcttgaggtccgggcgga-ggtagttggtccagcgcaggcggcagctcttgccgca 329

                          
Query: 642 gcgcagcangccggc 656
           |||||||| ||||||
Sbjct: 328 gcgcagcaggccggc 314



to top

>gb|AY365033.1| Zea mays MYB-like protein 1 mRNA, complete cds
          Length = 1417

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           |||||||||||||||||| ||||| || || ||| |||| |||||  | |||||||||||
Sbjct: 502 gttcttgatctcgttgtcagtcctgcccggtagcttggcagcaatcttcgaccatctgtt 443

                             
Query: 527 gccgagcatggcgtggag 544
           ||||||| ||||||||||
Sbjct: 442 gccgagcttggcgtggag 425



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 66/75 (88%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                       
Query: 582 ccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
           |||||||||| ||| ||||| | |||||||| |||| || ||||| ||||||||||||||
Sbjct: 387 ccgcgcttgaggtccgggcgga-ggtagttggtccagcgcaggcggcagctcttgccgca 329

                          
Query: 642 gcgcagcangccggc 656
           |||||||| ||||||
Sbjct: 328 gcgcagcaggccggc 314



to top

>gb|AY111641.1| Zea mays CL1341_1 mRNA sequence
          Length = 608

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           |||||||||||||||||| ||||| || || ||| |||| |||||  | |||||||||||
Sbjct: 507 gttcttgatctcgttgtcagtcctgcccggtagcttggcagcaatcttcgaccatctgtt 448

                             
Query: 527 gccgagcatggcgtggag 544
           ||||||| ||||||||||
Sbjct: 447 gccgagcttggcgtggag 430



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 66/75 (88%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                       
Query: 582 ccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
           |||||||||| ||| ||||| | |||||||| |||| || ||||| ||||||||||||||
Sbjct: 392 ccgcgcttgaggtccgggcgga-ggtagttggtccagcgcaggcggcagctcttgccgca 334

                          
Query: 642 gcgcagcangccggc 656
           |||||||| ||||||
Sbjct: 333 gcgcagcaggccggc 319



to top

>gb|AY108777.1| Zea mays PCO139596 mRNA sequence
          Length = 496

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 41/42 (97%)
 Strand = Plus / Minus

                                                     
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcgc 645
           ||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 224 aggtagttgatccaccggaggcggcagctcttgccgcagcgc 183



to top

>gb|AY672068.1| Hordeum vulgare subsp. vulgare myb transcription factor mRNA,
           complete cds
          Length = 1542

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 146/181 (80%), Gaps = 1/181 (0%)
 Strand = Plus / Minus

                                                                       
Query: 461 ccagacgttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggacca 520
           ||||| |||||||||||||||||| || | ||| || | |||||| || ||    |||||
Sbjct: 469 ccagaagttcttgatctcgttgtcggtgcgccccggtaacctggctgcgatctgagacca 410

                                                                       
Query: 521 tctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagtt 580
           |||||||||||| ||||||||||| | || ||||  | ||||||| |     | ||||  
Sbjct: 409 tctgttgccgaggatggcgtggaggttgacgatgaggtcctcctcatgtggcgagaaggc 350

                                                                       
Query: 581 gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
           ||||||||||| ||| || || | |||||||||||||||||||||| |||||||||||||
Sbjct: 349 gccgcgcttgaggtccggacgga-ggtagttgatccaccggaggcggcagctcttgccgc 291

            
Query: 641 a 641
           |
Sbjct: 290 a 290



to top

>gb|AF470076.1| Zea mays P-type R2R3 Myb protein (Myb9) gene, partial cds
          Length = 2194

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 103/121 (85%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                        
Query: 522  ctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctgg-tgaagtt 580
            |||||||||||||  |||||||||||||||||||    |||||||| || || |||| ||
Sbjct: 1516 ctgttgccgagcagagcgtggagctggatgatggtctgctcctcct-gcaggctgaactt 1458

                                                                        
Query: 581  gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
            ||| ||||||||||| || || | |||||||  ||||||||||||| |||||||||||||
Sbjct: 1457 gccccgcttgatgtccggccgga-ggtagttcgtccaccggaggcggcagctcttgccgc 1399

             
Query: 641  a 641
            |
Sbjct: 1398 a 1398



to top

>gb|AF470071.1| Sorghum bicolor P-type R2R3 Myb protein (Myb68) gene, partial cds
          Length = 1953

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 103/121 (85%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                        
Query: 522  ctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctgg-tgaagtt 580
            |||||||||||||  |||||||||||||||||||    |||||||| || || |||| ||
Sbjct: 1690 ctgttgccgagcagcgcgtggagctggatgatggtctgctcctcct-gcaggctgaactt 1632

                                                                        
Query: 581  gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
            ||| ||||||||||| || || | |||||||  ||||||||||||| |||||||||||||
Sbjct: 1631 gccccgcttgatgtccggccgga-ggtagttcgtccaccggaggcggcagctcttgccgc 1573

             
Query: 641  a 641
            |
Sbjct: 1572 a 1572



to top

>emb|AJ576024.1|EGU576024 Eucalyptus gunnii mRNA for MYB transcription factor (myb1 gene)
          Length = 955

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 65/73 (89%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||| ||||||| ||| || |||| |||| ||||||||||||||||| ||||
Sbjct: 302 ggtgaagttgccccgcttgaggtccggccgca-ggtaattgatccaccggaggcggcagc 244

                        
Query: 632 tcttgccgcagcg 644
           ||||||| |||||
Sbjct: 243 tcttgccacagcg 231



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 467 gttcttgatctcgttgtccgtcctccc 493
           ||||||||||||||||||||| |||||
Sbjct: 407 gttcttgatctcgttgtccgttctccc 381



to top

>gb|AF514783.1| Lolium perenne R2R3 MYB protein (Myb2) gene, partial cds
          Length = 264

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 86/101 (85%), Gaps = 1/101 (0%)
 Strand = Plus / Minus

                                                                       
Query: 523 tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
           |||||||||| | |||||||||  ||||||||    | ||||| |||| |||||||||||
Sbjct: 100 tgttgccgaggagggcgtggaggcggatgatgagctcgtcctcgtcgccggtgaagttgc 41

                                                    
Query: 583 cgcgcttgatgtcggggcgcaaggtagttgatccaccggag 623
           ||||||||| |||||||||  |||||||||||||| |||||
Sbjct: 40  cgcgcttgaggtcggggcg-gaggtagttgatccagcggag 1



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 467 gttcttgatctcgttgtccgtcct 490
           ||||||||||||||||||||||||
Sbjct: 251 gttcttgatctcgttgtccgtcct 228



to top

>dbj|AP005092.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1112_E07
          Length = 132055

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 62/69 (89%), Gaps = 1/69 (1%)
 Strand = Plus / Plus

                                                                         
Query: 581   gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
             ||||||||||| ||||||||| | |||||||  ||||||||||||| |||||||||||||
Sbjct: 11637 gccgcgcttgaggtcggggcgga-ggtagtttgtccaccggaggcggcagctcttgccgc 11695

                      
Query: 641   agcgcagca 649
             |||| ||||
Sbjct: 11696 agcggagca 11704



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 70/82 (85%)
 Strand = Plus / Plus

                                                                        
Query: 443  cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
            |||||||| ||| |||| ||||  |||||||||||||||||||||||| || || ||| |
Sbjct: 8570 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcctgcccggtagctt 8629

                                  
Query: 503  ggcggcaatggtggaccatctg 524
            ||| |||||  |||||||||||
Sbjct: 8630 ggcagcaatcttggaccatctg 8651



to top

>dbj|AP005314.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0515E01
          Length = 140063

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 62/69 (89%), Gaps = 1/69 (1%)
 Strand = Plus / Plus

                                                                         
Query: 581   gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
             ||||||||||| ||||||||| | |||||||  ||||||||||||| |||||||||||||
Sbjct: 83684 gccgcgcttgaggtcggggcgga-ggtagtttgtccaccggaggcggcagctcttgccgc 83742

                      
Query: 641   agcgcagca 649
             |||| ||||
Sbjct: 83743 agcggagca 83751



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 70/82 (85%)
 Strand = Plus / Plus

                                                                         
Query: 443   cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
             |||||||| ||| |||| ||||  |||||||||||||||||||||||| || || ||| |
Sbjct: 80617 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcctgcccggtagctt 80676

                                   
Query: 503   ggcggcaatggtggaccatctg 524
             ||| |||||  |||||||||||
Sbjct: 80677 ggcagcaatcttggaccatctg 80698



to top

>gb|AF099369.1|AF099369 Zea mays clone ZmMYB1H32 R2R3MYB-domain protein mRNA, partial cds
          Length = 129

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 67/76 (88%), Gaps = 1/76 (1%)
 Strand = Plus / Minus

                                                                       
Query: 539 gtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgtcggg 598
           |||||||| ||||||| || | ||||||||   |||||||||||||||||||| ||||||
Sbjct: 75  gtggagcttgatgatgacgtcgtcctcctcctgggtgaagttgccgcgcttgaggtcggg 16

                           
Query: 599 gcgcaaggtagttgat 614
           |||| |||||||||||
Sbjct: 15  gcgc-aggtagttgat 1



to top

>ref|NM_187376.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1203

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 60/67 (89%), Gaps = 1/67 (1%)
 Strand = Plus / Minus

                                                                       
Query: 575 gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
           |||| |||||||||||| |||||| || | ||||||||||||||||||| || |||||||
Sbjct: 207 gaaggtgccgcgcttgaggtcgggccgga-ggtagttgatccaccggagccggcagctct 149

                  
Query: 635 tgccgca 641
           |||||||
Sbjct: 148 tgccgca 142



to top

>gb|AF470072.1| Zea mays A-type R2R3 Myb protein (Myb5) gene, partial cds
          Length = 1213

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 96/115 (83%), Gaps = 1/115 (0%)
 Strand = Plus / Minus

                                                                       
Query: 535 tggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgt 594
           |||||||||||| ||||||| || |||| |||||  ||| || ||| || | ||||| ||
Sbjct: 946 tggcgtggagcttgatgatgacgtcctcttcctccttggagatgttccccctcttgacgt 887

                                                                  
Query: 595 cggggcgcaaggtagttgatccaccggaggcgacagctcttgccgcagcgcagca 649
           |||  || |||||||||||||||||| || || ||||||||||||||||| ||||
Sbjct: 886 cggcccg-aaggtagttgatccaccgcagacggcagctcttgccgcagcggagca 833



to top

>gb|AF470068.1| Sorghum bicolor P-type R2R3 Myb protein (Myb41) gene, partial cds
          Length = 358

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           ||||||||||||||||||||||| |||||||||| ||||||||
Sbjct: 351 aggtagttgatccaccggaggcggcagctcttgctgcagcgca 309



to top

>gb|AF474125.1| Sorghum bicolor typical A-type R2R3 Myb protein (MybY1) gene,
           partial cds
          Length = 318

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 105/127 (82%), Gaps = 1/127 (0%)
 Strand = Plus / Minus

                                                                       
Query: 515 ggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggt 574
           |||||| |||||||||||  |||||||||||| |||||||  | |||| |||||  ||| 
Sbjct: 240 ggaccacctgttgccgagggtggcgtggagcttgatgatgatgtcctcttcctccttgga 181

                                                                       
Query: 575 gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
           || ||| || | ||||| |||||  || |||||||||||||||||| || || |||||||
Sbjct: 180 gatgttccctctcttgacgtcggcccg-aaggtagttgatccaccgcagccggcagctct 122

                  
Query: 635 tgccgca 641
           |||||||
Sbjct: 121 tgccgca 115



to top

>gb|AY363141.1| Sorghum bicolor P-type R2R3 Myb protein (Myb48) gene, partial cds
          Length = 93

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangcc 653
           |||||||||||||| || ||||| |||||||||||||||||||||| |||
Sbjct: 86  aggtagttgatccagcgcaggcggcagctcttgccgcagcgcagcaggcc 37



to top

>gb|AY363140.1| Sorghum bicolor P-type R2R3 Myb protein (Myb47) gene, partial cds
          Length = 111

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangcc 653
           |||||||||||||| || ||||| |||||||||||||||||||||| |||
Sbjct: 104 aggtagttgatccagcgcaggcggcagctcttgccgcagcgcagcaggcc 55



to top

>gb|AY363139.1| Sorghum bicolor P-type R2R3 Myb protein (Myb43) gene, partial cds
          Length = 105

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           ||||||||||||||||||||||| |||||||||| ||||||||
Sbjct: 98  aggtagttgatccaccggaggcggcagctcttgctgcagcgca 56



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 60/67 (89%), Gaps = 1/67 (1%)
 Strand = Plus / Plus

                                                                            
Query: 575      gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
                |||| |||||||||||| |||||| || | ||||||||||||||||||| || |||||||
Sbjct: 18606406 gaaggtgccgcgcttgaggtcgggccgga-ggtagttgatccaccggagccggcagctct 18606464

                       
Query: 635      tgccgca 641
                |||||||
Sbjct: 18606465 tgccgca 18606471



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                               
Query: 523      tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcg 569
                |||||||||| |||  ||||||||||||||||||  |||||||||||
Sbjct: 22241239 tgttgccgaggatgctgtggagctggatgatggcctcctcctcctcg 22241285



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                           
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
                ||||||||| |||||||||| | ||||||||||| ||| ||||
Sbjct: 26023177 aggtagttggtccaccggagcctacagctcttgctgcaccgca 26023219



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 467      gttcttgatctcgttgtccgtcc 489
                |||||||||||||||||||||||
Sbjct: 22241055 gttcttgatctcgttgtccgtcc 22241077



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                          
Query: 446      cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgt 487
                ||||||||| |||| ||||  ||||||||| |||||||||||
Sbjct: 26023020 cttgaggtgggtgttccagtagttcttgatgtcgttgtccgt 26023061



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 461      ccagacgttcttgatctcgttgtccgtcc 489
                ||||| |||||||| ||||||||||||||
Sbjct: 26303188 ccagaagttcttgacctcgttgtccgtcc 26303160



to top

>gb|AF210619.1|AF210619S1 Zea mays subsp. parviglumis P-like protein (P-like) gene, exons 1
           and 2
          Length = 1092

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 90/107 (84%), Gaps = 1/107 (0%)
 Strand = Plus / Minus

                                                                       
Query: 535 tggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgccgcgcttgatgt 594
           |||||||||||| ||||||| || |||| |||||  ||| || ||| || | ||||| ||
Sbjct: 970 tggcgtggagcttgatgatgacgtcctcttcctccttggagatgttccccctcttgacgt 911

                                                          
Query: 595 cggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
           |||  || |||||||||||||||||| ||||| ||||||||||||||
Sbjct: 910 cggcccg-aaggtagttgatccaccgcaggcggcagctcttgccgca 865



to top

>dbj|AP004006.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1197_D06
          Length = 103844

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 60/67 (89%), Gaps = 1/67 (1%)
 Strand = Plus / Plus

                                                                         
Query: 575   gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
             |||| |||||||||||| |||||| || | ||||||||||||||||||| || |||||||
Sbjct: 31460 gaaggtgccgcgcttgaggtcgggccgga-ggtagttgatccaccggagccggcagctct 31518

                    
Query: 635   tgccgca 641
             |||||||
Sbjct: 31519 tgccgca 31525



to top

>dbj|AP004259.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0005E02
          Length = 89380

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 60/67 (89%), Gaps = 1/67 (1%)
 Strand = Plus / Plus

                                                                         
Query: 575   gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
             |||| |||||||||||| |||||| || | ||||||||||||||||||| || |||||||
Sbjct: 58948 gaaggtgccgcgcttgaggtcgggccgga-ggtagttgatccaccggagccggcagctct 59006

                    
Query: 635   tgccgca 641
             |||||||
Sbjct: 59007 tgccgca 59013



to top

>dbj|AP005619.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0624H09
          Length = 158719

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                                 
Query: 443    cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
              |||||||| |||||||| ||||  |||||||||||||||||||||||||||
Sbjct: 154927 cttcttgatgtgtgtgttccagtggttcttgatctcgttgtccgtcctccc 154877



to top

>dbj|AP005527.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0603C10
          Length = 187620

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                                
Query: 443   cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
             |||||||| |||||||| ||||  |||||||||||||||||||||||||||
Sbjct: 56069 cttcttgatgtgtgtgttccagtggttcttgatctcgttgtccgtcctccc 56019



to top

>dbj|AP005319.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0643A10
          Length = 187931

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                         
Query: 443   cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
             |||||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||| 
Sbjct: 70957 cttcttgatgtgggtgttccagtggttcttgatctcgttgtccgtcctcccggggagccg 71016

                                    
Query: 503   ggcggcaatggtggaccatctgt 525
              || |||||  ||||||||||||
Sbjct: 71017 tgccgcaatcttggaccatctgt 71039



to top

>emb|X78845.1|ZM1G12 Z.Mays Zm1 gene, introns 1 and 2
          Length = 3270

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                               
Query: 443  cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
            |||||| ||||| |||| ||| |||||||||||||||||||||||||||||
Sbjct: 1517 cttcttcaggtgcgtgttccacacgttcttgatctcgttgtccgtcctccc 1467



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 76/89 (85%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                        
Query: 559  cctcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccac 618
            |||||||||||  |||||||||||||||||||| ||| || ||| |||||||||||||| 
Sbjct: 1282 cctcctcctcgtcggtgaagttgccgcgcttgaggtccggccgc-aggtagttgatccag 1224

                                         
Query: 619  cggaggcgacagctcttgccgcagcgcag 647
            || || |  |||||||| || ||||||||
Sbjct: 1223 cgcagcctgcagctcttcccacagcgcag 1195



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 664  ggcagcgcccgccagttgctgtggccgtgct 694
            |||||||| ||||||||| ||||||||||||
Sbjct: 1061 ggcagcgcgcgccagttggtgtggccgtgct 1031



to top

>ref|XM_482497.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 930

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccagg 496
           |||||||| ||| |||| ||||  ||||||||||||||||||||||||||||||
Sbjct: 342 cttcttgatgtgagtgttccagtggttcttgatctcgttgtccgtcctcccagg 289



to top

>ref|NM_189302.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 954

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangccggc 656
           ||||||||||||||||| || |  |||||||||||||||||||||| ||||||
Sbjct: 182 aggtagttgatccaccgaagcctgcagctcttgccgcagcgcagcaggccggc 130



to top

>gb|AF470063.1| Sorghum bicolor P-type R2R3 Myb protein (Myb5) gene, partial cds
          Length = 1117

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgca 641
           ||||||||||||||||||||||| ||||||||||||||
Sbjct: 593 aggtagttgatccaccggaggcggcagctcttgccgca 556



to top

>gb|BT009312.1| Triticum aestivum clone wlm1.pk0027.a5:fis, full insert mRNA
           sequence
          Length = 1336

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 59/66 (89%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||||  | |||||| ||||||||| |||||||||| || ||||
Sbjct: 238 ggtgaagttgccgcgcttgatccctgggcgc-aggtagttggtccaccggagccggcagc 180

                 
Query: 632 tcttgc 637
           ||||||
Sbjct: 179 tcttgc 174



to top

>emb|AJ311051.1|OSA311051 Oryza sativa mRNA for Myb51 protein (myb51 gene)
          Length = 1187

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccagg 496
           |||||||| ||| |||| ||||  ||||||||||||||||||||||||||||||
Sbjct: 501 cttcttgatgtgagtgttccagtggttcttgatctcgttgtccgtcctcccagg 448



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                          
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
                |||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 17409362 cttcttgaggtgagtgtgccacacgttcttgatctcgttgtc 17409403



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 72/86 (83%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                            
Query: 559      cctcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccac 618
                ||||||| |||  ||||||||| || ||||||||||| || || | ||||||||||||||
Sbjct: 17410748 cctcctcgtcggcggtgaagttcccccgcttgatgtccggccgga-ggtagttgatccac 17410806

                                          
Query: 619      cggaggcgacagctcttgccgcagcg 644
                || || |  |||||||| ||||||||
Sbjct: 17410807 cgcagcctgcagctcttcccgcagcg 17410832



to top

>gb|AC037425.7|AC037425 Oryza sativa chromosome 10 BAC OSJNBa0055P24 genomic sequence, complete
             sequence
          Length = 134058

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                       
Query: 443   cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
             |||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 38357 cttcttgaggtgagtgtgccacacgttcttgatctcgttgtc 38398



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 72/86 (83%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                         
Query: 559   cctcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccac 618
             ||||||| |||  ||||||||| || ||||||||||| || || | ||||||||||||||
Sbjct: 39743 cctcctcgtcggcggtgaagttcccccgcttgatgtccggccgga-ggtagttgatccac 39801

                                       
Query: 619   cggaggcgacagctcttgccgcagcg 644
             || || |  |||||||| ||||||||
Sbjct: 39802 cgcagcctgcagctcttcccgcagcg 39827



to top

>dbj|AP002873.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0552C05
          Length = 136586

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                  
Query: 604   aggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangccggc 656
             ||||||||||||||||| || |  |||||||||||||||||||||| ||||||
Sbjct: 62452 aggtagttgatccaccgaagcctgcagctcttgccgcagcgcagcaggccggc 62400



to top

>dbj|AP002871.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0475H04
          Length = 143337

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 604    aggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangccggc 656
              ||||||||||||||||| || |  |||||||||||||||||||||| ||||||
Sbjct: 136272 aggtagttgatccaccgaagcctgcagctcttgccgcagcgcagcaggccggc 136220



to top

>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0032E15
          Length = 120419

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                   
Query: 443   cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccagg 496
             |||||||| ||| |||| ||||  ||||||||||||||||||||||||||||||
Sbjct: 97927 cttcttgatgtgagtgttccagtggttcttgatctcgttgtccgtcctcccagg 97874



to top

>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1663_D06
          Length = 139103

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                   
Query: 443   cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccagg 496
             |||||||| ||| |||| ||||  ||||||||||||||||||||||||||||||
Sbjct: 68338 cttcttgatgtgagtgttccagtggttcttgatctcgttgtccgtcctcccagg 68285



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                          
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
                |||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 17418402 cttcttgaggtgagtgtgccacacgttcttgatctcgttgtc 17418443



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 72/86 (83%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                            
Query: 559      cctcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccac 618
                ||||||| |||  ||||||||| || ||||||||||| || || | ||||||||||||||
Sbjct: 17419788 cctcctcgtcggcggtgaagttcccccgcttgatgtccggccgga-ggtagttgatccac 17419846

                                          
Query: 619      cggaggcgacagctcttgccgcagcg 644
                || || |  |||||||| ||||||||
Sbjct: 17419847 cgcagcctgcagctcttcccgcagcg 17419872



to top

>ref|XM_472754.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1038

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 119/144 (82%), Gaps = 3/144 (2%)
 Strand = Plus / Minus

                                                                       
Query: 516 gaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctgg-t 574
           ||||| ||||||||||| | ||||||||||||||||||||    |||||||| || || |
Sbjct: 269 gaccacctgttgccgagaagggcgtggagctggatgatggtctgctcctcct-gcaggct 211

                                                                       
Query: 575 gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
           ||| ||||| | ||||||||| || ||  ||||||||  |||||||||| || |||||||
Sbjct: 210 gaacttgcccctcttgatgtccggccg-gaggtagttcgtccaccggagtcggcagctct 152

                                   
Query: 635 tgccgcagcgcagcangccggcct 658
           ||||||| ||| |||  |||||||
Sbjct: 151 tgccgcaccgctgcagcccggcct 128



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 441 cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgt 487
           |||||||| ||||| |||| ||||  |||||||||||||||||||||
Sbjct: 344 cgcttctttaggtgcgtgttccagtagttcttgatctcgttgtccgt 298



to top

>emb|AJ601376.1| Lolium multiflorum partial mRNA for putative R2R3 MYB transcription
           factor (myb1 gene)
          Length = 167

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 46/49 (93%), Gaps = 1/49 (2%)
 Strand = Plus / Plus

                                                            
Query: 575 gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggag 623
           |||||||||||||||||||||||||||  ||||||||| ||||||||||
Sbjct: 105 gaagttgccgcgcttgatgtcggggcg-gaggtagttggtccaccggag 152



to top

>gb|AY555190.1| Vitis vinifera Myb transcription factor (MybCs1) mRNA, complete cds
          Length = 1212

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                
Query: 613 atccaccggaggcgacagctcttgccgcagcgcagca 649
           ||||||||||||||||||||||||||||| |||||||
Sbjct: 236 atccaccggaggcgacagctcttgccgcaccgcagca 200



to top

>gb|DQ277688.1| Vitis vinifera isolate GNF24 MYB-like protein mRNA, partial cds
          Length = 292

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                
Query: 613 atccaccggaggcgacagctcttgccgcagcgcagca 649
           ||||||||||||||||||||||||||||| |||||||
Sbjct: 137 atccaccggaggcgacagctcttgccgcatcgcagca 101



to top

>gb|DQ277687.1| Vitis vinifera isolate GNF22 MYB-like protein mRNA, partial cds
          Length = 291

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                
Query: 613 atccaccggaggcgacagctcttgccgcagcgcagca 649
           ||||||||||||||||||||||||||||| |||||||
Sbjct: 136 atccaccggaggcgacagctcttgccgcatcgcagca 100



to top

>gb|DQ277673.1| Vitis vinifera isolate GNS17 MYB-like protein mRNA, partial cds
          Length = 292

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                
Query: 613 atccaccggaggcgacagctcttgccgcagcgcagca 649
           ||||||||||||||||||||||||||||| |||||||
Sbjct: 137 atccaccggaggcgacagctcttgccgcatcgcagca 101



to top

>gb|AY899404.1| Vitis vinifera MYB5b mRNA, complete cds
          Length = 1103

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcg 644
           |||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 251 aggtagttcatccagcggaggcgacagctcttgccgcagcg 211



to top

>ref|XM_473295.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 897

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                       
Query: 468 ttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgttg 527
           ||||||||||||||||||||||  ||||| |||   ||||| ||  |||||||  |||||
Sbjct: 317 ttcttgatctcgttgtccgtccgaccaggcagctgcgcggcgatcatggaccacttgttg 258

                                       
Query: 528 ccgagcatggcgtggagctggatgatgg 555
           ||||  |||||||||||||||| |||||
Sbjct: 257 ccgacgatggcgtggagctggaggatgg 230



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 52/60 (86%), Gaps = 1/60 (1%)
 Strand = Plus / Minus

                                                                       
Query: 582 ccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
           |||||||||||||| || |||| |||||||  ||||||| || || ||||||||||||||
Sbjct: 203 ccgcgcttgatgtccggccgca-ggtagttcgtccaccgcagccggcagctcttgccgca 145



to top

>gb|AF470088.1| Zea mays P-type R2R3 Myb protein (Myb41) gene, partial cds
          Length = 1913

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 54/60 (90%), Gaps = 1/60 (1%)
 Strand = Plus / Minus

                                                                        
Query: 582  ccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
            |||||||||||||| ||||||| |||||||| ||||||| || || ||||||||||||||
Sbjct: 1638 ccgcgcttgatgtccgggcgca-ggtagttggtccaccgcagccggcagctcttgccgca 1580



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 467  gttcttgatctcgttgtccgtcc 489
            |||||||||||||||||||||||
Sbjct: 1842 gttcttgatctcgttgtccgtcc 1820



to top

>gb|AF470084.1| Zea mays P-type R2R3 Myb protein (Myb34) gene, partial cds
          Length = 2440

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 442  gcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcc 489
            ||||||||||||| |||| ||||  |||||||||||||||||||||||
Sbjct: 2155 gcttcttgaggtgcgtgttccagtagttcttgatctcgttgtccgtcc 2108



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 96/119 (80%), Gaps = 1/119 (0%)
 Strand = Plus / Minus

                                                                        
Query: 523  tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
            |||||||||  |||||||||||||||| |||||    || |||||||   ||||||   |
Sbjct: 1727 tgttgccgacgatggcgtggagctggacgatggacttctgctcctcggatgtgaagggcc 1668

                                                                       
Query: 583  cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
            ||||||||||||| || ||  ||||||||  ||||||| || || ||||||||||||||
Sbjct: 1667 cgcgcttgatgtccggccg-gaggtagttcgtccaccgcagtcggcagctcttgccgca 1610



to top

>gb|AF470075.1| Zea mays A-type R2R3 Myb protein (Myb8) gene, partial cds
          Length = 778

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 603 aaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangcc 653
           ||||||||||||||||||||| || |||||||||||||| || |||| |||
Sbjct: 232 aaggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcc 182



to top

>gb|AF470073.1| Zea mays A-type R2R3 Myb protein (Myb6) gene, partial cds
          Length = 1722

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 603 aaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangcc 653
           ||||||||||||||||||||| || |||||||||||||| || |||| |||
Sbjct: 715 aaggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcc 665



to top

>gb|AF474116.1| Zea mays typical P-type R2R3 Myb protein (Myb3) gene, partial cds
          Length = 2138

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 442  gcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcc 489
            ||||||||||||| |||| ||||  |||||||||||||||||||||||
Sbjct: 2006 gcttcttgaggtgcgtgttccagtagttcttgatctcgttgtccgtcc 1959



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 96/119 (80%), Gaps = 1/119 (0%)
 Strand = Plus / Minus

                                                                        
Query: 523  tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
            |||||||||  |||||||||||||||| |||||    || |||||||   ||||||   |
Sbjct: 1578 tgttgccgacgatggcgtggagctggacgatggacttctgctcctcggatgtgaagggcc 1519

                                                                       
Query: 583  cgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
            ||||||||||||| || ||  ||||||||  ||||||| || || ||||||||||||||
Sbjct: 1518 cgcgcttgatgtccggccg-gaggtagttcgtccaccgcagtcggcagctcttgccgca 1461



to top

>emb|Z11879.1|ZMAYSPG Z.mays P gene
          Length = 7753

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 603 aaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangcc 653
           ||||||||||||||||||||| || |||||||||||||| || |||| |||
Sbjct: 729 aaggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcc 679



to top

>gb|AF427146.1|AF427146 Zea mays myb-like transcription factor (P) mRNA, complete cds
          Length = 1513

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 113/139 (81%), Gaps = 1/139 (0%)
 Strand = Plus / Minus

                                                                       
Query: 515 ggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggt 574
           |||||| |||||||||||  |||||||||||| |||||||  | | || |||||  ||| 
Sbjct: 448 ggaccacctgttgccgagggtggcgtggagcttgatgatgatgtcttcttcctccttgga 389

                                                                       
Query: 575 gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
           || ||| || | ||||| ||| |  || ||||||||||||||||||||| || |||||||
Sbjct: 388 gatgttccccctcttgacgtccgcccg-aaggtagttgatccaccggagccggcagctct 330

                              
Query: 635 tgccgcagcgcagcangcc 653
           ||||||| || |||| |||
Sbjct: 329 tgccgcaccggagcaggcc 311



to top

>gb|AY860968.1| Sorghum bicolor yellow seed1 (y1) gene, y1-rr allele, complete cds;
            and y2 pseudogene, complete sequence
          Length = 22400

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 99/120 (82%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                        
Query: 522  ctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttg 581
            |||||||||||  |||||||||||| |||||||  | |||| |||||  ||| || ||| 
Sbjct: 2931 ctgttgccgagggtggcgtggagcttgatgatgatgtcctcttcctccttggagatgttc 2872

                                                                        
Query: 582  ccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgca 641
            || | ||||| |||||  || |||||||||||||||||| || || ||||||||||||||
Sbjct: 2871 cctctcttgacgtcggcccg-aaggtagttgatccaccgcagccggcagctcttgccgca 2813



to top

>gb|AF210617.1|AF210617 Zea mays subsp. parviglumis P2-t protein (P2-t) gene, complete cds
          Length = 12679

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 603  aaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangcc 653
            ||||||||||||||||||||| || |||||||||||||| || |||| |||
Sbjct: 3620 aaggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcc 3570



to top

>gb|AF099376.1|AF099376 Zea mays clone ZmMYB4H29 R2R3MYB-domain protein mRNA, partial cds
          Length = 129

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 84/100 (84%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 513 gtggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctg 572
           |||||||| ||||||||||  |||||||||||||||| ||| | |   | |||||||  |
Sbjct: 101 gtggaccacctgttgccgatgatggcgtggagctggaggatagagttgtgctcctcgggg 42

                                                   
Query: 573 gtgaagttgccgcgcttgatgtcggggcgcaaggtagttg 612
           |||||||  |||||||||||||| |||||| |||||||||
Sbjct: 41  gtgaagtgcccgcgcttgatgtccgggcgc-aggtagttg 3



to top

>gb|AY702552.1| Zea mays Myb-like transcription factor P1 (P1) gene, P1-rw1077 allele,
             complete cds
          Length = 22270

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                
Query: 603   aaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangcc 653
             ||||||||||||||||||||| || |||||||||||||| || |||| |||
Sbjct: 10175 aaggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcc 10125



to top

>gb|AY104089.1| Zea mays PCO146624 mRNA sequence
          Length = 914

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 603 aaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangcc 653
           ||||||||||||||||||||| || |||||||||||||| || |||| |||
Sbjct: 494 aaggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcc 444



to top

>gb|U57002.1|ZMU57002 Zea mays P protein (P) mRNA, complete cds
          Length = 1601

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 113/139 (81%), Gaps = 1/139 (0%)
 Strand = Plus / Minus

                                                                       
Query: 515 ggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggt 574
           |||||| |||||||||||  |||||||||||| |||||||  | | || |||||  ||| 
Sbjct: 589 ggaccacctgttgccgagggtggcgtggagcttgatgatgatgtcttcttcctccttgga 530

                                                                       
Query: 575 gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
           || ||| || | ||||| ||| |  || ||||||||||||||||||||| || |||||||
Sbjct: 529 gatgttccccctcttgacgtccgcccg-aaggtagttgatccaccggagccggcagctct 471

                              
Query: 635 tgccgcagcgcagcangcc 653
           ||||||| || |||| |||
Sbjct: 470 tgccgcaccggagcaggcc 452



to top

>gb|M73029.1|MZEPPRA Zea mays myb-like transcription factor (P) protein mRNA, complete
           cds
          Length = 945

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 603 aaggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangcc 653
           ||||||||||||||||||||| || |||||||||||||| || |||| |||
Sbjct: 502 aaggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcc 452



to top

>gb|M73028.1|MZEPPR Zea mays protein homologous to the DNA-binding domain of myb-like
           transcription factor mRNA, complete cds
          Length = 1802

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 113/139 (81%), Gaps = 1/139 (0%)
 Strand = Plus / Minus

                                                                       
Query: 515 ggaccatctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggt 574
           |||||| |||||||||||  |||||||||||| |||||||  | | || |||||  ||| 
Sbjct: 589 ggaccacctgttgccgagggtggcgtggagcttgatgatgatgtcttcttcctccttgga 530

                                                                       
Query: 575 gaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctct 634
           || ||| || | ||||| ||| |  || ||||||||||||||||||||| || |||||||
Sbjct: 529 gatgttccccctcttgacgtccgcccg-aaggtagttgatccaccggagccggcagctct 471

                              
Query: 635 tgccgcagcgcagcangcc 653
           ||||||| || |||| |||
Sbjct: 470 tgccgcaccggagcaggcc 452



to top

>ref|XM_478689.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1107

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           |||||||||||||||||||||||  || || ||||  || || || |  |||||  ||||
Sbjct: 318 gttcttgatctcgttgtccgtccggcccggcagccgcgccgcgatcgctgaccacttgtt 259

                                                      
Query: 527 gccgagcatggcgtggagctggatgatggcgccctcctcctcg 569
           |||||| |||  ||||||||||||||||||  |||||||||||
Sbjct: 258 gccgaggatgctgtggagctggatgatggcctcctcctcctcg 216



to top

>gb|AF474133.1| Sorghum bicolor typical P-type R2R3 Myb protein (Myb67) gene, partial
            cds
          Length = 2224

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 443  cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
            |||||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 1953 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcctccc 1903



to top

>gb|AF474131.1| Sorghum bicolor typical P-type R2R3 Myb protein (Myb54) gene, partial
            cds
          Length = 1899

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 443  cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
            |||||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 1754 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcctccc 1704



to top

>gb|AF474130.1| Sorghum bicolor typical P-type R2R3 Myb protein (Myb53) gene, partial
            cds
          Length = 1892

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 443  cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
            |||||||| ||| |||| ||||  |||||||||||||||||||||||||||
Sbjct: 1680 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcctccc 1630



to top

>emb|Y11415.1|OSMYB1355 O.sativa mRNA for myb factor, 1355 bp
          Length = 1355

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 467 gttcttgatctcgttgtccgtcctcccaggaagcctggcggcaatggtggaccatctgtt 526
           |||||||||||||||||||||||  || || ||||  || || || |  |||||  ||||
Sbjct: 433 gttcttgatctcgttgtccgtccggcccggcagccgcgccgcgatcgctgaccacttgtt 374

                                                      
Query: 527 gccgagcatggcgtggagctggatgatggcgccctcctcctcg 569
           |||||| |||  ||||||||||||||||||  |||||||||||
Sbjct: 373 gccgaggatgctgtggagctggatgatggcctcctcctcctcg 331



to top

>gb|AF210616.1|AF210616 Zea mays P2 protein (P2) gene, complete cds
          Length = 12634

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 604  aggtagttgatccaccggaggcgacagctcttgccgcagcgcagcangcc 653
            |||||||||||||||||||| || |||||||||||||| || |||| |||
Sbjct: 5014 aggtagttgatccaccggagccggcagctcttgccgcaccggagcaggcc 4965



to top

>gb|AF099402.1|AF099402 Zea mays clone ZmMYBIM16 R2R3MYB-domain protein mRNA, partial cds
          Length = 129

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                       
Query: 523 tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
           |||||||||||| ||||||||||| |||||||    | || || |||| |||||||||||
Sbjct: 91  tgttgccgagcagggcgtggagcttgatgatgagctcgtcgtcgtcgccggtgaagttgc 32

                              
Query: 583 cgcgcttgatgtcggggcg 601
           ||||||||| ||| |||||
Sbjct: 31  cgcgcttgaggtccgggcg 13



to top

>ref|NM_191815.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 921

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgca 641
           |||||||||| |||||||||||| ||||||||||||||
Sbjct: 209 aggtagttgagccaccggaggcggcagctcttgccgca 172



to top

>gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genomic sequence, complete
             sequence
          Length = 167239

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                           
Query: 604   aggtagttgatccaccggaggcgacagctcttgccgcagcgcagca 649
             |||| |||| ||||||||||||| ||||||||||||||||| ||||
Sbjct: 64248 aggtggttggtccaccggaggcggcagctcttgccgcagcggagca 64293



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 467   gttcttgatctcgttgtccgtcctccc 493
             |||||||||||||||||||||||||||
Sbjct: 64001 gttcttgatctcgttgtccgtcctccc 64027



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                              
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgcagcgcagca 649
                |||| |||| ||||||||||||| ||||||||||||||||| ||||
Sbjct: 21021030 aggtggttggtccaccggaggcggcagctcttgccgcagcggagca 21020985



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                         
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaag 499
                |||||||||| | |||| ||||  ||||||||||||||||||||| | |||||||||
Sbjct: 15351383 cttcttgaggcgcgtgttccagtagttcttgatctcgttgtccgtgcgcccaggaag 15351439



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                           
Query: 467      gttcttgatctcgttgtccgtcctccc 493
                |||||||||||||||||||||||||||
Sbjct: 21021277 gttcttgatctcgttgtccgtcctccc 21021251



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                           
Query: 467      gttcttgatctcgttgtccgtcctccc 493
                |||||||||||||||||||||||||||
Sbjct: 10679863 gttcttgatctcgttgtccgtcctccc 10679889



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                          
Query: 467     gttcttgatctcgttgtccgtcctccc 493
               |||||||||||||||||||||||||||
Sbjct: 2324258 gttcttgatctcgttgtccgtcctccc 2324284



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                      
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgca 641
                |||||||| | |||||||||||| ||||||||||||||
Sbjct: 31650213 aggtagttcagccaccggaggcggcagctcttgccgca 31650250



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                
Query: 522     ctgttgccgagcatggcgtggagctggatgatg 554
               |||||||||||||||||||| ||||||| ||||
Sbjct: 2324432 ctgttgccgagcatggcgtgcagctggaggatg 2324464



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                          
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
                |||||||||||| |||| ||||| ||||||||  ||||||||
Sbjct: 14806124 cttcttgaggtgggtgttccagaagttcttgacgtcgttgtc 14806083



to top

>gb|AF474120.1| Zea mays typical P-type R2R3 Myb protein (Myb30) gene, partial cds
          Length = 1697

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 604  aggtagttgatccaccggaggcgacagctcttgccgcagcgcagca 649
            ||||||||| ||||||||||||| |||||||||| ||| |||||||
Sbjct: 1392 aggtagttggtccaccggaggcggcagctcttgctgcaccgcagca 1347



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                              
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgcagcgcagca 649
                |||| |||| ||||||||||||| ||||||||||||||||| ||||
Sbjct: 21014059 aggtggttggtccaccggaggcggcagctcttgccgcagcggagca 21014014



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                         
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaag 499
                |||||||||| | |||| ||||  ||||||||||||||||||||| | |||||||||
Sbjct: 15345917 cttcttgaggcgcgtgttccagtagttcttgatctcgttgtccgtgcgcccaggaag 15345973



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                           
Query: 467      gttcttgatctcgttgtccgtcctccc 493
                |||||||||||||||||||||||||||
Sbjct: 21014306 gttcttgatctcgttgtccgtcctccc 21014280



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                           
Query: 467      gttcttgatctcgttgtccgtcctccc 493
                |||||||||||||||||||||||||||
Sbjct: 10677964 gttcttgatctcgttgtccgtcctccc 10677990



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                          
Query: 467     gttcttgatctcgttgtccgtcctccc 493
               |||||||||||||||||||||||||||
Sbjct: 2324368 gttcttgatctcgttgtccgtcctccc 2324394



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                      
Query: 604      aggtagttgatccaccggaggcgacagctcttgccgca 641
                |||||||| | |||||||||||| ||||||||||||||
Sbjct: 31740729 aggtagttcagccaccggaggcggcagctcttgccgca 31740766



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                
Query: 522     ctgttgccgagcatggcgtggagctggatgatg 554
               |||||||||||||||||||| ||||||| ||||
Sbjct: 2324542 ctgttgccgagcatggcgtgcagctggaggatg 2324574



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                          
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
                |||||||||||| |||| ||||| ||||||||  ||||||||
Sbjct: 14800658 cttcttgaggtgggtgttccagaagttcttgacgtcgttgtc 14800617



to top

>dbj|AP003229.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0022F10
          Length = 150498

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                   
Query: 604   aggtagttgatccaccggaggcgacagctcttgccgca 641
             |||||||||| |||||||||||| ||||||||||||||
Sbjct: 15805 aggtagttgagccaccggaggcggcagctcttgccgca 15768



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0690B02
          Length = 153116

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                    
Query: 604    aggtagttgatccaccggaggcgacagctcttgccgca 641
              |||||||||| |||||||||||| ||||||||||||||
Sbjct: 106973 aggtagttgagccaccggaggcggcagctcttgccgca 106936



to top

>ref|XM_482584.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 933

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctc 491
           |||||||||||| |||| ||||  ||||||||| |||||||||||||||
Sbjct: 342 cttcttgaggtgcgtgttccagtagttcttgatgtcgttgtccgtcctc 294



to top

>ref|NM_192221.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 909

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 461 ccagacgttcttgatctcgttgtccgtcctccc 493
           ||||| |||||||||||||||||||||||||||
Sbjct: 336 ccagaagttcttgatctcgttgtccgtcctccc 304



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/92 (85%), Gaps = 3/92 (3%)
 Strand = Plus / Minus

                                                                       
Query: 551 gatggcgccctcctcctcgctg-gtgaagttgccgcgcttgatgtcggggcgcaaggtag 609
           ||||||| ||||||||| |||| | |||| |||| ||||| | ||||||||||| |||||
Sbjct: 246 gatggcgtcctcctcct-gctgcgagaagctgccccgcttcaggtcggggcgca-ggtag 189

                                           
Query: 610 ttgatccaccggaggcgacagctcttgccgca 641
           ||||||||||| || |  ||||||||||||||
Sbjct: 188 ttgatccaccgcagcctgcagctcttgccgca 157



to top

>ref|XM_470783.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 954

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaag 499
           |||||||||| | |||| ||||  ||||||||||||||||||||| | |||||||||
Sbjct: 351 cttcttgaggcgcgtgttccagtagttcttgatctcgttgtccgtgcgcccaggaag 295



to top

>gb|AC135794.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
            OSJNBb0084H09, complete sequence
          Length = 130151

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 446  cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
            ||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||||
Sbjct: 2263 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccccggcagcct 2207



to top

>gb|AC134044.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0019D06
              map S10616A, complete sequence
          Length = 182486

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                       
Query: 446    cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
              ||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||||
Sbjct: 158227 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccccggcagcct 158171



to top

>gb|AC098833.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1288_A07,
             complete sequence
          Length = 122120

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                              
Query: 461   ccagacgttcttgatctcgttgtccgtcctccc 493
             ||||| |||||||||||||||||||||||||||
Sbjct: 63343 ccagaagttcttgatctcgttgtccgtcctccc 63311



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 604   aggtagttgatccaccggaggcgacagctcttgccgca 641
             ||||||||||||||||| || |  ||||||||||||||
Sbjct: 63076 aggtagttgatccaccgcagcctgcagctcttgccgca 63039



to top

>gb|AC118285.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1206_C08,
             complete sequence
          Length = 115026

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                              
Query: 461   ccagacgttcttgatctcgttgtccgtcctccc 493
             ||||| |||||||||||||||||||||||||||
Sbjct: 19644 ccagaagttcttgatctcgttgtccgtcctccc 19612



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 604   aggtagttgatccaccggaggcgacagctcttgccgca 641
             ||||||||||||||||| || |  ||||||||||||||
Sbjct: 19377 aggtagttgatccaccgcagcctgcagctcttgccgca 19340



to top

>gb|AF470061.1| Sorghum bicolor P-type R2R3 Myb protein (Myb44) gene, partial cds
          Length = 1707

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 63/73 (86%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                        
Query: 574  tgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctc 633
            |||||||||||||||||||| | |||||  || |||||| |||||||||| || ||||||
Sbjct: 1655 tgaagttgccgcgcttgatgcccgggcg-gagatagttggtccaccggagccggcagctc 1597

                         
Query: 634  ttgccgcagcgca 646
            |||| ||| ||||
Sbjct: 1596 ttgctgcatcgca 1584



to top

>gb|AY363132.1| Sorghum bicolor P-type R2R3 Myb protein (Myb30) gene, partial cds
          Length = 114

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcg 644
           |||||||||||||| |||||||| |||||||| ||||||||
Sbjct: 107 aggtagttgatccagcggaggcggcagctcttcccgcagcg 67



to top

>gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genomic sequence, complete
              sequence
          Length = 164705

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                       
Query: 443    cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaag 499
              |||||||||| | |||| ||||  ||||||||||||||||||||| | |||||||||
Sbjct: 150143 cttcttgaggcgcgtgttccagtagttcttgatctcgttgtccgtgcgcccaggaag 150087



to top

>emb|AL606460.3|OSJN00003 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072F16,
             complete sequence
          Length = 176383

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 101/121 (83%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                         
Query: 522   ctgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctgg-tgaagtt 580
             ||||||||||| | ||||||||||||||||||||    |||||||| || || |||| ||
Sbjct: 93803 ctgttgccgagaagggcgtggagctggatgatggtctgctcctcct-gcaggctgaactt 93745

                                                                         
Query: 581   gccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgccgc 640
             ||| | ||||||||| || ||  ||||||||  |||||||||| || |||||||||||||
Sbjct: 93744 gcccctcttgatgtccggccg-gaggtagttcgtccaccggagtcggcagctcttgccgc 93686

              
Query: 641   a 641
             |
Sbjct: 93685 a 93685



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 441   cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgt 487
             |||||||| ||||| |||| ||||  |||||||||||||||||||||
Sbjct: 94793 cgcttctttaggtgcgtgttccagtagttcttgatctcgttgtccgt 94747



to top

>emb|AJ601383.1| Festuca arundinacea partial mRNA for putative R2R3 MYB
           transcription factor (myb2 gene)
          Length = 166

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 66/77 (85%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 559 cctcctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccac 618
           ||||||| |||  |||||||||||| ||||||||||| || ||  |||||||||||||||
Sbjct: 79  cctcctcgtcggcggtgaagttgccccgcttgatgtccggccg-gaggtagttgatccac 21

                            
Query: 619 cggaggcgacagctctt 635
           || || ||||| |||||
Sbjct: 20  cgcagccgacaactctt 4



to top

>gb|AC165178.2| Zea mays clone ZMMBBb-272P17, complete sequence
          Length = 131485

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                              
Query: 443   cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctc 491
             |||||||||||| |||| ||||  ||||||||| |||||||||||||||
Sbjct: 35060 cttcttgaggtgcgtgttccagtagttcttgatgtcgttgtccgtcctc 35108



to top

>gb|AF474137.1| Oryza sativa typical P-type R2R3 Myb protein gene, partial cds
          Length = 1271

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctc 491
           |||||||||||| |||| ||||  ||||||||| |||||||||||||||
Sbjct: 272 cttcttgaggtgcgtgttccagtagttcttgatgtcgttgtccgtcctc 320



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                        
Query: 446     cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
               ||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||||
Sbjct: 4030601 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccccggcagcct 4030545



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 467      gttcttgatctcgttgtccgtcctcccagg 496
                |||||||||||||||||| |||||||||||
Sbjct: 26794429 gttcttgatctcgttgtcggtcctcccagg 26794458



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                          
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
                ||||||||||||||||| ||||  ||||||||| ||||||||
Sbjct: 19906432 cttcttgaggtgtgtgttccagtagttcttgatgtcgttgtc 19906473



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 298      cggtggcggacgacgagatggg 319
                ||||||||||||||||||||||
Sbjct: 25099708 cggtggcggacgacgagatggg 25099729



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 298      cggtggcggacgacgagatggg 319
                ||||||||||||||||||||||
Sbjct: 25057341 cggtggcggacgacgagatggg 25057362



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                         
Query: 443     cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
               |||||||||||| |||| ||||  ||||||||| ||||||||
Sbjct: 1319410 cttcttgaggtgggtgttccagtagttcttgatgtcgttgtc 1319451



to top

>dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0421H07
          Length = 158126

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                              
Query: 461   ccagacgttcttgatctcgttgtccgtcctccc 493
             ||||| |||||||||||||||||||||||||||
Sbjct: 86697 ccagaagttcttgatctcgttgtccgtcctccc 86729



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/92 (85%), Gaps = 3/92 (3%)
 Strand = Plus / Plus

                                                                         
Query: 551   gatggcgccctcctcctcgctg-gtgaagttgccgcgcttgatgtcggggcgcaaggtag 609
             ||||||| ||||||||| |||| | |||| |||| ||||| | ||||||||||| |||||
Sbjct: 86908 gatggcgtcctcctcct-gctgcgagaagctgccccgcttcaggtcggggcgca-ggtag 86965

                                             
Query: 610   ttgatccaccggaggcgacagctcttgccgca 641
             ||||||||||| || |  ||||||||||||||
Sbjct: 86966 ttgatccaccgcagcctgcagctcttgccgca 86997



to top

>gb|DQ074467.1| Malus x domestica MYB19 mRNA, complete cds
          Length = 810

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcg 644
           ||||| || |||||||||||||| |||||||||||||||||
Sbjct: 196 aggtaattaatccaccggaggcggcagctcttgccgcagcg 156



to top

>dbj|AP005636.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
            clone:P0707C02
          Length = 163609

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 443  cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctc 491
            |||||||||||| |||| ||||  ||||||||| |||||||||||||||
Sbjct: 6698 cttcttgaggtgcgtgttccagtagttcttgatgtcgttgtccgtcctc 6650



to top

>dbj|AP005159.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0016C11
          Length = 170723

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 443   cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctc 491
             |||||||||||| |||| ||||  ||||||||| |||||||||||||||
Sbjct: 60452 cttcttgaggtgcgtgttccagtagttcttgatgtcgttgtccgtcctc 60404



to top

>dbj|AK111782.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023084H22, full
           insert sequence
          Length = 1514

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 461 ccagacgttcttgatctcgttgtccgtcctccc 493
           ||||| |||||||||||||||||||||||||||
Sbjct: 613 ccagaagttcttgatctcgttgtccgtcctccc 581



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/92 (85%), Gaps = 3/92 (3%)
 Strand = Plus / Minus

                                                                       
Query: 551 gatggcgccctcctcctcgctg-gtgaagttgccgcgcttgatgtcggggcgcaaggtag 609
           ||||||| ||||||||| |||| | |||| |||| ||||| | ||||||||||| |||||
Sbjct: 523 gatggcgtcctcctcct-gctgcgagaagctgccccgcttcaggtcggggcgca-ggtag 466

                                           
Query: 610 ttgatccaccggaggcgacagctcttgccgca 641
           ||||||||||| || |  ||||||||||||||
Sbjct: 465 ttgatccaccgcagcctgcagctcttgccgca 434



to top

>gb|AF099422.1|AF099422 Zea mays clone ZmMYBIP148 R2R3MYB-domain protein mRNA, partial cds
          Length = 129

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 523 tgttgccgagcatggcgtggagctggatgatggcgccctcctcctcgctggtgaagttgc 582
           |||||||||| |||  ||||||||||||||| ||  |||||||||||  || ||||  ||
Sbjct: 91  tgttgccgaggatgctgtggagctggatgatagcctcctcctcctcgaaggagaagcggc 32

                        
Query: 583 cgcgcttgatgtc 595
           |||||||||||||
Sbjct: 31  cgcgcttgatgtc 19



to top

>gb|AF111710.1|AF111710 Oryza sativa subsp. indica putative dnaJ-like protein, putative
             myb-related protein, putative farnesyl pyrophosphate
             synthase, and hypothetical protein genes, complete cds
          Length = 43422

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                              
Query: 461   ccagacgttcttgatctcgttgtccgtcctccc 493
             ||||| |||||||||||||||||||||||||||
Sbjct: 12683 ccagaagttcttgatctcgttgtccgtcctccc 12715



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 604   aggtagttgatccaccggaggcgacagctcttgccgca 641
             ||||||||||||||||| || |  ||||||||||||||
Sbjct: 12950 aggtagttgatccaccgcagcctgcagctcttgccgca 12987



to top

>gb|DQ277686.1| Vitis vinifera isolate GNF21 MYB-like protein mRNA, partial cds
          Length = 292

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 457 tgtgccagacgttcttgatctcgttgtccgtcc 489
           |||||||||||||||||||||||||||| ||||
Sbjct: 292 tgtgccagacgttcttgatctcgttgtcggtcc 260



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                        
Query: 446     cttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcct 502
               ||||| ||| |||| ||||  ||||||||||||||||||||||||||| || |||||
Sbjct: 4039295 cttgatgtgcgtgttccagtagttcttgatctcgttgtccgtcctccccggcagcct 4039239



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 467      gttcttgatctcgttgtccgtcctcccagg 496
                |||||||||||||||||| |||||||||||
Sbjct: 27121661 gttcttgatctcgttgtcggtcctcccagg 27121690



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                          
Query: 443      cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
                ||||||||||||||||| ||||  ||||||||| ||||||||
Sbjct: 20191411 cttcttgaggtgtgtgttccagtagttcttgatgtcgttgtc 20191452



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 298      cggtggcggacgacgagatggg 319
                ||||||||||||||||||||||
Sbjct: 25410727 cggtggcggacgacgagatggg 25410748



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 298      cggtggcggacgacgagatggg 319
                ||||||||||||||||||||||
Sbjct: 25368931 cggtggcggacgacgagatggg 25368952



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                         
Query: 443     cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
               |||||||||||| |||| ||||  ||||||||| ||||||||
Sbjct: 1317131 cttcttgaggtgggtgttccagtagttcttgatgtcgttgtc 1317172



to top

>emb|AL731887.5|CNS08C8R Oryza sativa chromosome 12, . BAC OJ1559_C07 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 145816

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                       
Query: 604    aggtagttgatccaccggaggcgacagctcttgccgcagcg 644
              |||||||||| ||| |||||||| |||||||||||||||||
Sbjct: 127136 aggtagttgagccagcggaggcggcagctcttgccgcagcg 127096



to top

>emb|AL831809.3|CNS08CAM Oryza sativa chromosome 12, . BAC OJ1268_D02 of library Monsanto from
            chromosome 12 of cultivar Nipponbare of ssp. japonica of
            Oryza sativa (rice), complete sequence
          Length = 146585

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 604  aggtagttgatccaccggaggcgacagctcttgccgcagcg 644
            |||||||||| ||| |||||||| |||||||||||||||||
Sbjct: 1269 aggtagttgagccagcggaggcggcagctcttgccgcagcg 1229



to top

>ref|XM_467854.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1134

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcct 490
           |||||| |||||||||| ||||  |||||||||||||||||| |||||
Sbjct: 342 cttcttcaggtgtgtgttccagtagttcttgatctcgttgtcagtcct 295



to top

>ref|XM_466994.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1399

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 158/200 (79%), Gaps = 1/200 (0%)
 Strand = Plus / Minus

                                                                       
Query: 442 gcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcc 501
           ||||||||||||| |||| |||   |||||||||||||||||| ||||  || || ||| 
Sbjct: 463 gcttcttgaggtgagtgttccaatagttcttgatctcgttgtcggtccggccgggcagct 404

                                                                       
Query: 502 tggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccct 561
             || || ||  |||||||  |||||||||  ||| |||||||||||| |||||    ||
Sbjct: 403 gcgccgcgatcatggaccacttgttgccgacgatgccgtggagctggacgatggacttct 344

                                                                       
Query: 562 cctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgg 621
            |||||||  |||||||   |||||||||||||| || ||  ||||||||  ||||||| 
Sbjct: 343 gctcctcggcggtgaagggcccgcgcttgatgtccggccg-gaggtagttcgtccaccgc 285

                               
Query: 622 aggcgacagctcttgccgca 641
           || || ||||||||||||||
Sbjct: 284 agccggcagctcttgccgca 265



to top

>gb|BT008981.2| Triticum aestivum clone wdk2c.pk006.d4:fis, full insert mRNA
           sequence
          Length = 1199

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcct 490
           |||||||| ||| |||| ||||  ||||||||||||||||||||||||
Sbjct: 449 cttcttgatgtgggtgttccagtggttcttgatctcgttgtccgtcct 402



to top

>emb|Y11351.1|OSMYB1402 O.sativa mRNA for myb factor, 1402 bp
          Length = 1402

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcct 490
           |||||||| ||| |||| ||||  ||||||||||||||||||||||||
Sbjct: 488 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcct 441



to top

>dbj|AP003723.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0003H08
          Length = 142068

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 467   gttcttgatctcgttgtccgtcctccca 494
             ||||||||||||||||||||||||||||
Sbjct: 42478 gttcttgatctcgttgtccgtcctccca 42505



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                            
Query: 615   ccaccggaggcgacagctcttgccgcagcgc 645
             |||||||||||| ||||||||||||||||||
Sbjct: 42711 ccaccggaggcggcagctcttgccgcagcgc 42741



to top

>dbj|AP005421.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0435D08
          Length = 148912

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 443    cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcct 490
              |||||||| ||| |||| ||||  ||||||||||||||||||||||||
Sbjct: 129117 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcct 129070



to top

>dbj|AP005321.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0650H04
          Length = 134533

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                             
Query: 443   cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcct 490
             |||||||| ||| |||| ||||  ||||||||||||||||||||||||
Sbjct: 77914 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcct 77867



to top

>dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0627E03
          Length = 159861

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                             
Query: 443   cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcct 490
             |||||| |||||||||| ||||  |||||||||||||||||| |||||
Sbjct: 39903 cttcttcaggtgtgtgttccagtagttcttgatctcgttgtcagtcct 39950



to top

>dbj|AK111697.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023004F23, full
           insert sequence
          Length = 1928

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 467 gttcttgatctcgttgtccgtcctccca 494
           ||||||||||||||||||||||||||||
Sbjct: 637 gttcttgatctcgttgtccgtcctccca 610



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 615 ccaccggaggcgacagctcttgccgcagcgc 645
           |||||||||||| ||||||||||||||||||
Sbjct: 490 ccaccggaggcggcagctcttgccgcagcgc 460



to top

>dbj|AK108621.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-147-D04, full
           insert sequence
          Length = 1399

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 158/200 (79%), Gaps = 1/200 (0%)
 Strand = Plus / Minus

                                                                       
Query: 442 gcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctcccaggaagcc 501
           ||||||||||||| |||| |||   |||||||||||||||||| ||||  || || ||| 
Sbjct: 463 gcttcttgaggtgagtgttccaatagttcttgatctcgttgtcggtccggccgggcagct 404

                                                                       
Query: 502 tggcggcaatggtggaccatctgttgccgagcatggcgtggagctggatgatggcgccct 561
             || || ||  |||||||  |||||||||  ||| |||||||||||| |||||    ||
Sbjct: 403 gcgccgcgatcatggaccacttgttgccgacgatgccgtggagctggacgatggacttct 344

                                                                       
Query: 562 cctcctcgctggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccgg 621
            |||||||  |||||||   |||||||||||||| || ||  ||||||||  ||||||| 
Sbjct: 343 gctcctcggcggtgaagggcccgcgcttgatgtccggccg-gaggtagttcgtccaccgc 285

                               
Query: 622 aggcgacagctcttgccgca 641
           || || ||||||||||||||
Sbjct: 284 agccggcagctcttgccgca 265



to top

>dbj|AK069082.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023005A19, full
           insert sequence
          Length = 1404

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 467 gttcttgatctcgttgtccgtcctccca 494
           ||||||||||||||||||||||||||||
Sbjct: 513 gttcttgatctcgttgtccgtcctccca 486



to top

>dbj|AK064679.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-H05, full
           insert sequence
          Length = 1389

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 443 cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcct 490
           |||||||| ||| |||| ||||  ||||||||||||||||||||||||
Sbjct: 491 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgtcct 444



to top

>ref|NM_184207.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1577

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 467 gttcttgatctcgttgtccgtcctccc 493
           |||||||||||||||||||||||||||
Sbjct: 493 gttcttgatctcgttgtccgtcctccc 467



to top

>ref|NM_183669.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 882

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 467 gttcttgatctcgttgtccgtcctccc 493
           |||||||||||||||||||||||||||
Sbjct: 345 gttcttgatctcgttgtccgtcctccc 319



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 604 aggtagttgatccaccggaggcgacagctctt 635
           |||||||||| |||||||||||| ||||||||
Sbjct: 209 aggtagttgagccaccggaggcggcagctctt 178



to top

>gb|AF470089.1| Zea mays P-type R2R3 Myb protein (Myb48) gene, partial cds
          Length = 1419

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 55/63 (87%), Gaps = 1/63 (1%)
 Strand = Plus / Minus

                                                                        
Query: 579  ttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagctcttgcc 638
            ||||| ||||||||||| || |||| |||||||| ||||||| || || |||||||||||
Sbjct: 1153 ttgccccgcttgatgtccggccgca-ggtagttggtccaccgcagccggcagctcttgcc 1095

               
Query: 639  gca 641
            |||
Sbjct: 1094 gca 1092



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 441  cgcttcttgaggtgtgtgtgccagacgttcttgatctcgttgtc 484
            |||||| ||||||| |||| ||| | ||||||||||||||||||
Sbjct: 1291 cgcttcctgaggtgcgtgttccaaaagttcttgatctcgttgtc 1248



to top

>gb|AF470086.1| Zea mays P-type R2R3 Myb protein (Myb36) gene, partial cds
          Length = 593

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 64/75 (85%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                       
Query: 572 ggtgaagttgccgcgcttgatgtcggggcgcaaggtagttgatccaccggaggcgacagc 631
           |||||||||||||||||||||| | || ||  ||||||||| ||||||| || || ||||
Sbjct: 456 ggtgaagttgccgcgcttgatgcccggccg-gaggtagttggtccaccgcagacggcagc 398

                          
Query: 632 tcttgccgcagcgca 646
           |||||| ||| ||||
Sbjct: 397 tcttgctgcaccgca 383



to top

>gb|AF470070.1| Sorghum bicolor P-type R2R3 Myb protein (Myb66) gene, partial cds
          Length = 910

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           |||||||||||||||||||| || |||||||||| ||| ||||
Sbjct: 903 aggtagttgatccaccggagccggcagctcttgctgcatcgca 861



to top

>gb|AF470069.1| Sorghum bicolor P-type R2R3 Myb protein (Myb46) gene, partial cds
          Length = 708

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           |||||||||||||||||||| || |||||||||| ||| ||||
Sbjct: 701 aggtagttgatccaccggagccggcagctcttgctgcatcgca 659



to top

>gb|AF474129.1| Sorghum bicolor typical P-type R2R3 Myb protein (Myb42) gene, partial
            cds
          Length = 1357

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 604  aggtagttgatccaccggaggcgacagctcttgcc 638
            |||||||||| |||||||||||| |||||||||||
Sbjct: 1021 aggtagttgagccaccggaggcggcagctcttgcc 987



to top

>gb|AF474127.1| Sorghum bicolor typical P-type R2R3 Myb protein (Myb20) gene, partial
            cds
          Length = 2328

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 604  aggtagttgatccaccggaggcgacagctcttgcc 638
            |||||||||| |||||||||||| |||||||||||
Sbjct: 1875 aggtagttgagccaccggaggcggcagctcttgcc 1841



to top

>gb|AF474123.1| Zea mays typical P-type R2R3 Myb protein (Myb55) gene, partial cds
          Length = 1941

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 443  cttcttgaggtgtgtgtgccagacgttcttgatctcgttgtccgtcctccc 493
            |||||||| ||| |||| ||||  ||||||||||||||||||||| |||||
Sbjct: 1832 cttcttgatgtgcgtgttccagtggttcttgatctcgttgtccgttctccc 1782



to top

>gb|AY363161.1| Sorghum bicolor P-type R2R3 Myb protein (Myb86) gene, partial cds
          Length = 752

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 604 aggtagttgatccaccggaggcgacagctcttgcc 638
           |||||||||| |||||||||||| |||||||||||
Sbjct: 297 aggtagttgagccaccggaggcggcagctcttgcc 263



to top

>gb|AY363136.1| Sorghum bicolor P-type R2R3 Myb protein (Myb36) gene, partial cds
          Length = 242

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 604 aggtagttgatccaccggaggcgacagctcttgccgcagcgca 646
           |||||||||||||||||||| || |||||||||| ||| ||||
Sbjct: 235 aggtagttgatccaccggagccggcagctcttgctgcatcgca 193



to top

>gb|AY459337.1| Oryza sativa (japonica cultivar-group) clone CL003615.3 R2R3-MYB gene
            region
          Length = 42296

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 467  gttcttgatctcgttgtccgtcctccc 493
            |||||||||||||||||||||||||||
Sbjct: 8945 gttcttgatctcgttgtccgtcctccc 8971



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 604  aggtagttgatccaccggaggcgacagctctt 635
            |||||||||| |||||||||||| ||||||||
Sbjct: 9081 aggtagttgagccaccggaggcggcagctctt 9112



to top

>gb|AC137267.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0032G21, from chromosome 3, complete sequence
          Length = 187621

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 467   gttcttgatctcgttgtccgtcctccc 493
             |||||||||||||||||||||||||||
Sbjct: 96777 gttcttgatctcgttgtccgtcctccc 96803



to top

>gb|AF485899.1| Dendrobium sp. XMW-2002-8 MYB8 (MYB8) mRNA, complete cds
          Length = 1060

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 467 gttcttgatctcgttgtccgtcctccc 493
           |||||||||||||||||||||||||||
Sbjct: 370 gttcttgatctcgttgtccgtcctccc 344



to top

>emb|AJ495785.1|OSA495785 Oryza sativa (japonica cultivar-group) mRNA for MYB17 protein
          Length = 1177

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 604 aggtagttgatccaccggaggcgacagctcttgcc 638
           |||||||||| |||||||||||| |||||||||||
Sbjct: 382 aggtagttgacccaccggaggcggcagctcttgcc 348



to top

>gb|DQ075263.2| Oryza sativa (japonica cultivar-group) MYB transcription factor
           MYBAS2-3 mRNA, complete cds, alternatively spliced
          Length = 729

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 604 aggtagttgatccaccggaggcgacagctcttgcc 638
           |||||||||| |||||||||||| |||||||||||
Sbjct: 170 aggtagttgacccaccggaggcggcagctcttgcc 136



to top

>gb|DQ075262.1| Oryza sativa (japonica cultivar-group) MYB transcription factor
           MYBAS2-2 mRNA, complete cds, alternatively spliced
          Length = 758

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 604 aggtagttgatccaccggaggcgacagctcttgcc 638
           |||||||||| |||||||||||| |||||||||||
Sbjct: 199 aggtagttgacccaccggaggcggcagctcttgcc 165


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,694,418
Number of Sequences: 3902068
Number of extensions: 4694418
Number of successful extensions: 90969
Number of sequences better than 10.0: 647
Number of HSP's better than 10.0 without gapping: 602
Number of HSP's successfully gapped in prelim test: 86
Number of HSP's that attempted gapping in prelim test: 86948
Number of HSP's gapped (non-prelim): 3911
length of query: 710
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 687
effective length of database: 17,143,297,704
effective search space: 11777445522648
effective search space used: 11777445522648
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top