>emb|Z99289.1|HS142L7 Human DNA sequence from clone RP1-142L7 on chromosome 6q21 Contains the
3' end of the WISP3 gene for WNT1 inducible signaling
pathway protein 3, the gene for epsilon tubulin, two novel
genes, the 3' end of the LAMA4 gene for laminin alpha 4,
the 5' end of a novel gene and a CpG island, complete
sequence
Length = 190778
Score = 44.1 bits (22), Expect = 0.53
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 357 caccaactgcttgcagaaagcaaggc 382
|||||||||||| |||||||||||||
Sbjct: 175244 caccaactgcttacagaaagcaaggc 175269
>emb|BX322539.9| Human DNA sequence from clone DAQB-115I13 on chromosome 6 Contains the
3' end of the HCG27 gene for HLA complex group 27, the
HLA-C gene for major histocompatibility complex, class I,
C, and 1 CpG island, complete sequence
Length = 69495
Score = 40.1 bits (20), Expect = 8.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 aattttttgtatgtattttc 20
||||||||||||||||||||
Sbjct: 41657 aattttttgtatgtattttc 41676
>emb|AL662844.12| Human DNA sequence from clone XXbac-299F13 on chromosome 6 contains the
gene for STG protein, the CDSN gene for corneodesmosin, the
gene for SEEK1 protein, the gene for SPR1 protein, the gene
for HCR, the TCF19 gene for transcription factor 19, the
POU5F1 gene for POU domain, class 5, transcription factor
1, a putative novel transcript and four CpG islands,
complete sequence
Length = 204298
Score = 40.1 bits (20), Expect = 8.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 aattttttgtatgtattttc 20
||||||||||||||||||||
Sbjct: 185453 aattttttgtatgtattttc 185472
>emb|AL662833.4| Human DNA sequence from clone XXbac-101P6 on chromosome 6 contains the
gene for HCR, the TCF19 gene for transcription factor 19,
the POU5F1 gene for POU domain, class 5, transcription
factor 1, a putative novel transcript, the HLA-C gene for
major histocompatibility complex, class I, C, a ubiquitin
specific protease 8 (USP8) pseudogene, a ribosomal protein
L3 (RPL3) pseudogene, a WAS protein family, member 3
(WASF3) pseudogene and three CpG islands, complete
sequence
Length = 168887
Score = 40.1 bits (20), Expect = 8.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 aattttttgtatgtattttc 20
||||||||||||||||||||
Sbjct: 105613 aattttttgtatgtattttc 105632
>dbj|D84394.1| Homo sapiens genomic DNA, 237 kb segment from 6p21.3 region including HLA
genes, complete sequence
Length = 236822
Score = 40.1 bits (20), Expect = 8.3
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 aattttttgtatgtattttc 20
||||||||||||||||||||
Sbjct: 168814 aattttttgtatgtattttc 168795
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,568,274
Number of Sequences: 3902068
Number of extensions: 6568274
Number of successful extensions: 127250
Number of sequences better than 10.0: 71
Number of HSP's better than 10.0 without gapping: 71
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 127035
Number of HSP's gapped (non-prelim): 215
length of query: 612
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 589
effective length of database: 17,143,297,704
effective search space: 10097402347656
effective search space used: 10097402347656
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)