| Clone Name | rbags9a21 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK060267.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-005-D04, full insert sequence Length = 742 Score = 341 bits (172), Expect = 2e-90 Identities = 265/296 (89%) Strand = Plus / Minus Query: 310 gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369 ||||| |||| ||||||||| | ||| ||||||||||| |||||||||||||||| ||| Sbjct: 422 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 363 Query: 370 gggaagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatacaga 429 ||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||| || Sbjct: 362 gggaagaccatcttggttccagggatgtacttcttaggattaagcaggtagtcataaagt 303 Query: 430 gtgttctcctcccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcg 489 |||||||||||||| ||||||| |||||||||| |||| ||||||||| ||||||| | Sbjct: 302 gtgttctcctcccagatcacagccatgttcttgttggccgtagagtaggaataaccaggg 243 Query: 490 gtggtgcccgactgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcg 549 ||||| || |||||||| ||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 242 gtggtacctgactgccttccaaacagaccattcaagtttggaccttgcttgtggccggcg 183 Query: 550 cccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605 ||| |||||||||||||||||| ||||||||||||||||||||||| ||||||| Sbjct: 182 cccttgtcgacggtgtggcactgggcgcacttggtcttgaagatcttctcgccggc 127 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 caagataattgtctcgtggat 201 ||||||||||||||||||||| Sbjct: 547 caagataattgtctcgtggat 527
>dbj|D12634.1|RICYCYTC Oryza sativa (japonica cultivar-group) mRNA for cytochrome C, complete cds Length = 654 Score = 341 bits (172), Expect = 2e-90 Identities = 265/296 (89%) Strand = Plus / Minus Query: 310 gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369 ||||| |||| ||||||||| | ||| ||||||||||| |||||||||||||||| ||| Sbjct: 340 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 281 Query: 370 gggaagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatacaga 429 ||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||| || Sbjct: 280 gggaagaccatcttggttccagggatgtacttcttaggattaagcaggtagtcataaagt 221 Query: 430 gtgttctcctcccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcg 489 |||||||||||||| ||||||| |||||||||| |||| ||||||||| ||||||| | Sbjct: 220 gtgttctcctcccagatcacagccatgttcttgttggccgtagagtaggaataaccaggg 161 Query: 490 gtggtgcccgactgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcg 549 ||||| || |||||||| ||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 160 gtggtacctgactgccttccaaacagaccattcaagtttggaccttgcttgtggccggcg 101 Query: 550 cccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605 ||| |||||||||||||||||| ||||||||||||||||||||||| ||||||| Sbjct: 100 cccttgtcgacggtgtggcactgggcgcacttggtcttgaagatcttctcgccggc 45 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 caagataattgtctcgtggat 201 ||||||||||||||||||||| Sbjct: 465 caagataattgtctcgtggat 445
>gb|AF017367.1|AF017367 Oryza sativa cytochrome C mRNA, complete cds Length = 609 Score = 280 bits (141), Expect = 5e-72 Identities = 250/285 (87%), Gaps = 1/285 (0%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| | ||| ||||||||||| |||||||| || |||| |||||||||||||| Sbjct: 410 cttcaggtaggaaataagatcagcacgctcctgtggttt-ttcaacccagggaagaccat 352 Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctc 440 ||||||| |||| ||||||||||| |||||||||| ||||||||| || ||||| || || Sbjct: 351 cttggtttcagggatgtacttcttaggattaagcaggtagtcataaagtgtgttttcttc 292 Query: 441 ccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccga 500 ||| ||||||| |||||||||| |||| ||||||||| ||||||| |||||| || || Sbjct: 291 ccagatcacagccatgttcttgttggccgtagagtaggaataaccaggggtggtacctga 232 Query: 501 ctgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgac 560 |||||| ||||||||||||| |||||||||||||||||||||||| |||||| |||||| Sbjct: 231 ctgccttccaaacagaccattcaagtttggaccttgcttgtggccggcgcccttgtcgac 172 Query: 561 ggtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605 |||||||||||| ||||||||||| ||||||||||| ||||||| Sbjct: 171 ggtgtggcactgggcgcacttggttttgaagatcttctcgccggc 127
>dbj|D21275.1|RICSS393 Oryza sativa SS393 mRNA for cytochrome c, partial sequence Length = 344 Score = 278 bits (140), Expect = 2e-71 Identities = 216/240 (90%), Gaps = 1/240 (0%) Strand = Plus / Minus Query: 367 ccagggaagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatac 426 |||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||| Sbjct: 327 ccagggaagaccatcttggttccagggatgtacttcttaggattaagcaggtagtcataa 268 Query: 427 agagtgttctcctcccactccac-agccttgttcttgtttgccgcagagtaggagtaacc 485 || |||||||||||||| ||| |||| |||||||||| |||| ||||||||| ||||| Sbjct: 267 agtgtgttctcctcccagatcacnagccatgttcttgttggccgtagagtaggaataacc 208 Query: 486 agcggtggtgcccgactgcctcccaaacagaccatgcaagtttggaccttgcttgtggcc 545 || |||||| || |||||||| ||||||||||||| |||||||||||||||||||||||| Sbjct: 207 aggggtggtacctgactgccttccaaacagaccattcaagtttggaccttgcttgtggcc 148 Query: 546 cgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605 |||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||| Sbjct: 147 ggcgcccttgtcgacggtgtggcactgggcgcacttggtcttgaagatcttctcgccggc 88
>gb|AF031540.1|AF031540 Fritillaria agrestis cytochrome C (cytC) mRNA, complete cds Length = 570 Score = 262 bits (132), Expect = 1e-66 Identities = 246/284 (86%) Strand = Plus / Minus Query: 313 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccaggg 372 ||||||| ||| ||||| ||||| || || || || || ||||||||||||||||||||| Sbjct: 386 gtggcttccttgaggtaagcaatcaggtccgctcgatcttgtggcttcttcagaccaggg 327 Query: 373 aagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtg 432 || ||||||||||| |||||||| |||||||| ||||| |||||||| |||||||||||| Sbjct: 326 aacaccatcttggtaccaggaatatacttcttaggattgagcaagtaatcatacagagtg 267 Query: 433 ttctcctcccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtg 492 ||||| ||||| | ||| ||||||||||| || ||||||||||| || || ||||| || Sbjct: 266 ttctcatcccaattcaccgccttgttcttattcgccgcagagtacgaatacccagccgta 207 Query: 493 gtgcccgactgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgccc 552 |||||||| |||||||| || || || | ||| || |||||||||||||| || |||||| Sbjct: 206 gtgcccgattgcctcccgaaaagcccgttcaaattcggaccttgcttgtgaccggcgccc 147 Query: 553 gcgtcgacggtgtggcactgcgcgcacttggtcttgaagatctt 596 |||||||||||||||||||||||||||||||||||||||||| Sbjct: 146 ttgtcgacggtgtggcactgcgcgcacttggtcttgaagatctt 103
>dbj|D10421.1|RICT76 Oryza sativa mRNA for cytochrome C (T76 gene), partial sequence Length = 241 Score = 178 bits (90), Expect = 1e-41 Identities = 171/198 (86%), Gaps = 1/198 (0%) Strand = Plus / Minus Query: 408 attaagcaagtagtcatacagagtgttctcctcccactccacagccttgttcttgtttgc 467 |||||||| ||||||||| || |||||||||||| | ||||||| |||||||||| || Sbjct: 241 attaagcaggtagtcataaagtgtgttctcctccaagatcacagccatgttcttgttggc 182 Query: 468 cgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagaccatgcaagtt 527 | ||||||||| |||| || |||||| | |||||||| |||||||||| || |||||| Sbjct: 181 ngnagagtaggaataacnaggggtggtacntgactgccttccaaacagacaattcaagtt 122 Query: 528 tggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtctt 587 |||||||||||||| ||| |||||| |||||||||||||||||| |||||||||||||| Sbjct: 121 tggaccttgcttgt-gccggcgcccttgtcgacggtgtggcactgggcgcacttggtctt 63 Query: 588 gaagatcttggcgccggc 605 ||||||||| ||||||| Sbjct: 62 gaagatcttctcgccggc 45
>ref|NM_102130.2| Arabidopsis thaliana electron carrier/ electron transporter AT1G22840 mRNA, complete cds Length = 727 Score = 159 bits (80), Expect = 1e-35 Identities = 227/276 (82%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| ||||| Sbjct: 418 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 359 Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctc 440 |||||| || || |||||||||||||| || |||||||| || |||| | ||||| || Sbjct: 358 cttggtacctggtatgtacttcttggggttgagcaagtaatcgtacaaggccttctcttc 299 Query: 441 ccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccga 500 ||| |||||||| ||||||||||| || |||||||| ||||||||||| || || || || Sbjct: 298 ccattccacagctttgttcttgttagcagcagagtaagagtaaccagcagttgtaccaga 239 Query: 501 ctgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgac 560 || || ||||| ||||| | | || || ||||| ||||| || ||||| || ||||| Sbjct: 238 ttgtcttccaaatagaccgtttagattgggtccttgtttgtgaccggcgcctgcttcgac 179 Query: 561 ggtgtggcactgcgcgcacttggtcttgaagatctt 596 |||||| ||||| || ||||||||| |||||||||| Sbjct: 178 ggtgtgacactgagcacacttggtcctgaagatctt 143
>gb|AY114580.1| Arabidopsis thaliana cytochrome C (At1g22840) mRNA, complete cds Length = 475 Score = 159 bits (80), Expect = 1e-35 Identities = 227/276 (82%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| ||||| Sbjct: 324 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 265 Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctc 440 |||||| || || |||||||||||||| || |||||||| || |||| | ||||| || Sbjct: 264 cttggtacctggtatgtacttcttggggttgagcaagtaatcgtacaaggccttctcttc 205 Query: 441 ccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccga 500 ||| |||||||| ||||||||||| || |||||||| ||||||||||| || || || || Sbjct: 204 ccattccacagctttgttcttgttagcagcagagtaagagtaaccagcagttgtaccaga 145 Query: 501 ctgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgac 560 || || ||||| ||||| | | || || ||||| ||||| || ||||| || ||||| Sbjct: 144 ttgtcttccaaatagaccgtttagattgggtccttgtttgtgaccggcgcctgcttcgac 85 Query: 561 ggtgtggcactgcgcgcacttggtcttgaagatctt 596 |||||| ||||| || ||||||||| |||||||||| Sbjct: 84 ggtgtgacactgagcacacttggtcctgaagatctt 49
>gb|AY062853.1| Arabidopsis thaliana cytochrome C (At1g22840; F19G10.20) mRNA, complete cds Length = 619 Score = 159 bits (80), Expect = 1e-35 Identities = 227/276 (82%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| ||||| Sbjct: 411 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 352 Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctc 440 |||||| || || |||||||||||||| || |||||||| || |||| | ||||| || Sbjct: 351 cttggtacctggtatgtacttcttggggttgagcaagtaatcgtacaaggccttctcttc 292 Query: 441 ccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccga 500 ||| |||||||| ||||||||||| || |||||||| ||||||||||| || || || || Sbjct: 291 ccattccacagctttgttcttgttagcagcagagtaagagtaaccagcagttgtaccaga 232 Query: 501 ctgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgac 560 || || ||||| ||||| | | || || ||||| ||||| || ||||| || ||||| Sbjct: 231 ttgtcttccaaatagaccgtttagattgggtccttgtttgtgaccggcgcctgcttcgac 172 Query: 561 ggtgtggcactgcgcgcacttggtcttgaagatctt 596 |||||| ||||| || ||||||||| |||||||||| Sbjct: 171 ggtgtgacactgagcacacttggtcctgaagatctt 136
>gb|AY087108.1| Arabidopsis thaliana clone 31770 mRNA, complete sequence Length = 627 Score = 159 bits (80), Expect = 1e-35 Identities = 227/276 (82%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| ||||| Sbjct: 418 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 359 Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctc 440 |||||| || || |||||||||||||| || |||||||| || |||| | ||||| || Sbjct: 358 cttggtacctggtatgtacttcttggggttgagcaagtaatcgtacaaggccttctcttc 299 Query: 441 ccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccga 500 ||| |||||||| ||||||||||| || |||||||| ||||||||||| || || || || Sbjct: 298 ccattccacagctttgttcttgttagcagcagagtaagagtaaccagcagttgtaccaga 239 Query: 501 ctgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgac 560 || || ||||| ||||| | | || || ||||| ||||| || ||||| || ||||| Sbjct: 238 ttgtcttccaaatagaccgtttagattgggtccttgtttgtgaccggcgcctgcttcgac 179 Query: 561 ggtgtggcactgcgcgcacttggtcttgaagatctt 596 |||||| ||||| || ||||||||| |||||||||| Sbjct: 178 ggtgtgacactgagcacacttggtcctgaagatctt 143
>emb|AJ539068.1|NTA539068 Nicotiana tabacum cDNA-AFLP-fragment BT42-M1-010 Length = 450 Score = 157 bits (79), Expect = 5e-35 Identities = 163/191 (85%) Strand = Plus / Minus Query: 322 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381 |||||||| |||||||| || ||||| |||||||||||||||| ||||||||| |||||| Sbjct: 269 ttcaggtaggcaatgaggtctgcacgctcctgtggcttcttcaaaccagggaaaaccatc 210 Query: 382 ttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctcc 441 || |||||||| |||||||||||||| || ||||| || ||||||| ||| || || ||| Sbjct: 209 tttgttccaggtatgtacttcttggggttgagcaaataatcatacaaagtcttttcttcc 150 Query: 442 cactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgac 501 ||| ||||||| | ||||| || || |||||||||||||||||||| || || || ||| Sbjct: 149 cacatcacagccatattcttattggcagcagagtaggagtaaccagcagtagttccagac 90 Query: 502 tgcctcccaaa 512 ||||| ||||| Sbjct: 89 tgccttccaaa 79
>gb|AY466606.1| Helianthus annuus cytochrome c mRNA, complete cds Length = 684 Score = 153 bits (77), Expect = 8e-34 Identities = 227/277 (81%) Strand = Plus / Minus Query: 320 tcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagacca 379 |||||| ||| ||||||||||| ||||| ||||||||||| ||| | || ||||| |||| Sbjct: 443 tcttcaagtatgcaatgagatctgcacgctcctgtggctttttcggtcctgggaaaacca 384 Query: 380 tcttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcct 439 |||| |||||||| ||||||||||| || || | ||||||||| |||| |||||| |||| Sbjct: 383 tctttgttccagggatgtacttcttcgggttcaacaagtagtcgtacaaagtgttttcct 324 Query: 440 cccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccg 499 |||| || |||||||||||||| | |||||||| || || ||||| ||||| || | Sbjct: 323 cccagataactgccttgttcttgttaccagcagagtaagaatatccagcagtggttccag 264 Query: 500 actgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcga 559 ||||||| |||||||| |||| | ||| || ||||| ||||| || ||||| |||| Sbjct: 263 actgccttccaaacagtccatttaggttgggtccttgtttgtgaccagcgcctttctcga 204 Query: 560 cggtgtggcactgcgcgcacttggtcttgaagatctt 596 ||||||| || || |||||||| |||||||||||||| Sbjct: 203 cggtgtgacattgagcgcactttgtcttgaagatctt 167
>gb|L77113.1|HNNCYTC Helianthus annuus L. cytochrome c (cytc1) mRNA, complete cds Length = 559 Score = 145 bits (73), Expect = 2e-31 Identities = 226/277 (81%) Strand = Plus / Minus Query: 320 tcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagacca 379 |||||| ||| ||||||||||| ||||| ||||||||||| || | || ||||| |||| Sbjct: 335 tcttcaagtatgcaatgagatctgcacgctcctgtggcttttttaagcctgggaaaacca 276 Query: 380 tcttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcct 439 |||| |||||||| ||||||||||| || || | ||||||||| |||| |||||| |||| Sbjct: 275 tctttgttccagggatgtacttcttcgggttcaacaagtagtcgtacaaagtgttttcct 216 Query: 440 cccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccg 499 |||| || |||||||||||||| | |||||||| || || ||||| ||||| || | Sbjct: 215 cccagataactgccttgttcttgttaccagcagagtaagaatatccagcagtggttccag 156 Query: 500 actgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcga 559 ||||||| |||||||| |||| | ||| || ||||| ||||| || ||||| |||| Sbjct: 155 actgccttccaaacagtccatttaggttgggcccttgtttgtgaccagcgcctttctcga 96 Query: 560 cggtgtggcactgcgcgcacttggtcttgaagatctt 596 ||||||| || || |||||||| |||||||||||||| Sbjct: 95 cggtgtgacattgagcgcactttgtcttgaagatctt 59
>gb|AC137623.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0426G01, complete sequence Length = 173074 Score = 143 bits (72), Expect = 8e-31 Identities = 120/136 (88%) Strand = Plus / Minus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458 |||||| |||||||||| ||||||||| || |||||||||||||| ||||||| |||| Sbjct: 158696 cttcttaggattaagcaggtagtcataaagtgtgttctcctcccagatcacagccatgtt 158637 Query: 459 cttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagacc 518 |||||| |||| ||||||||| ||||||| |||||| || |||||||| ||||||||||| Sbjct: 158636 cttgttggccgtagagtaggaataaccaggggtggtacctgactgccttccaaacagacc 158577 Query: 519 atgcaagtttggacct 534 || ||||||||||||| Sbjct: 158576 attcaagtttggacct 158561 Score = 109 bits (55), Expect = 1e-20 Identities = 82/91 (90%) Strand = Plus / Minus Query: 310 gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369 ||||| |||| ||||||||| | ||| ||||||||||| |||||||||||||||| ||| Sbjct: 159501 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 159442 Query: 370 gggaagaccatcttggttccaggaatgtact 400 ||||||||||||||||||||||| ||||||| Sbjct: 159441 gggaagaccatcttggttccagggatgtact 159411 Score = 101 bits (51), Expect = 3e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 531 accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590 ||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||| Sbjct: 157742 accttgcttgtggccggcgcccttgtcgacggtgtggcactgggcgcacttggtcttgaa 157683 Query: 591 gatcttggcgccggc 605 |||||| ||||||| Sbjct: 157682 gatcttctcgccggc 157668 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 caagataattgtctcgtggat 201 ||||||||||||||||||||| Sbjct: 159626 caagataattgtctcgtggat 159606
>gb|AC124836.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0092E21, complete sequence Length = 132649 Score = 143 bits (72), Expect = 8e-31 Identities = 120/136 (88%) Strand = Plus / Minus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458 |||||| |||||||||| ||||||||| || |||||||||||||| ||||||| |||| Sbjct: 30430 cttcttaggattaagcaggtagtcataaagtgtgttctcctcccagatcacagccatgtt 30371 Query: 459 cttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagacc 518 |||||| |||| ||||||||| ||||||| |||||| || |||||||| ||||||||||| Sbjct: 30370 cttgttggccgtagagtaggaataaccaggggtggtacctgactgccttccaaacagacc 30311 Query: 519 atgcaagtttggacct 534 || ||||||||||||| Sbjct: 30310 attcaagtttggacct 30295 Score = 109 bits (55), Expect = 1e-20 Identities = 82/91 (90%) Strand = Plus / Minus Query: 310 gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369 ||||| |||| ||||||||| | ||| ||||||||||| |||||||||||||||| ||| Sbjct: 31235 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 31176 Query: 370 gggaagaccatcttggttccaggaatgtact 400 ||||||||||||||||||||||| ||||||| Sbjct: 31175 gggaagaccatcttggttccagggatgtact 31145 Score = 101 bits (51), Expect = 3e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 531 accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590 ||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||| Sbjct: 29476 accttgcttgtggccggcgcccttgtcgacggtgtggcactgggcgcacttggtcttgaa 29417 Query: 591 gatcttggcgccggc 605 |||||| ||||||| Sbjct: 29416 gatcttctcgccggc 29402 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 caagataattgtctcgtggat 201 ||||||||||||||||||||| Sbjct: 31360 caagataattgtctcgtggat 31340
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 143 bits (72), Expect = 8e-31 Identities = 120/136 (88%) Strand = Plus / Minus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458 |||||| |||||||||| ||||||||| || |||||||||||||| ||||||| |||| Sbjct: 20486951 cttcttaggattaagcaggtagtcataaagtgtgttctcctcccagatcacagccatgtt 20486892 Query: 459 cttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagacc 518 |||||| |||| ||||||||| ||||||| |||||| || |||||||| ||||||||||| Sbjct: 20486891 cttgttggccgtagagtaggaataaccaggggtggtacctgactgccttccaaacagacc 20486832 Query: 519 atgcaagtttggacct 534 || ||||||||||||| Sbjct: 20486831 attcaagtttggacct 20486816 Score = 109 bits (55), Expect = 1e-20 Identities = 82/91 (90%) Strand = Plus / Minus Query: 310 gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369 ||||| |||| ||||||||| | ||| ||||||||||| |||||||||||||||| ||| Sbjct: 20487756 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 20487697 Query: 370 gggaagaccatcttggttccaggaatgtact 400 ||||||||||||||||||||||| ||||||| Sbjct: 20487696 gggaagaccatcttggttccagggatgtact 20487666 Score = 101 bits (51), Expect = 3e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 531 accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590 ||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||| Sbjct: 20485997 accttgcttgtggccggcgcccttgtcgacggtgtggcactgggcgcacttggtcttgaa 20485938 Query: 591 gatcttggcgccggc 605 |||||| ||||||| Sbjct: 20485937 gatcttctcgccggc 20485923 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 caagataattgtctcgtggat 201 ||||||||||||||||||||| Sbjct: 20487881 caagataattgtctcgtggat 20487861
>gb|M63704.1|RICCYTC Rice cytochrome c (OsCc-1) gene, complete cds Length = 2408 Score = 143 bits (72), Expect = 8e-31 Identities = 120/136 (88%) Strand = Plus / Minus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458 |||||| |||||||||| ||||||||| || |||||||||||||| ||||||| |||| Sbjct: 1382 cttcttaggattaagcaggtagtcataaagtgtgttctcctcccagatcacagccatgtt 1323 Query: 459 cttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagacc 518 |||||| |||| ||||||||| ||||||| |||||| || |||||||| ||||||||||| Sbjct: 1322 cttgttggccgtagagtaggaataaccaggggtggtacctgactgccttccaaacagacc 1263 Query: 519 atgcaagtttggacct 534 || ||||||||||||| Sbjct: 1262 attcaagtttggacct 1247 Score = 109 bits (55), Expect = 1e-20 Identities = 82/91 (90%) Strand = Plus / Minus Query: 310 gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369 ||||| |||| ||||||||| | ||| ||||||||||| |||||||||||||||| ||| Sbjct: 2219 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 2160 Query: 370 gggaagaccatcttggttccaggaatgtact 400 ||||||||||||||||||||||| ||||||| Sbjct: 2159 gggaagaccatcttggttccagggatgtact 2129 Score = 101 bits (51), Expect = 3e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 531 accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590 ||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||| Sbjct: 433 accttgcttgtggccggcgcccttgtcgacggtgtggcactgggcgcacttggtcttgaa 374 Query: 591 gatcttggcgccggc 605 |||||| ||||||| Sbjct: 373 gatcttctcgccggc 359 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 caagataattgtctcgtggat 201 ||||||||||||||||||||| Sbjct: 2344 caagataattgtctcgtggat 2324
>ref|XM_463549.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 336 Score = 113 bits (57), Expect = 7e-22 Identities = 113/131 (86%), Gaps = 3/131 (2%) Strand = Plus / Minus Query: 313 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccaggg 372 ||||| ||||||||||| || ||||||||||||||||||||||||| |||||| ||| | Sbjct: 329 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcagtccattg 270 Query: 373 aagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtg 432 || ||||||||| ||||| |||||||||| ||| |||||| ||||||||||| |||| Sbjct: 269 aaccccatcttgg---caggagtgtacttcttaggagtaagcaggtagtcatacaaagtg 213 Query: 433 ttctcctccca 443 ||||| ||||| Sbjct: 212 ttctcttccca 202 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Minus Query: 502 tgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacg 561 ||||||||||||| ||| | ||||||||| || ||||||||||| ||| || ||||||| Sbjct: 143 tgcctcccaaacaaaccgttcaagtttggcccatgcttgtggccggcggccttgtcgacg 84 Query: 562 gtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605 | ||||| | ||||||||||||| |||||||||| ||||||| Sbjct: 83 gcatggcagtacgcgcacttggtcctgaagatcttctcgccggc 40
>dbj|AK121662.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033064H20, full insert sequence Length = 696 Score = 113 bits (57), Expect = 7e-22 Identities = 113/131 (86%), Gaps = 3/131 (2%) Strand = Plus / Minus Query: 313 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccaggg 372 ||||| ||||||||||| || ||||||||||||||||||||||||| |||||| ||| | Sbjct: 402 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcagtccattg 343 Query: 373 aagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtg 432 || ||||||||| ||||| |||||||||| ||| |||||| ||||||||||| |||| Sbjct: 342 aaccccatcttgg---caggagtgtacttcttaggagtaagcaggtagtcatacaaagtg 286 Query: 433 ttctcctccca 443 ||||| ||||| Sbjct: 285 ttctcttccca 275 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Minus Query: 502 tgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacg 561 ||||||||||||| ||| | ||||||||| || ||||||||||| ||| || ||||||| Sbjct: 216 tgcctcccaaacaaaccgttcaagtttggcccatgcttgtggccggcggccttgtcgacg 157 Query: 562 gtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605 | ||||| | ||||||||||||| |||||||||| ||||||| Sbjct: 156 gcatggcagtacgcgcacttggtcctgaagatcttctcgccggc 113
>gb|AF101422.1|AF101422 Cichorium intybus cytochrome mRNA, partial cds Length = 336 Score = 95.6 bits (48), Expect = 2e-16 Identities = 216/272 (79%) Strand = Plus / Minus Query: 325 aggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttg 384 ||||| ||||| ||||| ||||| || || ||||| ||||| || ||||| |||||||| Sbjct: 320 aggtatgcaataagatctgcacgctcttgaggctttttcagtcctgggaaaaccatcttt 261 Query: 385 gttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccac 444 |||||||| |||||||||||||| || |||| ||||||||||| || || |||||||| Sbjct: 260 gttccagggatgtacttcttggggttgagcaggtagtcatacaatgtattttcctcccat 201 Query: 445 tccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgc 504 || |||||| ||||| || ||||| || ||||| ||||| || || || |||||| Sbjct: 200 gtaaccgccttggatttgttagcagcagaataagagtatccagcagtcgttccagactgc 141 Query: 505 ctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtg 564 || ||||| || |||| | || || ||||| |||||||| ||||| ||||||||| Sbjct: 140 cttccaaatagtccattaagattgggtccttgtttgtggccggcgcctttctcgacggtg 81 Query: 565 tggcactgcgcgcacttggtcttgaagatctt 596 || || || ||||| || |||||||||||||| Sbjct: 80 tgacattgagcgcatttagtcttgaagatctt 49
>gb|AC155340.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone KBrH020D15, complete sequence Length = 143633 Score = 95.6 bits (48), Expect = 2e-16 Identities = 72/80 (90%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||| ||| || ||||||||||||||||| || |||||||| || |||||||||||||| Sbjct: 102836 cttcaagtaggcgatgagatcagcacggtcttgaggcttcttgagcccagggaagaccat 102895 Query: 381 cttggttccaggaatgtact 400 ||| |||||||||||||||| Sbjct: 102896 cttcgttccaggaatgtact 102915 Score = 87.7 bits (44), Expect = 4e-14 Identities = 101/120 (84%) Strand = Plus / Plus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458 ||||||||| || |||||||| || |||| || ||||| ||||| |||||||| ||||| Sbjct: 103005 cttcttggggttgagcaagtaatcgtacaaggtcttctcttcccattccacagctttgtt 103064 Query: 459 cttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagacc 518 |||||| || |||||||| ||||||||||| || || || ||||| || ||||||||||| Sbjct: 103065 cttgttagcagcagagtaagagtaaccagctgttgttccagactgtcttccaaacagacc 103124 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 555 gtcgacggtgtggcactgcgcgcacttggtcttgaagatctt 596 |||||||||||| ||||| || ||||||||| |||||||||| Sbjct: 103473 gtcgacggtgtgacactgagcacacttggtcctgaagatctt 103514
>dbj|AK060676.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-B03, full insert sequence Length = 295 Score = 91.7 bits (46), Expect = 3e-15 Identities = 96/112 (85%), Gaps = 3/112 (2%) Strand = Plus / Minus Query: 313 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccaggg 372 ||||| ||||||||||| || ||||||||||||||||||||||||| |||||| ||| | Sbjct: 109 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcagtccattg 50 Query: 373 aagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcat 424 || ||||||||| ||||| |||||||||| ||| |||||| |||||||| Sbjct: 49 aaccccatcttgg---caggagtgtacttcttaggagtaagcaggtagtcat 1
>gb|AC142095.9| Medicago truncatula clone mth2-14c17, complete sequence Length = 110037 Score = 81.8 bits (41), Expect = 2e-12 Identities = 71/81 (87%) Strand = Plus / Plus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458 ||||||||| || |||||||| ||||||| || || |||||||| |||||||||||||| Sbjct: 58340 cttcttggggttcagcaagtaatcatacaaggtcttttcctcccaatccacagccttgtt 58399 Query: 459 cttgtttgccgcagagtagga 479 |||||| |||||||| ||||| Sbjct: 58400 cttgttggccgcagaatagga 58420 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 531 accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590 |||||| |||||||| ||||| |||||||||||||||||| ||||||||||| |||| Sbjct: 59819 accttgtttgtggccggcgcctttgtcgacggtgtggcactgagcgcacttggttctgaa 59878 Query: 591 gatcttggcgccggcg 606 |||||| |||||||| Sbjct: 59879 gatcttctcgccggcg 59894 Score = 54.0 bits (27), Expect = 6e-04 Identities = 66/79 (83%) Strand = Plus / Plus Query: 322 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381 ||||| || ||||| ||||||||||| || || |||||||| |||||||| || |||||| Sbjct: 58014 ttcagatatgcaataagatcagcacgttcttgaggcttcttaagaccaggaaaaaccatc 58073 Query: 382 ttggttccaggaatgtact 400 || || || || ||||||| Sbjct: 58074 tttgtccctgggatgtact 58092
>gb|AC171534.4| Medicago truncatula chromosome 7 BAC clone mth2-90a20, complete sequence Length = 88903 Score = 81.8 bits (41), Expect = 2e-12 Identities = 71/81 (87%) Strand = Plus / Plus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458 ||||||||| || |||||||| ||||||| || || |||||||| |||||||||||||| Sbjct: 80291 cttcttggggttcagcaagtaatcatacaaggtcttttcctcccaatccacagccttgtt 80350 Query: 459 cttgtttgccgcagagtagga 479 |||||| |||||||| ||||| Sbjct: 80351 cttgttggccgcagaatagga 80371 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 531 accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590 |||||| |||||||| ||||| |||||||||||||||||| ||||||||||| |||| Sbjct: 81770 accttgtttgtggccggcgcctttgtcgacggtgtggcactgagcgcacttggttctgaa 81829 Query: 591 gatcttggcgccggcg 606 |||||| |||||||| Sbjct: 81830 gatcttctcgccggcg 81845 Score = 54.0 bits (27), Expect = 6e-04 Identities = 66/79 (83%) Strand = Plus / Plus Query: 322 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381 ||||| || ||||| ||||||||||| || || |||||||| |||||||| || |||||| Sbjct: 79965 ttcagatatgcaataagatcagcacgttcttgaggcttcttaagaccaggaaaaaccatc 80024 Query: 382 ttggttccaggaatgtact 400 || || || || ||||||| Sbjct: 80025 tttgtccctgggatgtact 80043
>ref|NM_117072.2| Arabidopsis thaliana electron carrier/ electron transporter AT4G10040 mRNA, complete cds Length = 647 Score = 77.8 bits (39), Expect = 4e-11 Identities = 207/263 (78%) Strand = Plus / Minus Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393 |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| Sbjct: 396 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 337 Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453 ||||||||||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| Sbjct: 336 atgtacttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 277 Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513 || | ||||| || |||||||| || || || | || || || || || || |||||| Sbjct: 276 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 217 Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573 | |||| ||| || || ||||| ||||| || || || ||||||||||| ||||| Sbjct: 216 aatccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactga 157 Query: 574 gcgcacttggtcttgaagatctt 596 ||||||||||| |||||||||| Sbjct: 156 gcgcacttggttctgaagatctt 134
>gb|AY079373.1| Arabidopsis thaliana putative cytochrome c protein (At4g10040) mRNA, complete cds Length = 370 Score = 77.8 bits (39), Expect = 4e-11 Identities = 207/263 (78%) Strand = Plus / Minus Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393 |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| Sbjct: 311 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 252 Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453 ||||||||||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| Sbjct: 251 atgtacttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 192 Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513 || | ||||| || |||||||| || || || | || || || || || || |||||| Sbjct: 191 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 132 Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573 | |||| ||| || || ||||| ||||| || || || ||||||||||| ||||| Sbjct: 131 aatccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactga 72 Query: 574 gcgcacttggtcttgaagatctt 596 ||||||||||| |||||||||| Sbjct: 71 gcgcacttggttctgaagatctt 49
>gb|AY045944.1| Arabidopsis thaliana putative cytochrome c protein (At4g10040) mRNA, complete cds Length = 664 Score = 77.8 bits (39), Expect = 4e-11 Identities = 207/263 (78%) Strand = Plus / Minus Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393 |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| Sbjct: 396 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 337 Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453 ||||||||||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| Sbjct: 336 atgtacttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 277 Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513 || | ||||| || |||||||| || || || | || || || || || || |||||| Sbjct: 276 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 217 Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573 | |||| ||| || || ||||| ||||| || || || ||||||||||| ||||| Sbjct: 216 aatccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactga 157 Query: 574 gcgcacttggtcttgaagatctt 596 ||||||||||| |||||||||| Sbjct: 156 gcgcacttggttctgaagatctt 134
>emb|BX828516.1|CNS0A2QS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL10ZG07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 580 Score = 77.8 bits (39), Expect = 4e-11 Identities = 207/263 (78%) Strand = Plus / Minus Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393 |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| Sbjct: 350 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 291 Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453 ||||||||||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| Sbjct: 290 atgtacttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 231 Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513 || | ||||| || |||||||| || || || | || || || || || || |||||| Sbjct: 230 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 171 Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573 | |||| ||| || || ||||| ||||| || || || ||||||||||| ||||| Sbjct: 170 aatccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactga 111 Query: 574 gcgcacttggtcttgaagatctt 596 ||||||||||| |||||||||| Sbjct: 110 gcgcacttggttctgaagatctt 88
>gb|AY087056.1| Arabidopsis thaliana clone 31115 mRNA, complete sequence Length = 616 Score = 77.8 bits (39), Expect = 4e-11 Identities = 207/263 (78%) Strand = Plus / Minus Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393 |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| Sbjct: 389 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 330 Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453 ||||||||||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| Sbjct: 329 atgtacttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 270 Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513 || | ||||| || |||||||| || || || | || || || || || || |||||| Sbjct: 269 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 210 Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573 | |||| ||| || || ||||| ||||| || || || ||||||||||| ||||| Sbjct: 209 aatccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactga 150 Query: 574 gcgcacttggtcttgaagatctt 596 ||||||||||| |||||||||| Sbjct: 149 gcgcacttggttctgaagatctt 127
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 313 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 365 ||||| ||||||||||| || ||||||||||||||||||||||||| |||||| Sbjct: 38439384 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 38439332 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 535 tgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatc 594 ||||||||||| ||| || |||||||| ||||| | ||||||||||||| |||||||| Sbjct: 38437067 tgcttgtggccggcggccttgtcgacggcatggcagtacgcgcacttggtcctgaagatc 38437008 Query: 595 ttggcgccggc 605 || ||||||| Sbjct: 38437007 ttctcgccggc 38436997 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctccca 443 |||||| ||| |||||| ||||||||||| ||||||||| ||||| Sbjct: 38438300 cttcttaggagtaagcaggtagtcatacaaagtgttctcttccca 38438256
>gb|AF229199.1|AF229199 Oryza sativa chromosome 1 clone OSJNBa0048I01, complete sequence Length = 193444 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 313 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 365 ||||| ||||||||||| || ||||||||||||||||||||||||| |||||| Sbjct: 32481 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 32429 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 535 tgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatc 594 ||||||||||| ||| || |||||||| ||||| | ||||||||||||| |||||||| Sbjct: 30164 tgcttgtggccggcggccttgtcgacggcatggcagtacgcgcacttggtcctgaagatc 30105 Query: 595 ttggcgccggc 605 || ||||||| Sbjct: 30104 ttctcgccggc 30094 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctccca 443 |||||| ||| |||||| ||||||||||| ||||||||| ||||| Sbjct: 31397 cttcttaggagtaagcaggtagtcatacaaagtgttctcttccca 31353
>dbj|AP003379.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0408G07 Length = 126631 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 313 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 365 ||||| ||||||||||| || ||||||||||||||||||||||||| |||||| Sbjct: 24799 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 24747 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 535 tgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatc 594 ||||||||||| ||| || |||||||| ||||| | ||||||||||||| |||||||| Sbjct: 22482 tgcttgtggccggcggccttgtcgacggcatggcagtacgcgcacttggtcctgaagatc 22423 Query: 595 ttggcgccggc 605 || ||||||| Sbjct: 22422 ttctcgccggc 22412 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctccca 443 |||||| ||| |||||| ||||||||||| ||||||||| ||||| Sbjct: 23715 cttcttaggagtaagcaggtagtcatacaaagtgttctcttccca 23671
>gb|M35173.1|CRECYCA C.reinhardtii mitochondrial apocytochrome c (cyc) mRNA, complete cds Length = 662 Score = 73.8 bits (37), Expect = 6e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| ||||| ||||| || || |||| ||||||||||| |||| ||| ||||| Sbjct: 365 cttcaggtaggcaatcagatcggcgcgctcctcgggcttcttcaggccagcgaacaccat 306 Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctc 437 |||| | ||||| |||||||||||||| || |||| ||| || || |||||| |||| Sbjct: 305 cttgttgccaggcatgtacttcttggggttcagcaggtactcgtagagagtgctctc 249 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 564 gtggcactgcgcgcacttggtcttgaagatctt 596 |||||| |||||||||||||||||||| ||||| Sbjct: 122 gtggcattgcgcgcacttggtcttgaaaatctt 90
>gb|AF000657.1|ATAF000657 Arabidopsis thaliana BAC F19G10, complete sequence Length = 92948 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| ||||| Sbjct: 90776 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 90835 Query: 381 cttggttccaggaatgtact 400 |||||| || || ||||||| Sbjct: 90836 cttggtacctggtatgtact 90855 Score = 67.9 bits (34), Expect = 4e-08 Identities = 76/90 (84%) Strand = Plus / Plus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458 ||||||||| || |||||||| || |||| | ||||| ||||| |||||||| ||||| Sbjct: 90933 cttcttggggttgagcaagtaatcgtacaaggccttctcttcccattccacagctttgtt 90992 Query: 459 cttgtttgccgcagagtaggagtaaccagc 488 |||||| || |||||||| ||||||||||| Sbjct: 90993 cttgttagcagcagagtaagagtaaccagc 91022 Score = 60.0 bits (30), Expect = 9e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 531 accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590 |||||| ||||| || ||||| || ||||||||||| ||||| || ||||||||| |||| Sbjct: 91544 accttgtttgtgaccggcgcctgcttcgacggtgtgacactgagcacacttggtcctgaa 91603 Query: 591 gatctt 596 |||||| Sbjct: 91604 gatctt 91609
>emb|BX826474.1|CNS0A37Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB2ZB01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 540 Score = 69.9 bits (35), Expect = 9e-09 Identities = 206/263 (78%) Strand = Plus / Minus Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393 |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| Sbjct: 290 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 231 Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453 |||||| |||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| Sbjct: 230 atgtacgtcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 171 Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513 || | ||||| || |||||||| || || || | || || || || || || |||||| Sbjct: 170 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 111 Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573 | |||| ||| || || ||||| ||||| || || || ||||||||||| ||||| Sbjct: 110 aagccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactgt 51 Query: 574 gcgcacttggtcttgaagatctt 596 ||||||||||| |||||||||| Sbjct: 50 gcgcacttggttctgaagatctt 28
>ref|NM_102131.3| Arabidopsis thaliana unknown protein AT1G22850 mRNA, complete cds Length = 1563 Score = 63.9 bits (32), Expect = 6e-07 Identities = 56/64 (87%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| ||||| Sbjct: 1500 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 1559 Query: 381 cttg 384 |||| Sbjct: 1560 cttg 1563
>gb|AY431227.1| Aedes aegypti ASAP ID: 35977 cyctochrome c mRNA sequence Length = 1095 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 322 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381 |||||||| || |||||||| ||||| || | ||||||||||| |||| ||||| |||| Sbjct: 420 ttcaggtaagcgatgagatcggcacgctcattgggcttcttcaggccagcgaagatcatc 361 Query: 382 ttggttccaggaatgtacttctt 404 || || ||||| ||||||||||| Sbjct: 360 ttcgtgccagggatgtacttctt 338
>gb|DQ440105.1| Aedes aegypti clone AE-442 mitochondrial cytochrome c mRNA, complete cds; nuclear gene for mitochondrial product Length = 327 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 322 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381 |||||||| || |||||||| ||||| || | ||||||||||| |||| ||||| |||| Sbjct: 311 ttcaggtaagcgatgagatcggcacgctcattgggcttcttcaggccagcgaagatcatc 252 Query: 382 ttggttccaggaatgtacttctt 404 || || ||||| ||||||||||| Sbjct: 251 ttcgtgccagggatgtacttctt 229
>ref|XM_567012.1| Cryptococcus neoformans var. neoformans JEC21 electron carrier (CNA06950) partial mRNA Length = 482 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||| ||||||| ||| |||||||||| |||||||||||||||||||| Sbjct: 335 cttcttgagaccagcaaaggccatcttggtaccaggaatgtacttcttggg 285
>emb|CR937943.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YP13AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 785 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 322 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381 |||||||| || |||||||| ||||| || | ||||||||||| |||| ||||| |||| Sbjct: 414 ttcaggtaagcgatgagatcggcacgctcgttgggcttcttcaggccagcgaagatcatc 355 Query: 382 ttggttccaggaatgtacttctt 404 || || ||||| ||||||||||| Sbjct: 354 ttcgtgccagggatgtacttctt 332
>gb|DQ122874.1| Chlamydomonas incerta mitochondrial apocytochrome c (CYC) mRNA, complete cds; nuclear gene for mitochondrial product Length = 609 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttgggattaagc 414 ||||||||||| |||| ||| ||||||||| | || || |||||||||||||| || ||| Sbjct: 305 ggcttcttcaggccagcgaacaccatcttgttgccgggcatgtacttcttggggttcagc 246 Query: 415 aagtagtcatacagagtgttctc 437 | ||| || ||||||||| |||| Sbjct: 245 aggtactcgtacagagtgctctc 223 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 564 gtggcactgcgcgcacttggtcttgaagatctt 596 |||||| |||||||||||||||||||| ||||| Sbjct: 96 gtggcattgcgcgcacttggtcttgaaaatctt 64
>gb|DQ176429.1| Capra hircus mitochondrial cytochrome c mRNA, partial cds; nuclear gene for mitochondrial product Length = 315 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| ||||||||||||||| ||||||||||||||||| Sbjct: 245 aagatcatcttggttccagggatgtacttcttgggatt 208
>emb|X59459.1|ATATCC1G A.thaliana AtCc-1 gene for cytochrome c Length = 1263 Score = 60.0 bits (30), Expect = 9e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 346 cggtcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttg 405 ||||||| |||||||| |||||| |||| |||||||||| || ||||||||||||||| Sbjct: 634 cggtccttgggcttcttgagaccaccgaaggccatcttggtaccgggaatgtacttcttg 575 Query: 406 gg 407 || Sbjct: 574 gg 573
>gb|M85253.1|ATHATCC1A Arabidoposis thaliana AtCc-1 DNA, complete cds Length = 1264 Score = 60.0 bits (30), Expect = 9e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 346 cggtcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttg 405 ||||||| |||||||| |||||| |||| |||||||||| || ||||||||||||||| Sbjct: 634 cggtccttgggcttcttgagaccaccgaaggccatcttggtaccgggaatgtacttcttg 575 Query: 406 gg 407 || Sbjct: 574 gg 573
>gb|AY071701.1| Drosophila melanogaster RH17228 full insert cDNA Length = 763 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||||||||||| | ||||| ||||||||| || || |||||||||||||| Sbjct: 422 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 370
>ref|XM_971011.1| PREDICTED: Tribolium castaneum similar to CG17903-PA, transcript variant 2 (LOC659690), mRNA Length = 685 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||||||||||||| ||||||||| || ||||| || ||||| |||||||| Sbjct: 327 ggcttcttcagaccagcgaagaccatttttgttccggggatgtatttcttggg 275 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||| |||||||||||||||||| Sbjct: 126 tcgacagtgtggcactgcgcgcac 103
>ref|XM_962134.1| PREDICTED: Tribolium castaneum similar to CG17903-PA, transcript variant 1 (LOC659690), mRNA Length = 823 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||||||||||||| ||||||||| || ||||| || ||||| |||||||| Sbjct: 465 ggcttcttcagaccagcgaagaccatttttgttccggggatgtatttcttggg 413 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||| |||||||||||||||||| Sbjct: 264 tcgacagtgtggcactgcgcgcac 241
>emb|X01760.1|DMCYCDC4 Drosophila melanogaster cytochrome c gene DC4 Length = 1559 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||||||||||| | ||||| ||||||||| || || |||||||||||||| Sbjct: 1045 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 993
>ref|NM_057828.3| Drosophila melanogaster Cytochrome c proximal CG17903-RA (Cyt-c-p), mRNA Length = 754 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||||||||||| | ||||| ||||||||| || || |||||||||||||| Sbjct: 422 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 370
>gb|AC093097.1| Drosophila melanogaster, chromosome 2L, region 36A-36B, BAC clone BACR26O03, complete sequence Length = 175413 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||||||||||| | ||||| ||||||||| || || |||||||||||||| Sbjct: 95417 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 95365
>gb|AC006214.1|AC006214 Drosophila melanogaster, chromosome 2L, region 36A7-36A13, P1 clones DS04680 and DS00592, complete sequence Length = 129779 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||||||||||| | ||||| ||||||||| || || |||||||||||||| Sbjct: 127326 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 127274
>gb|AE003652.2| Drosophila melanogaster chromosome 2L, section 61 of 83 of the complete sequence Length = 262525 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||||||||||| | ||||| ||||||||| || || |||||||||||||| Sbjct: 106451 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 106399
>gb|M11381.1|DROCYCE D.melanogaster cytochrome C gene Length = 1015 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||||||||||| | ||||| ||||||||| || || |||||||||||||| Sbjct: 621 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 569
>emb|BX071915.1|CNS09RNJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 727 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 786 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 787 cttcgtgccggggatgtacttctt 810 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 962 tcgacggtgtggcactgggcgcac 985
>emb|BX069282.1|CNS09PME Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1030 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 742 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 801 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 802 cttcgtgccggggatgtacttctt 825 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 977 tcgacggtgtggcactgggcgcac 1000
>emb|BX068476.1|CNS09P00 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 713 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 772 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 773 cttcgtgccggggatgtacttctt 796
>emb|BX068178.1|CNS09ORQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 735 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 794 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 795 cttcgtgccggggatgtacttctt 818
>emb|BX067682.1|CNS09ODY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1039 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 715 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 774 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 775 cttcgtgccggggatgtacttctt 798 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 950 tcgacggtgtggcactgggcgcac 973
>emb|BX066463.1|CNS09NG3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 723 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 782 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 783 cttcgtgccggggatgtacttctt 806
>emb|BX064703.1|CNS09M37 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48AH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 258 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 62 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 121 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 122 cttcgtgccggggatgtacttctt 145
>emb|BX062557.1|CNS09KFL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43DF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 730 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 789 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 790 cttcgtgccggggatgtacttctt 813
>emb|BX061603.1|CNS09JP3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42CB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 709 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 768 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 769 cttcgtgccggggatgtacttctt 792
>emb|BX060541.1|CNS09IVL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 715 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 774 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 775 cttcgtgccggggatgtacttctt 798
>emb|BX060188.1|CNS09ILS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 716 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 775 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 776 cttcgtgccggggatgtacttctt 799
>emb|BX058941.1|CNS09HN5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 716 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 775 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 776 cttcgtgccggggatgtacttctt 799 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 951 tcgacggtgtggcactgggcgcac 974
>emb|BX058045.1|CNS09GY9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 721 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 780 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 781 cttcgtgccggggatgtacttctt 804
>emb|BX058044.1|CNS09GY8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 995 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 344 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 285 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 284 cttcgtgccggggatgtacttctt 261 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 109 tcgacggtgtggcactgggcgcac 86
>emb|BX057320.1|CNS09GE4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37AH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 735 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 794 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 795 cttcgtgccggggatgtacttctt 818
>emb|BX057317.1|CNS09GE1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 400 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 341 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 340 cttcgtgccggggatgtacttctt 317 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 165 tcgacggtgtggcactgggcgcac 142
>emb|BX055390.1|CNS09EWI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 708 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 767 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 768 cttcgtgccggggatgtacttctt 791
>emb|BX055389.1|CNS09EWH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 394 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 335 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 334 cttcgtgccggggatgtacttctt 311 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 159 tcgacggtgtggcactgggcgcac 136
>emb|BX053158.1|CNS09D6I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 639 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 344 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 285 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 284 cttcgtgccggggatgtacttctt 261 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 109 tcgacggtgtggcactgggcgcac 86
>emb|BX052789.1|CNS09CW9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 708 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 767 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 768 cttcgtgccggggatgtacttctt 791
>emb|BX030987.1|CNS08W2N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA46BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 926 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 735 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 794 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 795 cttcgtgccggggatgtacttctt 818
>emb|BX043390.1|CNS095N6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC15DH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 740 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 799 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 800 cttcgtgccggggatgtacttctt 823
>emb|BX043132.1|CNS095G0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC15CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 595 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 373 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 432 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 433 cttcgtgccggggatgtacttctt 456
>emb|BX040506.1|CNS093F2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC11BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 677 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 524 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 583 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 584 cttcgtgccggggatgtacttctt 607
>emb|BX039822.1|CNS092W2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10BC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 708 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 767 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 768 cttcgtgccggggatgtacttctt 791
>emb|BX039821.1|CNS092W1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC10BC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 345 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 286 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 285 cttcgtgccggggatgtacttctt 262
>emb|BX036850.1|CNS090LI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 717 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 776 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 777 cttcgtgccggggatgtacttctt 800 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 952 tcgacggtgtggcactgggcgcac 975
>emb|BX036056.1|CNS08ZZG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 371 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 262 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 321 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 322 cttcgtgccggggatgtacttctt 345
>emb|BX036052.1|CNS08ZZC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7CG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 714 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 773 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 774 cttcgtgccggggatgtacttctt 797
>emb|BX035216.1|CNS08ZC4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA6BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 700 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 759 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 760 cttcgtgccggggatgtacttctt 783
>emb|BX032226.1|CNS08X12 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA48AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 737 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 796 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 797 cttcgtgccggggatgtacttctt 820 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 972 tcgacggtgtggcactgggcgcac 995
>emb|BX031975.1|CNS08WU3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47CE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 892 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 713 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 772 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 773 cttcgtgccggggatgtacttctt 796
>emb|BX030340.1|CNS08VKO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA45BB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 709 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 768 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 769 cttcgtgccggggatgtacttctt 792
>emb|BX027835.1|CNS08TN3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 704 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 763 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 764 cttcgtgccggggatgtacttctt 787
>emb|BX026220.1|CNS08SE8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA4BF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 846 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 678 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 737 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 738 cttcgtgccggggatgtacttctt 761
>emb|BX024107.1|CNS08QRJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA36DB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 668 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 727 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 728 cttcgtgccggggatgtacttctt 751
>emb|BX024106.1|CNS08QRI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA36DB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 433 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 217 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 158 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 157 cttcgtgccggggatgtacttctt 134
>emb|BX023752.1|CNS08QHO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA36BB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 876 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 753 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 812 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 813 cttcgtgccggggatgtacttctt 836
>emb|BX019497.1|CNS08N7H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA29DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 841 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 728 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 787 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 788 cttcgtgccggggatgtacttctt 811
>emb|BX018904.1|CNS08MR0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA28CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 715 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 774 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 775 cttcgtgccggggatgtacttctt 798
>emb|BX018903.1|CNS08MQZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA28CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 785 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 307 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 248 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 247 cttcgtgccggggatgtacttctt 224 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 72 tcgacggtgtggcactgggcgcac 49
>emb|BX017251.1|CNS08LH3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA25DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 504 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 298 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 239 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 238 cttcgtgccggggatgtacttctt 215 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 63 tcgacggtgtggcactgggcgcac 40
>emb|BX015930.1|CNS08KGE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA23DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 712 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 771 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 772 cttcgtgccggggatgtacttctt 795
>emb|BX015215.1|CNS08JWJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA22DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 886 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 727 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 786 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 787 cttcgtgccggggatgtacttctt 810
>emb|BX010251.1|CNS08G2N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA16CA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 678 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 737 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 738 cttcgtgccggggatgtacttctt 761 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 913 tcgacggtgtggcactgggcgcac 936
>emb|BX007964.1|CNS08EB4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA13AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1001 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 721 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 780 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 781 cttcgtgccggggatgtacttctt 804 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 956 tcgacggtgtggcactgggcgcac 979
>dbj|AK121277.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108A04, full insert sequence Length = 781 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 349 tcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtact 400 ||||| ||||||||||| || ||||| ||||||||||| || |||||||||| Sbjct: 564 tcctgcggcttcttcaggccggggaacaccatcttggtgcccggaatgtact 513 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 562 gtgtggcactgcgcgcacttggtcttgaagatctt 596 |||||||||||||||||||||||| ||||||||| Sbjct: 202 gtgtggcactgcgcgcacttggtccggaagatctt 168
>ref|XM_310154.2| Anopheles gambiae str. PEST ENSANGP00000020091 (ENSANGG00000017602), mRNA Length = 1083 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 407 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 348 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 347 cttcgtgccggggatgtacttctt 324 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 172 tcgacggtgtggcactgggcgcac 149
>ref|XM_951393.1| Neurospora crassa OR74A CYTOCHROME C (NCU01808.1) partial mRNA Length = 357 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||| |||||| |||| |||||||||| ||||| |||||||||||||| Sbjct: 276 cttcttgagaccaccgaaggccatcttggtaccagggatgtacttcttggg 226
>ref|XM_328246.1| Neurospora crassa OR74A CYTOCHROME C (NCU01808.1) partial mRNA Length = 357 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||| |||||| |||| |||||||||| ||||| |||||||||||||| Sbjct: 276 cttcttgagaccaccgaaggccatcttggtaccagggatgtacttcttggg 226
>emb|BX036717.1|CNS090HT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA8DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 270 Score = 54.0 bits (27), Expect = 6e-04 Identities = 54/63 (85%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| ||||| ||||| Sbjct: 193 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggggaacaccat 252 Query: 381 ctt 383 ||| Sbjct: 253 ctt 255
>emb|BX012845.1|CNS08I2P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 54.0 bits (27), Expect = 6e-04 Identities = 54/63 (85%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| ||||| ||||| Sbjct: 727 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggggaacaccat 786 Query: 381 ctt 383 ||| Sbjct: 787 ctt 789
>emb|Z99829.1|CRCYC1GEN Chlamydomonas reinhardtii CYC1 gene encoding cytochrome c Length = 3078 Score = 54.0 bits (27), Expect = 6e-04 Identities = 66/79 (83%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| ||||| ||||| || || |||| ||||||||||| |||| ||| ||||| Sbjct: 2540 cttcaggtaggcaatcagatcggcgcgctcctcgggcttcttcaggccagcgaacaccat 2481 Query: 381 cttggttccaggaatgtac 399 |||| | ||||| |||||| Sbjct: 2480 cttgttgccaggcatgtac 2462 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 564 gtggcactgcgcgcacttggtcttgaagatctt 596 |||||| |||||||||||||||||||| ||||| Sbjct: 1916 gtggcattgcgcgcacttggtcttgaaaatctt 1884
>emb|X05506.1|NCCYTCR N.crassa mRNA for cytochrome c Length = 665 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||| |||||| |||| |||||||||| ||||| |||||||||||||| Sbjct: 381 cttcttgagaccaccgaaggccatcttggtaccagggatgtacttcttggg 331
>emb|AL669998.1|NCB1K11 Neurospora crassa DNA linkage group II BAC clone B1K11 Length = 88013 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||| |||||| |||| |||||||||| ||||| |||||||||||||| Sbjct: 5251 cttcttgagaccaccgaaggccatcttggtaccagggatgtacttcttggg 5301
>dbj|AB085853.1| Rosellinia necatrix cytc gene for cytochrome c, complete cds Length = 1692 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||| |||||| |||| |||||||||| ||||| |||||||||||||| Sbjct: 1161 cttcttgagaccaccgaaggccatcttggtgccagggatgtacttcttggg 1111
>gb|L19358.1|NEUCYTOC Neurospora crassa cytochrome c (cyc-1) gene, complete cds including cyc-1-12 mutation Length = 1465 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||| |||||| |||| |||||||||| ||||| |||||||||||||| Sbjct: 1221 cttcttgagaccaccgaaggccatcttggtaccagggatgtacttcttggg 1171
>ref|XM_587961.2| PREDICTED: Bos taurus similar to Cytochrome c, somatic (LOC510767), mRNA Length = 1386 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| |||||||| ||||||||||||||||| Sbjct: 359 aagatcatctttgttccagggatgtacttcttgggatt 322
>gb|BC074190.1| Xenopus laevis MGC82081 protein, mRNA (cDNA clone MGC:82081 IMAGE:7011609), complete cds Length = 668 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| |||||||||||||||||||| ||||| Sbjct: 296 aagatcatctttgttccaggaatgtacttcttaggatt 259
>ref|XM_583465.2| PREDICTED: Bos taurus similar to Cytochrome c, somatic (LOC506941), mRNA Length = 911 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| |||||||| ||||||||||||||||| Sbjct: 311 aagatcatctttgttccagggatgtacttcttgggatt 274
>gb|BC059740.1| Xenopus tropicalis cytochrome c, testis, mRNA (cDNA clone MGC:75709 IMAGE:5380711), complete cds Length = 758 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| |||||||||||||||||||| ||||| Sbjct: 421 aagatcatctttgttccaggaatgtacttcttaggatt 384
>gb|BC105397.1| Bos taurus similar to Cytochrome c, somatic, mRNA (cDNA clone MGC:128356 IMAGE:7987141), complete cds Length = 992 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| |||||||| ||||||||||||||||| Sbjct: 379 aagatcatctttgttccagggatgtacttcttgggatt 342
>ref|NM_203564.1| Xenopus tropicalis cytochrome c, testis (cyct), mRNA Length = 758 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| |||||||||||||||||||| ||||| Sbjct: 421 aagatcatctttgttccaggaatgtacttcttaggatt 384
>emb|CR760663.2| Xenopus tropicalis finished cDNA, clone TEgg084a23 Length = 594 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| |||||||||||||||||||| ||||| Sbjct: 277 aagatcatctttgttccaggaatgtacttcttaggatt 240
>emb|AJ416378.1|PSP416378 Polytomella sp. 'Pringsheim 198.80' mRNA for mitochondrial cytochrome c (cyc gene) Length = 643 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 564 gtggcactgcgcgcacttggtcttgaagatctt 596 ||||||||| ||||||||||||||||| ||||| Sbjct: 118 gtggcactgagcgcacttggtcttgaaaatctt 86
>emb|BX033449.1|CNS08XZ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 50.1 bits (25), Expect = 0.009 Identities = 52/61 (85%) Strand = Plus / Plus Query: 344 cacggtcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttct 403 |||| |||| ||||||||||||||| | ||| |||||||| || || || |||||||||| Sbjct: 690 cacgctcctttggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttct 749 Query: 404 t 404 | Sbjct: 750 t 750 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 902 tcgacggtgtggcactgggcgcac 925
>emb|AL161516.2|ATCHRIV28 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 28 Length = 198005 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcacttggtcttgaagatctt 596 ||||||||||| ||||| ||||||||||| |||||||||| Sbjct: 102405 tcgacggtgtgacactgagcgcacttggttctgaagatctt 102365 Score = 44.1 bits (22), Expect = 0.53 Identities = 64/78 (82%) Strand = Plus / Minus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458 |||||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| || | Sbjct: 102751 cttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagccatgct 102692 Query: 459 cttgtttgccgcagagta 476 ||||| || |||||||| Sbjct: 102691 tttgttagcagcagagta 102674
>emb|AL049487.1|ATF28M11 Arabidopsis thaliana DNA chromosome 4, BAC clone F28M11 (ESSA project) Length = 85907 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcacttggtcttgaagatctt 596 ||||||||||| ||||| ||||||||||| |||||||||| Sbjct: 4045 tcgacggtgtgacactgagcgcacttggttctgaagatctt 4005 Score = 44.1 bits (22), Expect = 0.53 Identities = 64/78 (82%) Strand = Plus / Minus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458 |||||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| || | Sbjct: 4391 cttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagccatgct 4332 Query: 459 cttgtttgccgcagagta 476 ||||| || |||||||| Sbjct: 4331 tttgttagcagcagagta 4314
>emb|AL049481.1|ATT5L19 Arabidopsis thaliana DNA chromosome 4, BAC clone T5L19 (ESSA project) Length = 92495 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcacttggtcttgaagatctt 596 ||||||||||| ||||| ||||||||||| |||||||||| Sbjct: 62977 tcgacggtgtgacactgagcgcacttggttctgaagatctt 62937 Score = 44.1 bits (22), Expect = 0.53 Identities = 64/78 (82%) Strand = Plus / Minus Query: 399 cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458 |||||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| || | Sbjct: 63323 cttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagccatgct 63264 Query: 459 cttgtttgccgcagagta 476 ||||| || |||||||| Sbjct: 63263 tttgttagcagcagagta 63246
>gb|DQ084330.1| Dermacentor variabilis clone 2 cytochrome C mRNA, complete cds; mitochondrial Length = 409 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtactt 401 |||||| || |||| ||||||||||||||| || ||||||||||| Sbjct: 325 cttcttgaggccagcgaagaccatcttggtgcccggaatgtactt 281
>gb|DQ084329.1| Dermacentor variabilis clone 1 cytochrome C mRNA, complete cds; mitochondrial Length = 480 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtactt 401 |||||| || |||| ||||||||||||||| || ||||||||||| Sbjct: 396 cttcttgaggccagcgaagaccatcttggtgcccggaatgtactt 352
>gb|AF038611.2| Caenorhabditis elegans cosmid E04A4, complete sequence Length = 23046 Score = 48.1 bits (24), Expect = 0.034 Identities = 42/48 (87%) Strand = Plus / Plus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||| || |||| ||| |||||||||||||| || ||||||||||| Sbjct: 21380 cttcttgagtccagcgaacaccatcttggttcctgggatgtacttctt 21427
>gb|AY559323.1| Pichia pastoris cytochrome c (CYC1) gene, complete cds Length = 333 Score = 48.1 bits (24), Expect = 0.034 Identities = 27/28 (96%) Strand = Plus / Minus Query: 377 ccatcttggttccaggaatgtacttctt 404 ||||||||||||| |||||||||||||| Sbjct: 262 ccatcttggttcctggaatgtacttctt 235
>ref|XM_532493.2| PREDICTED: Canis familiaris similar to Cytochrome c, somatic (LOC475258), mRNA Length = 1321 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Minus Query: 367 ccagggaagaccatcttggttccaggaatgtacttcttgggatt 410 |||| ||||| ||| || |||||||| ||||||||||||||||| Sbjct: 382 ccagcgaagatcatttttgttccagggatgtacttcttgggatt 339
>emb|BX053121.1|CNS09D5H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 438 Score = 48.1 bits (24), Expect = 0.034 Identities = 69/84 (82%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| | ||| |||||||||||||| | ||| ||||| Sbjct: 337 cttcaggtaggcgatcagatcgccacgcttctgcggcttcttcagaccggcgaacaccat 278 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 277 cttcgtgccggggatgtacttctt 254 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 102 tcgacggtgtggcactgggcgcac 79
>emb|BX054543.1|CNS09E8Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32DA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 808 Score = 48.1 bits (24), Expect = 0.034 Identities = 48/56 (85%) Strand = Plus / Plus Query: 349 tcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 ||||| |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 733 tcctgcggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 788
>emb|BX054542.1|CNS09E8Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32DA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 560 Score = 48.1 bits (24), Expect = 0.034 Identities = 48/56 (85%) Strand = Plus / Minus Query: 349 tcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 ||||| |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 318 tcctgcggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 263 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 111 tcgacggtgtggcactgggcgcac 88
>emb|BX045253.1|CNS0972X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC19BC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 332 Score = 48.1 bits (24), Expect = 0.034 Identities = 69/84 (82%) Strand = Plus / Minus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| | ||| |||||||||||||| | ||| ||||| Sbjct: 326 cttcaggtaggcgatcagatcgccacgcttctgcggcttcttcagaccggcgaacaccat 267 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 266 cttcgtgccggggatgtacttctt 243
>emb|BX022008.1|CNS08P58 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA32CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 389 Score = 48.1 bits (24), Expect = 0.034 Identities = 69/84 (82%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||| ||||||| | ||| ||||| Sbjct: 198 cttcaggtaggcgatcagatcgccacgctcctgcggcttcctcagaccggcgaacaccat 257 Query: 381 cttggttccaggaatgtacttctt 404 ||| || || || ||||||||||| Sbjct: 258 cttcgtgccggggatgtacttctt 281
>ref|NM_073755.2| Caenorhabditis elegans ZC116.2 (ZC116.2) mRNA, complete cds Length = 390 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Minus Query: 358 ttcttcagaccagggaagaccatcttggttccaggaatgtactt 401 ||||||| ||||| |||||||||||| ||||| || |||||||| Sbjct: 305 ttcttcaaaccagcgaagaccatcttagttccggggatgtactt 262
>ref|NM_068228.3| Caenorhabditis elegans E04A4.7 (E04A4.7) mRNA, complete cds Length = 525 Score = 48.1 bits (24), Expect = 0.034 Identities = 42/48 (87%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||| || |||| ||| |||||||||||||| || ||||||||||| Sbjct: 329 cttcttgagtccagcgaacaccatcttggttcctgggatgtacttctt 282
>gb|AY864613.1| Sus scrofa cytochrome c-like protein mRNA, complete cds Length = 1327 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Minus Query: 367 ccagggaagaccatcttggttccaggaatgtacttcttgggatt 410 |||| ||||| ||| || |||||||| ||||||||||||||||| Sbjct: 341 ccagcgaagatcatttttgttccagggatgtacttcttgggatt 298
>gb|AY610503.1| Sus scrofa clone rptbr0104_o5.y1.abd, mRNA sequence Length = 566 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Minus Query: 367 ccagggaagaccatcttggttccaggaatgtacttcttgggatt 410 |||| ||||| ||| || |||||||| ||||||||||||||||| Sbjct: 364 ccagcgaagatcatttttgttccagggatgtacttcttgggatt 321
>gb|AY610281.1| Sus scrofa clone rcki23_k5.y1.abd, mRNA sequence Length = 565 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Minus Query: 367 ccagggaagaccatcttggttccaggaatgtacttcttgggatt 410 |||| ||||| ||| || |||||||| ||||||||||||||||| Sbjct: 294 ccagcgaagatcatttttgttccagggatgtacttcttgggatt 251
>ref|XM_750550.1| Aspergillus fumigatus Af293 cytochrome c (Afu2g13110) partial mRNA Length = 708 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||||||| |||| |||||||||| || || ||| |||||||||| Sbjct: 453 cttcttcagaccaccgaaggccatcttggtaccggggatgaacttcttggg 403
>ref|XM_391057.1| Gibberella zeae PH-1 chromosome 3 CYC_NEUCR Cytochrome c (FG10881.1) partial mRNA Length = 330 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| ||| |||| |||||||||| || || |||||||||||||| Sbjct: 279 cttcttcaggccaccgaaggccatcttggtaccggggatgtacttcttggg 229
>emb|CR732655.1|CNS0GS9G Tetraodon nigroviridis full-length cDNA Length = 1192 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttggg 407 |||| ||| |||||||||||||| ||||||||||| Sbjct: 306 aagatcattttggttccaggaatatacttcttggg 272
>emb|CR685667.2|CNS0FS0F Tetraodon nigroviridis full-length cDNA Length = 1202 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttggg 407 |||| ||| |||||||||||||| ||||||||||| Sbjct: 320 aagatcattttggttccaggaatatacttcttggg 286
>emb|CR682724.1|CNS0FPQO Tetraodon nigroviridis full-length cDNA Length = 1218 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttggg 407 |||| ||| |||||||||||||| ||||||||||| Sbjct: 354 aagatcattttggttccaggaatatacttcttggg 320
>emb|CR675102.2|CNS0FJVO Tetraodon nigroviridis full-length cDNA Length = 1144 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttggg 407 |||| ||| |||||||||||||| ||||||||||| Sbjct: 241 aagatcattttggttccaggaatatacttcttggg 207
>emb|CR673433.2|CNS0FILB Tetraodon nigroviridis full-length cDNA Length = 1156 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttggg 407 |||| ||| |||||||||||||| ||||||||||| Sbjct: 254 aagatcattttggttccaggaatatacttcttggg 220
>ref|XM_502612.1| Yarrowia lipolytica CLIB122, YALI0D09273g predicted mRNA Length = 324 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 377 ccatcttggttccaggaatgtacttcttggg 407 |||||||||| || ||||||||||||||||| Sbjct: 256 ccatcttggtaccgggaatgtacttcttggg 226
>gb|AF091484.1| Tigriopus californicus isolate SD18 cytochrome c (CYC) gene, CYC-1 allele, complete cds Length = 803 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 732 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 682
>gb|AF091483.1| Tigriopus californicus isolate SD16 cytochrome c (CYC) gene, CYC-2 allele, complete cds Length = 860 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 786 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 736
>gb|AF091482.1| Tigriopus californicus isolate SD16 cytochrome c (CYC) gene, CYC-1 allele, complete cds Length = 855 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 781 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 731
>gb|AF091481.1| Tigriopus californicus isolate SD15 cytochrome c (CYC) gene, partial cds Length = 799 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 727 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 677
>gb|AF091480.1| Tigriopus californicus isolate SD12 cytochrome c (CYC) gene, partial cds Length = 790 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 727 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 677
>gb|AF091479.1| Tigriopus californicus isolate SD11 cytochrome c (CYC) gene, partial cds Length = 798 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 727 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 677
>gb|AF091478.1| Tigriopus californicus isolate SC17 cytochrome c (CYC) gene, complete cds Length = 874 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 813 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 763
>gb|AF091477.1| Tigriopus californicus isolate SC16 cytochrome c (CYC) gene, CYC-2 allele, partial cds Length = 867 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 799 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 749
>gb|AF091476.1| Tigriopus californicus isolate SC16 cytochrome c (CYC) gene, CYC-1 allele, partial cds Length = 870 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 805 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 755
>gb|AF091475.1| Tigriopus californicus isolate SC15 cytochrome c (CYC) gene, partial cds Length = 878 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 808 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 758
>gb|AF091474.1| Tigriopus californicus isolate SC14 cytochrome c (CYC) gene, partial cds Length = 877 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 808 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 758
>gb|AF091473.1| Tigriopus californicus isolate SC13 cytochrome c (CYC) gene, CYC-2 allele, complete cds Length = 887 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 813 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 763
>gb|AF091472.1| Tigriopus californicus isolate SC13 cytochrome c (CYC) gene, CYC-1 allele, complete cds Length = 894 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 820 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 770
>gb|AF091471.1| Tigriopus californicus isolate CA11 cytochrome c (CYC) gene, complete cds Length = 862 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 801 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 751
>gb|AF091470.1| Tigriopus californicus isolate CA3 cytochrome c (CYC) gene, CYC-2 allele, complete cds Length = 887 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 813 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 763
>gb|AF091469.1| Tigriopus californicus isolate CA3 cytochrome c (CYC) gene, CYC-1 allele, complete cds Length = 897 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 823 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 773
>gb|AF091468.1| Tigriopus californicus isolate CA2 cytochrome c (CYC) gene, CYC-2 allele, complete cds Length = 875 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 801 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 751
>gb|AF091467.1| Tigriopus californicus isolate CA2 cytochrome c (CYC) gene, CYC-1 allele, complete cds Length = 874 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 800 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 750
>gb|AF091466.1| Tigriopus californicus isolate CA1 cytochrome c (CYC) gene, CYC-2 allele, complete cds Length = 874 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 800 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 750
>gb|AF091465.1| Tigriopus californicus isolate CA1 cytochrome c (CYC) gene, CYC-1 allele, complete cds Length = 884 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 810 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 760
>gb|AF091460.1| Tigriopus californicus cytochrome c (CYC) mRNA, complete cds Length = 537 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 ||||||||| || | ||| ||||||||||| || ||||||||||| ||||| Sbjct: 314 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 264
>emb|BX070970.1|CNS09QXA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 761 Score = 46.1 bits (23), Expect = 0.13 Identities = 53/63 (84%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 699 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 758 Query: 381 ctt 383 ||| Sbjct: 759 ctt 761
>emb|BX068625.1|CNS09P45 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 46.1 bits (23), Expect = 0.13 Identities = 53/63 (84%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| |||| |||||||||||||| ||||| ||||| Sbjct: 478 cttcaggtaggcgatcagatcgccacgctccttcggcttcttcagaccggggaacaccat 537 Query: 381 ctt 383 ||| Sbjct: 538 ctt 540
>emb|BX048689.1|CNS099QD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC23DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 588 Score = 46.1 bits (23), Expect = 0.13 Identities = 53/63 (84%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 521 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 580 Query: 381 ctt 383 ||| Sbjct: 581 ctt 583
>emb|BX026468.1|CNS08SL4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA4DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 46.1 bits (23), Expect = 0.13 Identities = 53/63 (84%) Strand = Plus / Plus Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380 ||||||||| || || ||||| |||| ||||| |||||||||||||| | ||| ||||| Sbjct: 702 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 761 Query: 381 ctt 383 ||| Sbjct: 762 ctt 764
>gb|DQ445531.1| Graphocephala atropunctata isolate WHGA0824 cytochrome c-like protein mRNA, complete cds; mitochondrial Length = 327 Score = 46.1 bits (23), Expect = 0.13 Identities = 50/59 (84%) Strand = Plus / Minus Query: 349 tcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||||| ||||| | |||| ||| |||||||| ||||| ||||| ||||||||||| Sbjct: 284 tcctgtggtttcttgatgccagcgaacaccatcttcgttcctggaatatacttcttggg 226
>dbj|AB225913.1| Aspergillus oryzae cDNA, contig sequence: AoEST2768 Length = 684 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||| |||||| |||| |||||||||| || || |||||||||||||| Sbjct: 391 cttcttgagaccaccgaaggccatcttggtaccggggatgtacttcttggg 341
>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 Length = 2324132 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Plus Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407 |||||| |||||| |||| |||||||||| || || |||||||||||||| Sbjct: 769735 cttcttgagaccaccgaaggccatcttggtaccggggatgtacttcttggg 769785
>gb|AY034827.1| Curvularia lunata cytochrome c mRNA, complete cds Length = 608 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 377 ccatcttggttccaggaatgtacttcttggg 407 |||||||||| || ||||||||||||||||| Sbjct: 327 ccatcttggtgccgggaatgtacttcttggg 297
>gb|AY918494.1| Tarsius bancanus mitochondrial cytochrome c somatic (CYCS) gene, complete cds; nuclear gene for mitochondrial product Length = 1676 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Minus Query: 372 gaagaccatcttggttccaggaatgtacttcttgggatt 410 ||||| ||| || |||||||| ||||||||||||||||| Sbjct: 1502 gaagatcatttttgttccagggatgtacttcttgggatt 1464
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 377 ccatcttggttccaggaatgtacttcttggg 407 |||||||||| || ||||||||||||||||| Sbjct: 1176930 ccatcttggtaccgggaatgtacttcttggg 1176900
>gb|M83141.1|EMECYTC Emericella nidulans cytochrome c (CYTc) gene, complete cds Length = 1312 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 377 ccatcttggttccaggaatgtacttcttggg 407 |||||||||| ||||| |||||||||||||| Sbjct: 974 ccatcttggtaccagggatgtacttcttggg 944
>ref|XM_528718.1| PREDICTED: Pan troglodytes similar to cytochrome c (LOC473347), mRNA Length = 1407 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 1334 gttccagggatgtacttcttgggatt 1309
>ref|XM_520960.1| PREDICTED: Pan troglodytes similar to cytochrome c (LOC465522), mRNA Length = 576 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 300 gttccagggatgtacttcttgggatt 275
>ref|XM_519702.1| PREDICTED: Pan troglodytes similar to cytochrome c (LOC464105), mRNA Length = 1272 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 299 gttccagggatgtacttcttgggatt 274
>ref|XM_519001.1| PREDICTED: Pan troglodytes similar to Chromosome 7 open reading frame 31 (LOC463297), mRNA Length = 2591 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 2213 gttccagggatgtacttcttgggatt 2188
>ref|XM_518413.1| PREDICTED: Pan troglodytes similar to cytochrome c (LOC462623), mRNA Length = 600 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 290 gttccagggatgtacttcttgggatt 265
>ref|XM_524863.1| PREDICTED: Pan troglodytes LOC469480 (LOC469480), mRNA Length = 333 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 236 gttccagggatgtacttcttgggatt 211
>gb|BC021994.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:24510 IMAGE:4096609), complete cds Length = 1295 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 309 gttccagggatgtacttcttgggatt 284
>gb|AY440406.1| Armigeres subalbatus ASAP ID: 39155 cytochrome c mRNA sequence Length = 888 Score = 44.1 bits (22), Expect = 0.53 Identities = 65/80 (81%) Strand = Plus / Minus Query: 325 aggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttg 384 ||||| || |||||||| ||||| || | ||||| |||||||| | |||| |||||| Sbjct: 494 aggtatgcgatgagatcggcacgctcgttgggctttttcagaccggcraagatcatcttc 435 Query: 385 gttccaggaatgtacttctt 404 || ||||| ||||||||||| Sbjct: 434 gtgccagggatgtacttctt 415
>ref|XM_370188.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein (MG06685.4) partial mRNA Length = 654 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 553 gcgtcgacggtgtggcactgcgcgca 578 ||||||||||||||||||||| |||| Sbjct: 407 gcgtcgacggtgtggcactgctcgca 382
>gb|BC070346.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:88352 IMAGE:3826017), complete cds Length = 1279 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 306 gttccagggatgtacttcttgggatt 281
>gb|BC070156.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:88136 IMAGE:6451982), complete cds Length = 1269 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 305 gttccagggatgtacttcttgggatt 280
>gb|BC067222.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:72005 IMAGE:3685258), complete cds Length = 1019 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 309 gttccagggatgtacttcttgggatt 284
>gb|BC016006.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:27280 IMAGE:4656402), complete cds Length = 1284 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 309 gttccagggatgtacttcttgggatt 284
>gb|BC022330.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:22759 IMAGE:4280695), complete cds Length = 1018 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 305 gttccagggatgtacttcttgggatt 280
>gb|BC008477.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:14765 IMAGE:4290897), complete cds Length = 1288 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 305 gttccagggatgtacttcttgggatt 280
>gb|BC008475.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:14760 IMAGE:4284529), complete cds Length = 1283 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 305 gttccagggatgtacttcttgggatt 280
>gb|AC183376.4| Pan troglodytes BAC clone CH251-735O6 from chromosome 13, complete sequence Length = 188255 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Plus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||||||||||||| ||||||| Sbjct: 94812 gttccaggaatgtacttcctgggatt 94837
>gb|DQ481668.1| Takifugu rubripes HoxDa gene cluster, complete sequence Length = 366816 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Plus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| ||||| |||||||| ||||||||||| Sbjct: 311095 aagatcatctttgttcctggaatgtatttcttgggatt 311132
>gb|DQ176430.1| Bubalus bubalis mitochondrial cytochrome c mRNA, partial cds; nuclear gene for mitochondrial product Length = 315 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 233 gttccagggatgtacttcttgggatt 208
>gb|AC183388.3| Pan troglodytes BAC clone CH251-53D20 from chromosome 16, complete sequence Length = 161327 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 70460 gttccagggatgtacttcttgggatt 70435
>gb|AC183528.2| Pan troglodytes BAC clone CH251-737P22 from chromosome 13, complete sequence Length = 202694 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Plus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||||||||||||| ||||||| Sbjct: 85498 gttccaggaatgtacttcctgggatt 85523
>gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-249B10, complete sequence Length = 213633 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 101039 gttccagggatgtacttcttgggatt 101014
>gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, complete sequence Length = 215866 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Plus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 114822 gttccagggatgtacttcttgggatt 114847
>emb|CR722155.2|CNS0GK5T Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| || || |||||||||||||||||||| Sbjct: 332 aagatcatctttgtccctggaatgtacttcttgggatt 295
>emb|CR721647.2|CNS0GJRP Tetraodon nigroviridis full-length cDNA Length = 731 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| || || |||||||||||||||||||| Sbjct: 299 aagatcatctttgtccctggaatgtacttcttgggatt 262
>emb|CR710570.2|CNS0GB86 Tetraodon nigroviridis full-length cDNA Length = 789 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| || || |||||||||||||||||||| Sbjct: 374 aagatcatctttgtccctggaatgtacttcttgggatt 337
>gb|AC007487.2| Homo sapiens BAC clone CTA-232J20 from 7, complete sequence Length = 23179 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Plus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 21896 gttccagggatgtacttcttgggatt 21921
>emb|CR677377.2|CNS0FLML Tetraodon nigroviridis full-length cDNA Length = 805 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| || || |||||||||||||||||||| Sbjct: 352 aagatcatctttgtccctggaatgtacttcttgggatt 315
>emb|CR669860.1|CNS0FFU2 Tetraodon nigroviridis full-length cDNA Length = 1080 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 382 ttggttccaggaatgtacttcttggg 407 |||||||||||||| ||||||||||| Sbjct: 215 ttggttccaggaatatacttcttggg 190
>emb|CR657236.2|CNS0F63E Tetraodon nigroviridis full-length cDNA Length = 766 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410 |||| |||||| || || |||||||||||||||||||| Sbjct: 333 aagatcatctttgtccctggaatgtacttcttgggatt 296
>gb|AC142296.1| Pan troglodytes BAC clone RP43-97L1 from Y, complete sequence Length = 158231 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Plus Query: 385 gttccaggaatgtacttcttgggatt 410 ||||||| |||||||||||||||||| Sbjct: 33381 gttccagcaatgtacttcttgggatt 33406
>gb|AC146549.8| Medicago truncatula clone mth2-7p18, complete sequence Length = 96612 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Plus Query: 93 ttttccagcaactgaatcaaaa 114 |||||||||||||||||||||| Sbjct: 89901 ttttccagcaactgaatcaaaa 89922
>gb|AC146709.11| Medicago truncatula clone mth2-90m14, complete sequence Length = 110472 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Plus Query: 93 ttttccagcaactgaatcaaaa 114 |||||||||||||||||||||| Sbjct: 51396 ttttccagcaactgaatcaaaa 51417 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Plus Query: 93 ttttccagcaactgaatcaaaa 114 |||||||||||||||||||||| Sbjct: 36211 ttttccagcaactgaatcaaaa 36232
>emb|AL589762.16| Human DNA sequence from clone RP11-396D18 on chromosome 1 Contains the 5' end of the PPP1R12B gene for protein phosphatase 1 regulatory (inhibitor) subunit 12B and a somatic cytochrome c (CYCS) pseudogene, complete sequence Length = 74089 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Plus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 11283 gttccagggatgtacttcttgggatt 11308
>emb|AL590064.9| Human DNA sequence from clone RP11-471M10 on chromosome 13 Contains part of a novel gene similar to TPTE and PTEN homologous inositol lipid phosphatase (TPIP), a TPIP pseudogene and a cytochrome C (HCS) pseudogene, complete sequence Length = 73766 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Plus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 40141 gttccagggatgtacttcttgggatt 40166
>emb|AL590076.4| Human DNA sequence from clone RP11-408K19 on chromosome 13 Contains the gene for TPTE and PTEN homologous inositol lipid phosphatase (TPIP) and a cytochrome c (HCS) pseudogene, complete sequence Length = 119330 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Plus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||||||||||||| ||||||| Sbjct: 42295 gttccaggaatgtacttcctgggatt 42320
>emb|AL360020.15| Human DNA sequence from clone RP11-490F3 on chromosome 9 Contains a cytochrome C pseudogene, the gene for protein tyrosine phosphatase PTP9Q22 and a CpG island, complete sequence Length = 158710 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 56919 gttccagggatgtacttcttgggatt 56894
>emb|AL357080.13| Human DNA sequence from clone RP11-432L12 on chromosome 6 Contains STSs and GSSs, complete sequence Length = 172073 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Plus Query: 227 ctattaatgtctaatcttattatttt 252 |||||||||||||| ||||||||||| Sbjct: 67056 ctattaatgtctaaacttattatttt 67081
>emb|AL359763.9| Human DNA sequence from clone RP11-169O17 on chromosome 13 Contains a cytochrome c pseudogene, a novel gene, the ADPRTL1 gene for ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like protein 1 , part of a TPTE and PTEN homologous inositol lipid phosphatase (TPIP) pseudogene and four CpG islands, complete sequence Length = 190765 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||||||||||||| ||||||| Sbjct: 69277 gttccaggaatgtacttcctgggatt 69252
>gb|AF533200.1| Homo sapiens isolate HCP39 chromosome 16 cytochrome c pseudogene, complete sequence Length = 309 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 227 gttccagggatgtacttcttgggatt 202
>gb|AF533196.1| Homo sapiens isolate HCP35 chromosome 13 cytochrome c pseudogene, complete sequence Length = 313 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 234 gttccagggatgtacttcttgggatt 209
>gb|AF533195.1| Homo sapiens isolate HCP34 chromosome 13 cytochrome c pseudogene, complete sequence Length = 313 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 235 gttccagggatgtacttcttgggatt 210
>gb|AF533194.1| Homo sapiens isolate HCP33 chromosome 13 cytochrome c pseudogene, complete sequence Length = 318 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||||||||||||| ||||||| Sbjct: 236 gttccaggaatgtacttcctgggatt 211
>gb|AF533193.1| Homo sapiens isolate HCP32 chromosome 13 cytochrome c pseudogene, complete sequence Length = 318 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||||||||||||| ||||||| Sbjct: 236 gttccaggaatgtacttcctgggatt 211
>gb|AF533192.1| Homo sapiens isolate HCP31 chromosome 13 cytochrome c pseudogene, complete sequence Length = 316 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 236 gttccagggatgtacttcttgggatt 211
>gb|AF533185.1| Homo sapiens isolate HCP24 chromosome 9 cytochrome c pseudogene, complete sequence Length = 316 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 236 gttccagggatgtacttcttgggatt 211
>gb|AF533182.1| Homo sapiens isolate HCP21 chromosome 8 cytochrome c pseudogene, complete sequence Length = 318 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 236 gttccagggatgtacttcttgggatt 211
>gb|AF533176.1| Homo sapiens isolate HCP15 chromosome 6 cytochrome c pseudogene, complete sequence Length = 633 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 236 gttccagggatgtacttcttgggatt 211
>gb|AF533165.1| Homo sapiens isolate HCP4 chromosome 1 cytochrome c pseudogene, complete sequence Length = 277 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 195 gttccagggatgtacttcttgggatt 170
>gb|AF533162.1| Homo sapiens isolate HCP1 chromosome 1 cytochrome c pseudogene, complete sequence Length = 318 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 236 gttccagggatgtacttcttgggatt 211
>emb|AL356423.15| Human DNA sequence from clone RP11-295B17 on chromosome 13 Contains the 5' end of the STK24 gene for serine/threonine kinase 24, a novel gene, a novel pseudogene, a cytochrome c pseudogene, a calmodulin 2 (CALM2) pseudogene and a CpG island, complete sequence Length = 174041 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Plus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 131443 gttccagggatgtacttcttgggatt 131468
>emb|AL355860.12| Human DNA sequence from clone RP11-235D19 on chromosome 1 Contains a ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (UBE2D3) pseudogene, the 5' end of the CTSK gene for cathepsin K (pycnodysostosis), the ARNT gene for aryl hydrocarbon receptor nuclear translocator, a ribosomal protein S27a (RPS27A) pseudogene, a cytochrome c, somatic (CYCS) pseudogene and a CpG island, complete sequence Length = 116451 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 104775 gttccagggatgtacttcttgggatt 104750
>emb|AL354740.29| Human DNA sequence from clone RP11-513I15 on chromosome 6 Contains the 5' end of the GRM4 gene for glutamate receptor metabotropic 4, keratin 18 pseudogene 1 (KRT18P1), a cytochrome c, somatic (CYCS) pseudogene, the HMGA1 gene for high mobility group AT-hook 1, a ribosomal protein L35 (RPL35) pseudogene, part of a novel gene and CpG islands, complete sequence Length = 151828 Score = 44.1 bits (22), Expect = 0.53 Identities = 25/26 (96%) Strand = Plus / Minus Query: 385 gttccaggaatgtacttcttgggatt 410 |||||||| ||||||||||||||||| Sbjct: 87015 gttccagggatgtacttcttgggatt 86990
>emb|BX053421.1|CNS09DDT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 864 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 355 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 306 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 154 tcgacggtgtggcactgggcgcac 131
>emb|BX071914.1|CNS09RNI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1035 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 370 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 321 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 169 tcgacggtgtggcactgggcgcac 146
>emb|BX070969.1|CNS09QX9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 718 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 314 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 265 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 113 tcgacggtgtggcactgggcgcac 90
>emb|BX069281.1|CNS09PMD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1053 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 391 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 342 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 190 tcgacggtgtggcactgggcgcac 167
>emb|BX068475.1|CNS09OZZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 308 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 259 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 107 tcgacggtgtggcactgggcgcac 84
>emb|BX068177.1|CNS09ORP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1036 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 391 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 342 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 190 tcgacggtgtggcactgggcgcac 167
>emb|BX067681.1|CNS09ODX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 367 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 318 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 166 tcgacggtgtggcactgggcgcac 143
>emb|BX067077.1|CNS09NX5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 397 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 348 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 196 tcgacggtgtggcactgggcgcac 173
>emb|BX066876.1|CNS09NRK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 361 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 334 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 285 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 133 tcgacggtgtggcactgggcgcac 110
>emb|BX066631.1|CNS09NKR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 326 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 277 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 125 tcgacggtgtggcactgggcgcac 102
>emb|BX066462.1|CNS09NG2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 427 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 378 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 226 tcgacggtgtggcactgggcgcac 203
>emb|BX064776.1|CNS09M58 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 310 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 261 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 108 tcgacggtgtggcactgggcgcac 85
>emb|BX064702.1|CNS09M36 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48AH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 541 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 320 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 271 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 119 tcgacggtgtggcactgggcgcac 96
>emb|BX064486.1|CNS09LX6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 897 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 385 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 336
>emb|BX063948.1|CNS09LI8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 401 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 352 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 200 tcgacggtgtggcactgggcgcac 177
>emb|BX062556.1|CNS09KFK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43DF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 335 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 286 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 134 tcgacggtgtggcactgggcgcac 111
>emb|BX062284.1|CNS09K80 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 471 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 373 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 324
>emb|BX061602.1|CNS09JP2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 171 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 122
>emb|BX060540.1|CNS09IVK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 313 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 264 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 112 tcgacggtgtggcactgggcgcac 89
>emb|BX060187.1|CNS09ILR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 993 Score = 44.1 bits (22), Expect = 0.53 Identities = 43/50 (86%) Strand = Plus / Minus Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404 |||||||||||||| | ||| |||||||| || || || ||||||||||| Sbjct: 320 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 271 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 556 tcgacggtgtggcactgcgcgcac 579 ||||||||||||||||| |||||| Sbjct: 119 tcgacggtgtggcactgggcgcac 96 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,815,610 Number of Sequences: 3902068 Number of extensions: 5815610 Number of successful extensions: 111601 Number of sequences better than 10.0: 470 Number of HSP's better than 10.0 without gapping: 465 Number of HSP's successfully gapped in prelim test: 5 Number of HSP's that attempted gapping in prelim test: 110405 Number of HSP's gapped (non-prelim): 1192 length of query: 610 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 587 effective length of database: 17,143,297,704 effective search space: 10063115752248 effective search space used: 10063115752248 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)