Clone Name	rbags9a21
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK060267.1| Oryza sativa (japonica cultivar-group) cDNA clon...	341	2e-90
2	dbj|D12634.1|RICYCYTC Oryza sativa (japonica cultivar-group) mRN...	341	2e-90
3	gb|AF017367.1|AF017367 Oryza sativa cytochrome C mRNA, complete cds	280	5e-72
4	dbj|D21275.1|RICSS393 Oryza sativa SS393 mRNA for cytochrome c, ...	278	2e-71
5	gb|AF031540.1|AF031540 Fritillaria agrestis cytochrome C (cytC) ...	262	1e-66
6	dbj|D10421.1|RICT76 Oryza sativa mRNA for cytochrome C (T76 gene...	178	1e-41
7	ref|NM_102130.2| Arabidopsis thaliana electron carrier/ electron...	159	1e-35
8	gb|AY114580.1| Arabidopsis thaliana cytochrome C (At1g22840) mRN...	159	1e-35
9	gb|AY062853.1| Arabidopsis thaliana cytochrome C (At1g22840; F19...	159	1e-35
10	gb|AY087108.1| Arabidopsis thaliana clone 31770 mRNA, complete s...	159	1e-35
11	emb|AJ539068.1|NTA539068 Nicotiana tabacum cDNA-AFLP-fragment BT...	157	5e-35
12	gb|AY466606.1| Helianthus annuus cytochrome c mRNA, complete cds	153	8e-34
13	gb|L77113.1|HNNCYTC Helianthus annuus L. cytochrome c (cytc1) mR...	145	2e-31
14	gb|AC137623.3| Oryza sativa (japonica cultivar-group) chromosome...	143	8e-31
15	gb|AC124836.2| Oryza sativa (japonica cultivar-group) chromosome...	143	8e-31
16	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	143	8e-31
17	gb|M63704.1|RICCYTC Rice cytochrome c (OsCc-1) gene, complete cds	143	8e-31
18	ref|XM_463549.1| Oryza sativa (japonica cultivar-group), predic...	113	7e-22
19	dbj|AK121662.1| Oryza sativa (japonica cultivar-group) cDNA clon...	113	7e-22
20	gb|AF101422.1|AF101422 Cichorium intybus cytochrome mRNA, partia...	96	2e-16
21	gb|AC155340.1| Brassica rapa subsp. pekinensis chromosome Cytoge...	96	2e-16
22	dbj|AK060676.1| Oryza sativa (japonica cultivar-group) cDNA clon...	92	3e-15
23	gb|AC142095.9| Medicago truncatula clone mth2-14c17, complete se...	82	2e-12
24	gb|AC171534.4| Medicago truncatula chromosome 7 BAC clone mth2-9...	82	2e-12
25	ref|NM_117072.2| Arabidopsis thaliana electron carrier/ electron...	78	4e-11
26	gb|AY079373.1| Arabidopsis thaliana putative cytochrome c protei...	78	4e-11
27	gb|AY045944.1| Arabidopsis thaliana putative cytochrome c protei...	78	4e-11
28	emb|BX828516.1|CNS0A2QS Arabidopsis thaliana Full-length cDNA Co...	78	4e-11
29	gb|AY087056.1| Arabidopsis thaliana clone 31115 mRNA, complete s...	78	4e-11
30	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	74	6e-10
31	gb|AF229199.1|AF229199 Oryza sativa chromosome 1 clone OSJNBa004...	74	6e-10
32	dbj|AP003379.2| Oryza sativa (japonica cultivar-group) genomic D...	74	6e-10
33	gb|M35173.1|CRECYCA C.reinhardtii mitochondrial apocytochrome c ...	74	6e-10
34	gb|AF000657.1|ATAF000657 Arabidopsis thaliana BAC F19G10, comple...	72	2e-09
35	emb|BX826474.1|CNS0A37Z Arabidopsis thaliana Full-length cDNA Co...	70	9e-09
36	ref|NM_102131.3| Arabidopsis thaliana unknown protein AT1G22850 ...	64	6e-07
37	gb|AY431227.1| Aedes aegypti ASAP ID: 35977 cyctochrome c mRNA s...	62	2e-06
38	gb|DQ440105.1| Aedes aegypti clone AE-442 mitochondrial cytochro...	62	2e-06
39	ref|XM_567012.1| Cryptococcus neoformans var. neoformans JEC21 e...	62	2e-06
40	emb|CR937943.1| Single read from an extremity of a full-length c...	62	2e-06
41	gb|DQ122874.1| Chlamydomonas incerta mitochondrial apocytochrome...	62	2e-06
42	gb|DQ176429.1| Capra hircus mitochondrial cytochrome c mRNA, par...	60	9e-06
43	emb|X59459.1|ATATCC1G A.thaliana AtCc-1 gene for cytochrome c	60	9e-06
44	gb|M85253.1|ATHATCC1A Arabidoposis thaliana AtCc-1 DNA, complete...	60	9e-06
45	gb|AY071701.1| Drosophila melanogaster RH17228 full insert cDNA	58	4e-05
46	ref|XM_971011.1| PREDICTED: Tribolium castaneum similar to CG179...	58	4e-05
47	ref|XM_962134.1| PREDICTED: Tribolium castaneum similar to CG179...	58	4e-05
48	emb|X01760.1|DMCYCDC4 Drosophila melanogaster cytochrome c gene DC4	58	4e-05
49	ref|NM_057828.3| Drosophila melanogaster Cytochrome c proximal C...	58	4e-05
50	gb|AC093097.1| Drosophila melanogaster, chromosome 2L, region 36...	58	4e-05
51	gb|AC006214.1|AC006214 Drosophila melanogaster, chromosome 2L, r...	58	4e-05
52	gb|AE003652.2| Drosophila melanogaster chromosome 2L, section 61...	58	4e-05
53	gb|M11381.1|DROCYCE D.melanogaster cytochrome C gene	58	4e-05
54	emb|BX071915.1|CNS09RNJ Single read from an extremity of a full-...	56	1e-04
55	emb|BX069282.1|CNS09PME Single read from an extremity of a full-...	56	1e-04
56	emb|BX068476.1|CNS09P00 Single read from an extremity of a full-...	56	1e-04
57	emb|BX068178.1|CNS09ORQ Single read from an extremity of a full-...	56	1e-04
58	emb|BX067682.1|CNS09ODY Single read from an extremity of a full-...	56	1e-04
59	emb|BX066463.1|CNS09NG3 Single read from an extremity of a full-...	56	1e-04
60	emb|BX064703.1|CNS09M37 Single read from an extremity of a full-...	56	1e-04
61	emb|BX062557.1|CNS09KFL Single read from an extremity of a full-...	56	1e-04
62	emb|BX061603.1|CNS09JP3 Single read from an extremity of a full-...	56	1e-04
63	emb|BX060541.1|CNS09IVL Single read from an extremity of a full-...	56	1e-04
64	emb|BX060188.1|CNS09ILS Single read from an extremity of a full-...	56	1e-04
65	emb|BX058941.1|CNS09HN5 Single read from an extremity of a full-...	56	1e-04
66	emb|BX058045.1|CNS09GY9 Single read from an extremity of a full-...	56	1e-04
67	emb|BX058044.1|CNS09GY8 Single read from an extremity of a full-...	56	1e-04
68	emb|BX057320.1|CNS09GE4 Single read from an extremity of a full-...	56	1e-04
69	emb|BX057317.1|CNS09GE1 Single read from an extremity of a full-...	56	1e-04
70	emb|BX055390.1|CNS09EWI Single read from an extremity of a full-...	56	1e-04
71	emb|BX055389.1|CNS09EWH Single read from an extremity of a full-...	56	1e-04
72	emb|BX053158.1|CNS09D6I Single read from an extremity of a full-...	56	1e-04
73	emb|BX052789.1|CNS09CW9 Single read from an extremity of a full-...	56	1e-04
74	emb|BX030987.1|CNS08W2N Single read from an extremity of a full-...	56	1e-04
75	emb|BX043390.1|CNS095N6 Single read from an extremity of a full-...	56	1e-04
76	emb|BX043132.1|CNS095G0 Single read from an extremity of a full-...	56	1e-04
77	emb|BX040506.1|CNS093F2 Single read from an extremity of a full-...	56	1e-04
78	emb|BX039822.1|CNS092W2 Single read from an extremity of a full-...	56	1e-04
79	emb|BX039821.1|CNS092W1 Single read from an extremity of a full-...	56	1e-04
80	emb|BX036850.1|CNS090LI Single read from an extremity of a full-...	56	1e-04
81	emb|BX036056.1|CNS08ZZG Single read from an extremity of a full-...	56	1e-04
82	emb|BX036052.1|CNS08ZZC Single read from an extremity of a full-...	56	1e-04
83	emb|BX035216.1|CNS08ZC4 Single read from an extremity of a full-...	56	1e-04
84	emb|BX032226.1|CNS08X12 Single read from an extremity of a full-...	56	1e-04
85	emb|BX031975.1|CNS08WU3 Single read from an extremity of a full-...	56	1e-04
86	emb|BX030340.1|CNS08VKO Single read from an extremity of a full-...	56	1e-04
87	emb|BX027835.1|CNS08TN3 Single read from an extremity of a full-...	56	1e-04
88	emb|BX026220.1|CNS08SE8 Single read from an extremity of a full-...	56	1e-04
89	emb|BX024107.1|CNS08QRJ Single read from an extremity of a full-...	56	1e-04
90	emb|BX024106.1|CNS08QRI Single read from an extremity of a full-...	56	1e-04
91	emb|BX023752.1|CNS08QHO Single read from an extremity of a full-...	56	1e-04
92	emb|BX019497.1|CNS08N7H Single read from an extremity of a full-...	56	1e-04
93	emb|BX018904.1|CNS08MR0 Single read from an extremity of a full-...	56	1e-04
94	emb|BX018903.1|CNS08MQZ Single read from an extremity of a full-...	56	1e-04
95	emb|BX017251.1|CNS08LH3 Single read from an extremity of a full-...	56	1e-04
96	emb|BX015930.1|CNS08KGE Single read from an extremity of a full-...	56	1e-04
97	emb|BX015215.1|CNS08JWJ Single read from an extremity of a full-...	56	1e-04
98	emb|BX010251.1|CNS08G2N Single read from an extremity of a full-...	56	1e-04
99	emb|BX007964.1|CNS08EB4 Single read from an extremity of a full-...	56	1e-04
100	dbj|AK121277.1| Oryza sativa (japonica cultivar-group) cDNA clon...	56	1e-04
101	ref|XM_310154.2| Anopheles gambiae str. PEST ENSANGP00000020091 ...	56	1e-04
102	ref|XM_951393.1| Neurospora crassa OR74A CYTOCHROME C (NCU01808....	54	6e-04
103	ref|XM_328246.1| Neurospora crassa OR74A CYTOCHROME C (NCU01808....	54	6e-04
104	emb|BX036717.1|CNS090HT Single read from an extremity of a full-...	54	6e-04
105	emb|BX012845.1|CNS08I2P Single read from an extremity of a full-...	54	6e-04
106	emb|Z99829.1|CRCYC1GEN Chlamydomonas reinhardtii CYC1 gene encod...	54	6e-04
107	emb|X05506.1|NCCYTCR N.crassa mRNA for cytochrome c	54	6e-04
108	emb|AL669998.1|NCB1K11 Neurospora crassa DNA linkage group II BA...	54	6e-04
109	dbj|AB085853.1| Rosellinia necatrix cytc gene for cytochrome c, ...	54	6e-04
110	gb|L19358.1|NEUCYTOC Neurospora crassa cytochrome c (cyc-1) gene...	54	6e-04
111	ref|XM_587961.2| PREDICTED: Bos taurus similar to Cytochrome c, ...	52	0.002
112	gb|BC074190.1| Xenopus laevis MGC82081 protein, mRNA (cDNA clone...	52	0.002
113	ref|XM_583465.2| PREDICTED: Bos taurus similar to Cytochrome c, ...	52	0.002
114	gb|BC059740.1| Xenopus tropicalis cytochrome c, testis, mRNA (cD...	52	0.002
115	gb|BC105397.1| Bos taurus similar to Cytochrome c, somatic, mRNA...	52	0.002
116	ref|NM_203564.1| Xenopus tropicalis cytochrome c, testis (cyct),...	52	0.002
117	emb|CR760663.2| Xenopus tropicalis finished cDNA, clone TEgg084a23	52	0.002
118	emb|AJ416378.1|PSP416378 Polytomella sp. 'Pringsheim 198.80' mRN...	50	0.009
119	emb|BX033449.1|CNS08XZ1 Single read from an extremity of a full-...	50	0.009
120	emb|AL161516.2|ATCHRIV28 Arabidopsis thaliana DNA chromosome 4, ...	50	0.009
121	emb|AL049487.1|ATF28M11 Arabidopsis thaliana DNA chromosome 4, B...	50	0.009
122	emb|AL049481.1|ATT5L19 Arabidopsis thaliana DNA chromosome 4, BA...	50	0.009
123	gb|DQ084330.1| Dermacentor variabilis clone 2 cytochrome C mRNA,...	50	0.009
124	gb|DQ084329.1| Dermacentor variabilis clone 1 cytochrome C mRNA,...	50	0.009
125	gb|AF038611.2| Caenorhabditis elegans cosmid E04A4, complete seq...	48	0.034
126	gb|AY559323.1| Pichia pastoris cytochrome c (CYC1) gene, complet...	48	0.034
127	ref|XM_532493.2| PREDICTED: Canis familiaris similar to Cytochro...	48	0.034
128	emb|BX053121.1|CNS09D5H Single read from an extremity of a full-...	48	0.034
129	emb|BX054543.1|CNS09E8Z Single read from an extremity of a full-...	48	0.034
130	emb|BX054542.1|CNS09E8Y Single read from an extremity of a full-...	48	0.034
131	emb|BX045253.1|CNS0972X Single read from an extremity of a full-...	48	0.034
132	emb|BX022008.1|CNS08P58 Single read from an extremity of a full-...	48	0.034
133	ref|NM_073755.2| Caenorhabditis elegans ZC116.2 (ZC116.2) mRNA, ...	48	0.034
134	ref|NM_068228.3| Caenorhabditis elegans E04A4.7 (E04A4.7) mRNA, ...	48	0.034
135	gb|AY864613.1| Sus scrofa cytochrome c-like protein mRNA, comple...	48	0.034
136	gb|AY610503.1| Sus scrofa clone rptbr0104_o5.y1.abd, mRNA sequence	48	0.034
137	gb|AY610281.1| Sus scrofa clone rcki23_k5.y1.abd, mRNA sequence	48	0.034
138	ref|XM_750550.1| Aspergillus fumigatus Af293 cytochrome c (Afu2g...	46	0.13
139	ref|XM_391057.1| Gibberella zeae PH-1 chromosome 3 CYC_NEUCR Cyt...	46	0.13
140	emb|CR732655.1|CNS0GS9G Tetraodon nigroviridis full-length cDNA	46	0.13
141	emb|CR685667.2|CNS0FS0F Tetraodon nigroviridis full-length cDNA	46	0.13
142	emb|CR682724.1|CNS0FPQO Tetraodon nigroviridis full-length cDNA	46	0.13
143	emb|CR675102.2|CNS0FJVO Tetraodon nigroviridis full-length cDNA	46	0.13
144	emb|CR673433.2|CNS0FILB Tetraodon nigroviridis full-length cDNA	46	0.13
145	ref|XM_502612.1| Yarrowia lipolytica CLIB122, YALI0D09273g predi...	46	0.13
146	gb|AF091484.1| Tigriopus californicus isolate SD18 cytochrome c ...	46	0.13
147	gb|AF091483.1| Tigriopus californicus isolate SD16 cytochrome c ...	46	0.13
148	gb|AF091482.1| Tigriopus californicus isolate SD16 cytochrome c ...	46	0.13
149	gb|AF091481.1| Tigriopus californicus isolate SD15 cytochrome c ...	46	0.13
150	gb|AF091480.1| Tigriopus californicus isolate SD12 cytochrome c ...	46	0.13
151	gb|AF091479.1| Tigriopus californicus isolate SD11 cytochrome c ...	46	0.13
152	gb|AF091478.1| Tigriopus californicus isolate SC17 cytochrome c ...	46	0.13
153	gb|AF091477.1| Tigriopus californicus isolate SC16 cytochrome c ...	46	0.13
154	gb|AF091476.1| Tigriopus californicus isolate SC16 cytochrome c ...	46	0.13
155	gb|AF091475.1| Tigriopus californicus isolate SC15 cytochrome c ...	46	0.13
156	gb|AF091474.1| Tigriopus californicus isolate SC14 cytochrome c ...	46	0.13
157	gb|AF091473.1| Tigriopus californicus isolate SC13 cytochrome c ...	46	0.13
158	gb|AF091472.1| Tigriopus californicus isolate SC13 cytochrome c ...	46	0.13
159	gb|AF091471.1| Tigriopus californicus isolate CA11 cytochrome c ...	46	0.13
160	gb|AF091470.1| Tigriopus californicus isolate CA3 cytochrome c (...	46	0.13
161	gb|AF091469.1| Tigriopus californicus isolate CA3 cytochrome c (...	46	0.13
162	gb|AF091468.1| Tigriopus californicus isolate CA2 cytochrome c (...	46	0.13
163	gb|AF091467.1| Tigriopus californicus isolate CA2 cytochrome c (...	46	0.13
164	gb|AF091466.1| Tigriopus californicus isolate CA1 cytochrome c (...	46	0.13
165	gb|AF091465.1| Tigriopus californicus isolate CA1 cytochrome c (...	46	0.13
166	gb|AF091460.1| Tigriopus californicus cytochrome c (CYC) mRNA, c...	46	0.13
167	emb|BX070970.1|CNS09QXA Single read from an extremity of a full-...	46	0.13
168	emb|BX068625.1|CNS09P45 Single read from an extremity of a full-...	46	0.13
169	emb|BX048689.1|CNS099QD Single read from an extremity of a full-...	46	0.13
170	emb|BX026468.1|CNS08SL4 Single read from an extremity of a full-...	46	0.13
171	gb|DQ445531.1| Graphocephala atropunctata isolate WHGA0824 cytoc...	46	0.13
172	dbj|AB225913.1| Aspergillus oryzae cDNA, contig sequence: AoEST2768	46	0.13
173	dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026	46	0.13
174	gb|AY034827.1| Curvularia lunata cytochrome c mRNA, complete cds	46	0.13
175	gb|AY918494.1| Tarsius bancanus mitochondrial cytochrome c somat...	46	0.13
176	emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1...	46	0.13
177	gb|M83141.1|EMECYTC Emericella nidulans cytochrome c (CYTc) gene...	46	0.13
178	ref|XM_528718.1| PREDICTED: Pan troglodytes similar to cytochrom...	44	0.53
179	ref|XM_520960.1| PREDICTED: Pan troglodytes similar to cytochrom...	44	0.53
180	ref|XM_519702.1| PREDICTED: Pan troglodytes similar to cytochrom...	44	0.53
181	ref|XM_519001.1| PREDICTED: Pan troglodytes similar to Chromosom...	44	0.53
182	ref|XM_518413.1| PREDICTED: Pan troglodytes similar to cytochrom...	44	0.53
183	ref|XM_524863.1| PREDICTED: Pan troglodytes LOC469480 (LOC469480...	44	0.53
184	gb|BC021994.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
185	gb|AY440406.1| Armigeres subalbatus ASAP ID: 39155 cytochrome c ...	44	0.53
186	ref|XM_370188.1| Magnaporthe grisea 70-15 chromosome II hypothet...	44	0.53
187	gb|BC070346.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
188	gb|BC070156.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
189	gb|BC067222.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
190	gb|BC016006.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
191	gb|BC022330.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
192	gb|BC008477.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
193	gb|BC008475.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
194	gb|AC183376.4| Pan troglodytes BAC clone CH251-735O6 from chromo...	44	0.53
195	gb|DQ481668.1| Takifugu rubripes HoxDa gene cluster, complete se...	44	0.53
196	gb|DQ176430.1| Bubalus bubalis mitochondrial cytochrome c mRNA, ...	44	0.53
197	gb|AC183388.3| Pan troglodytes BAC clone CH251-53D20 from chromo...	44	0.53
198	gb|AC183528.2| Pan troglodytes BAC clone CH251-737P22 from chrom...	44	0.53
199	gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CI...	44	0.53
200	gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, comp...	44	0.53
201	emb|CR722155.2|CNS0GK5T Tetraodon nigroviridis full-length cDNA	44	0.53
202	emb|CR721647.2|CNS0GJRP Tetraodon nigroviridis full-length cDNA	44	0.53
203	emb|CR710570.2|CNS0GB86 Tetraodon nigroviridis full-length cDNA	44	0.53
204	gb|AC007487.2| Homo sapiens BAC clone CTA-232J20 from 7, complet...	44	0.53
205	emb|CR677377.2|CNS0FLML Tetraodon nigroviridis full-length cDNA	44	0.53
206	emb|CR669860.1|CNS0FFU2 Tetraodon nigroviridis full-length cDNA	44	0.53
207	emb|CR657236.2|CNS0F63E Tetraodon nigroviridis full-length cDNA	44	0.53
208	gb|AC142296.1| Pan troglodytes BAC clone RP43-97L1 from Y, compl...	44	0.53
209	gb|AC146549.8| Medicago truncatula clone mth2-7p18, complete seq...	44	0.53
210	gb|AC146709.11| Medicago truncatula clone mth2-90m14, complete s...	44	0.53
211	emb|AL589762.16| Human DNA sequence from clone RP11-396D18 on ch...	44	0.53
212	emb|AL590064.9| Human DNA sequence from clone RP11-471M10 on chr...	44	0.53
213	emb|AL590076.4| Human DNA sequence from clone RP11-408K19 on chr...	44	0.53
214	emb|AL360020.15| Human DNA sequence from clone RP11-490F3 on chr...	44	0.53
215	emb|AL357080.13| Human DNA sequence from clone RP11-432L12 on ch...	44	0.53
216	emb|AL359763.9| Human DNA sequence from clone RP11-169O17 on chr...	44	0.53
217	gb|AF533200.1| Homo sapiens isolate HCP39 chromosome 16 cytochro...	44	0.53
218	gb|AF533196.1| Homo sapiens isolate HCP35 chromosome 13 cytochro...	44	0.53
219	gb|AF533195.1| Homo sapiens isolate HCP34 chromosome 13 cytochro...	44	0.53
220	gb|AF533194.1| Homo sapiens isolate HCP33 chromosome 13 cytochro...	44	0.53
221	gb|AF533193.1| Homo sapiens isolate HCP32 chromosome 13 cytochro...	44	0.53
222	gb|AF533192.1| Homo sapiens isolate HCP31 chromosome 13 cytochro...	44	0.53
223	gb|AF533185.1| Homo sapiens isolate HCP24 chromosome 9 cytochrom...	44	0.53
224	gb|AF533182.1| Homo sapiens isolate HCP21 chromosome 8 cytochrom...	44	0.53
225	gb|AF533176.1| Homo sapiens isolate HCP15 chromosome 6 cytochrom...	44	0.53
226	gb|AF533165.1| Homo sapiens isolate HCP4 chromosome 1 cytochrome...	44	0.53
227	gb|AF533162.1| Homo sapiens isolate HCP1 chromosome 1 cytochrome...	44	0.53
228	emb|AL356423.15| Human DNA sequence from clone RP11-295B17 on ch...	44	0.53
229	emb|AL355860.12| Human DNA sequence from clone RP11-235D19 on ch...	44	0.53
230	emb|AL354740.29| Human DNA sequence from clone RP11-513I15 on ch...	44	0.53
231	emb|BX053421.1|CNS09DDT Single read from an extremity of a full-...	44	0.53
232	emb|BX071914.1|CNS09RNI Single read from an extremity of a full-...	44	0.53
233	emb|BX070969.1|CNS09QX9 Single read from an extremity of a full-...	44	0.53
234	emb|BX069281.1|CNS09PMD Single read from an extremity of a full-...	44	0.53
235	emb|BX068475.1|CNS09OZZ Single read from an extremity of a full-...	44	0.53
236	emb|BX068177.1|CNS09ORP Single read from an extremity of a full-...	44	0.53
237	emb|BX067681.1|CNS09ODX Single read from an extremity of a full-...	44	0.53
238	emb|BX067077.1|CNS09NX5 Single read from an extremity of a full-...	44	0.53
239	emb|BX066876.1|CNS09NRK Single read from an extremity of a full-...	44	0.53
240	emb|BX066631.1|CNS09NKR Single read from an extremity of a full-...	44	0.53
241	emb|BX066462.1|CNS09NG2 Single read from an extremity of a full-...	44	0.53
242	emb|BX064776.1|CNS09M58 Single read from an extremity of a full-...	44	0.53
243	emb|BX064702.1|CNS09M36 Single read from an extremity of a full-...	44	0.53
244	emb|BX064486.1|CNS09LX6 Single read from an extremity of a full-...	44	0.53
245	emb|BX063948.1|CNS09LI8 Single read from an extremity of a full-...	44	0.53
246	emb|BX062556.1|CNS09KFK Single read from an extremity of a full-...	44	0.53
247	emb|BX062284.1|CNS09K80 Single read from an extremity of a full-...	44	0.53
248	emb|BX061602.1|CNS09JP2 Single read from an extremity of a full-...	44	0.53
249	emb|BX060540.1|CNS09IVK Single read from an extremity of a full-...	44	0.53
250	emb|BX060187.1|CNS09ILR Single read from an extremity of a full-...	44	0.53
251	emb|BX059922.1|CNS09IEE Single read from an extremity of a full-...	44	0.53
252	emb|BX058940.1|CNS09HN4 Single read from an extremity of a full-...	44	0.53
253	emb|BX056581.1|CNS09FTL Single read from an extremity of a full-...	44	0.53
254	emb|BX057319.1|CNS09GE3 Single read from an extremity of a full-...	44	0.53
255	emb|BX056311.1|CNS09FM3 Single read from an extremity of a full-...	44	0.53
256	emb|BX056281.1|CNS09FL9 Single read from an extremity of a full-...	44	0.53
257	emb|BX050064.1|CNS09ASK Single read from an extremity of a full-...	44	0.53
258	emb|BX049798.1|CNS09AL6 Single read from an extremity of a full-...	44	0.53
259	emb|BX030986.1|CNS08W2M Single read from an extremity of a full-...	44	0.53
260	emb|BX047063.1|CNS098H7 Single read from an extremity of a full-...	44	0.53
261	emb|BX045298.1|CNS09746 Single read from an extremity of a full-...	44	0.53
262	emb|BX044250.1|CNS096B2 Single read from an extremity of a full-...	44	0.53
263	emb|BX043389.1|CNS095N5 Single read from an extremity of a full-...	44	0.53
264	emb|BX043131.1|CNS095FZ Single read from an extremity of a full-...	44	0.53
265	emb|BX042263.1|CNS094RV Single read from an extremity of a full-...	44	0.53
266	emb|BX041247.1|CNS093ZN Single read from an extremity of a full-...	44	0.53
267	emb|BX040807.1|CNS093NF Single read from an extremity of a full-...	44	0.53
268	emb|BX040505.1|CNS093F1 Single read from an extremity of a full-...	44	0.53
269	emb|BX036756.1|CNS090IW Single read from an extremity of a full-...	44	0.53
270	emb|BX036716.1|CNS090HS Single read from an extremity of a full-...	44	0.53
271	emb|BX036849.1|CNS090LH Single read from an extremity of a full-...	44	0.53
272	emb|BX036068.1|CNS08ZZS Single read from an extremity of a full-...	44	0.53
273	emb|BX036055.1|CNS08ZZF Single read from an extremity of a full-...	44	0.53
274	emb|BX035215.1|CNS08ZC3 Single read from an extremity of a full-...	44	0.53
275	emb|BX035092.1|CNS08Z8O Single read from an extremity of a full-...	44	0.53
276	emb|BX032225.1|CNS08X11 Single read from an extremity of a full-...	44	0.53
277	emb|BX031974.1|CNS08WU2 Single read from an extremity of a full-...	44	0.53
278	emb|BX030339.1|CNS08VKN Single read from an extremity of a full-...	44	0.53
279	emb|BX028630.1|CNS08U96 Single read from an extremity of a full-...	44	0.53
280	emb|BX027834.1|CNS08TN2 Single read from an extremity of a full-...	44	0.53
281	emb|BX027738.1|CNS08TKE Single read from an extremity of a full-...	44	0.53
282	emb|BX026467.1|CNS08SL3 Single read from an extremity of a full-...	44	0.53
283	emb|BX026219.1|CNS08SE7 Single read from an extremity of a full-...	44	0.53
284	emb|BX025595.1|CNS08RWV Single read from an extremity of a full-...	44	0.53
285	emb|BX023751.1|CNS08QHN Single read from an extremity of a full-...	44	0.53
286	emb|BX019496.1|CNS08N7G Single read from an extremity of a full-...	44	0.53
287	emb|BX019286.1|CNS08N1M Single read from an extremity of a full-...	44	0.53
288	emb|BX019062.1|CNS08MVE Single read from an extremity of a full-...	44	0.53
289	emb|BX018604.1|CNS08MIO Single read from an extremity of a full-...	44	0.53
290	emb|BX018446.1|CNS08MEA Single read from an extremity of a full-...	44	0.53
291	gb|AY268594.1| Pan troglodytes somatic cytochrome c (CYCS) gene,...	44	0.53
292	gb|AY268593.1| Gorilla gorilla somatic cytochrome c (CYCS) gene,...	44	0.53
293	gb|AY268592.1| Trachypithecus cristatus somatic cytochrome c (CY...	44	0.53
294	emb|BX016898.1|CNS08L7A Single read from an extremity of a full-...	44	0.53
295	emb|BX016292.1|CNS08KQG Single read from an extremity of a full-...	44	0.53
296	emb|BX015929.1|CNS08KGD Single read from an extremity of a full-...	44	0.53
297	emb|BX015297.1|CNS08JYT Single read from an extremity of a full-...	44	0.53
298	emb|BX015214.1|CNS08JWI Single read from an extremity of a full-...	44	0.53
299	emb|BX014426.1|CNS08JAM Single read from an extremity of a full-...	44	0.53
300	emb|BX013696.1|CNS08IQC Single read from an extremity of a full-...	44	0.53
301	emb|BX012844.1|CNS08I2O Single read from an extremity of a full-...	44	0.53
302	emb|BX010250.1|CNS08G2M Single read from an extremity of a full-...	44	0.53
303	emb|BX007963.1|CNS08EB3 Single read from an extremity of a full-...	44	0.53
304	emb|BX007153.1|CNS08DOL Single read from an extremity of a full-...	44	0.53
305	emb|CR857183.1| Pongo pygmaeus mRNA; cDNA DKFZp468F1016 (from cl...	44	0.53
306	emb|CR542175.1| Homo sapiens full open reading frame cDNA clone ...	44	0.53
307	emb|AL713681.1|HSM803026 Homo sapiens mRNA; cDNA DKFZp761O0217 (...	44	0.53
308	gb|BT007646.1| Synthetic construct Homo sapiens cytochrome c, so...	44	0.53
309	gb|BT006946.1| Homo sapiens cytochrome c, somatic mRNA, complete...	44	0.53
310	gb|BC071761.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
311	gb|DQ096857.1| Xenopus laevis soco01 mRNA, complete sequence	44	0.53
312	gb|AC098964.4| Homo sapiens chromosome 8 clone RP11-141M14 map 8...	44	0.53
313	gb|AF279873.4| Homo sapiens chromosome 8 clone RP1-25D10, RP1-27...	44	0.53
314	dbj|BS000589.1| Pan troglodytes chromosome Y clone:PTB-234J08, c...	44	0.53
315	dbj|BS000569.1| Pan troglodytes chromosome Y clone:PTFY-001L05, ...	44	0.53
316	dbj|BS000665.1| Pan troglodytes chromosome Y clone:PTB-114E01, c...	44	0.53
317	gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence	44	0.53
318	emb|CR624739.1| full-length cDNA clone CS0DI052YN11 of Placenta ...	44	0.53
319	emb|CR622353.1| full-length cDNA clone CS0DF012YP05 of Fetal bra...	44	0.53
320	emb|CR621998.1| full-length cDNA clone CS0DI052YF11 of Placenta ...	44	0.53
321	emb|CR618678.1| full-length cDNA clone CS0DL012YH02 of B cells (...	44	0.53
322	emb|CR616500.1| full-length cDNA clone CS0DC004YL13 of Neuroblas...	44	0.53
323	emb|CR615470.1| full-length cDNA clone CS0DI068YJ06 of Placenta ...	44	0.53
324	ref|NM_018947.4| Homo sapiens cytochrome c, somatic (CYCS), nucl...	44	0.53
325	gb|DQ066252.1| Ixodes scapularis isolate ISN-L-208 cytochrome c ...	44	0.53
326	ref|NR_001561.1| Homo sapiens cytochrome c, somatic-like 1 (CYCS...	44	0.53
327	ref|NG_002988.1| Homo sapiens cytochrome c, somatic pseudogene 3...	44	0.53
328	ref|NG_002953.1| Homo sapiens cytochrome c, somatic pseudogene 5...	44	0.53
329	ref|NG_002955.1| Homo sapiens cytochrome c, somatic pseudogene 4...	44	0.53
330	ref|NG_002971.1| Homo sapiens cytochrome c, somatic pseudogene 3...	44	0.53
331	ref|NG_002974.1| Homo sapiens cytochrome c, somatic pseudogene 2...	44	0.53
332	ref|NG_002981.1| Homo sapiens cytochrome c, somatic pseudogene 3...	44	0.53
333	ref|NG_002983.1| Homo sapiens cytochrome c, somatic pseudogene 3...	44	0.53
334	ref|NG_002982.1| Homo sapiens cytochrome c, somatic pseudogene 3...	44	0.53
335	ref|NG_002984.1| Homo sapiens cytochrome c, somatic pseudogene 3...	44	0.53
336	gb|AY918495.1| Macaca sylvanus mitochondrial cytochrome c somati...	44	0.53
337	gb|AC151722.2| Pan troglodytes BAC clone CH251-580N2 from chromo...	44	0.53
338	gb|AC146411.4| Pan troglodytes BAC clone RP43-36G22 from chromos...	44	0.53
339	gb|AY892600.1| Synthetic construct Homo sapiens clone FLH110829....	44	0.53
340	gb|AY892599.1| Synthetic construct Homo sapiens clone FLH110828....	44	0.53
341	gb|AY890126.1| Synthetic construct Homo sapiens clone FLH110832....	44	0.53
342	gb|AY890125.1| Synthetic construct Homo sapiens clone FLH110831....	44	0.53
343	gb|AY888124.1| Synthetic construct Homo sapiens clone FLH116437....	44	0.53
344	gb|AY890706.1| Synthetic construct Homo sapiens clone FLH116434....	44	0.53
345	gb|AY893657.1| Synthetic construct Homo sapiens clone FLH057938....	44	0.53
346	gb|AY893193.1| Synthetic construct Homo sapiens clone FLH057942....	44	0.53
347	gb|BC009579.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
348	gb|BC009607.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
349	gb|BC015130.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
350	gb|BC009587.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
351	gb|BC009582.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
352	dbj|AK062980.1| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.53
353	gb|AY849644.1| Magnaporthe grisea cytochrome c-like protein mRNA...	44	0.53
354	gb|BC024216.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
355	gb|BC068464.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
356	gb|BC009578.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
357	gb|BC014361.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
358	gb|BC014359.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
359	gb|BC005299.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
360	gb|BC009602.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA cl...	44	0.53
361	emb|CR938722.3| Pig DNA sequence from clone CH242-150C11 on chro...	44	0.53
362	emb|CT009582.3| Pan troglodytes chromosome X clone PTB-130G16 ma...	44	0.53
363	gb|M22900.1|HUMCYCPSJ Human somatic cytochrome c (HS11) processe...	44	0.53
364	gb|M22891.1|HUMCYCPSH Human somatic cytochrome c (HC8) processed...	44	0.53
365	gb|M22893.1|HUMCYCPSK Human somatic cytochrome c (HS7) processed...	44	0.53
366	gb|M22885.1|HUMCYCPSD Human somatic cytochrome c (HC4) processed...	44	0.53
367	gb|M22880.1|HUMCYCPSC Human somatic cytochrome c (HC3) processed...	44	0.53
368	gb|M22878.1|HUMCYCPSA Human somatic cytochrome c (HC1) processed...	44	0.53
369	gb|M22877.1|HUMCYCAA Human somatic cytochrome c (HCS) gene, comp...	44	0.53
370	dbj|D00268.1|HUMCYCPS3 Homo sapiens pseudogene for cytochrome c-...	44	0.53
371	dbj|D00266.1|HUMCYCPS1 Homo sapiens pseudogene for cytochrome c-...	44	0.53
372	gb|DQ214749.1| Taeniopygia guttata clone 0063P0016E04 cytochrome...	42	2.1
373	gb|DQ214748.1| Taeniopygia guttata clone 0063P0007F08 cytochrome...	42	2.1
374	gb|DQ214747.1| Taeniopygia guttata clone 0058P0058B11 cytochrome...	42	2.1
375	gb|DQ214746.1| Taeniopygia guttata clone 0065P0018D10 cytochrome...	42	2.1
376	gb|DQ214745.1| Taeniopygia guttata clone 0063P0020D04 cytochrome...	42	2.1
377	gb|AY534621.1| Pectinaria gouldii cytochrome c mRNA, complete cds	42	2.1
378	ref|XM_753762.1| Ustilago maydis 521 cytochrome c (UM02708.1) pa...	42	2.1
379	emb|CR762438.7| Zebrafish DNA sequence from clone CH211-12O9 in ...	42	2.1
380	gb|AC148765.24| Medicago truncatula clone mth2-34f9, complete se...	42	2.1
381	gb|AF533174.1| Homo sapiens isolate HCP13 chromosome 3 cytochrom...	42	2.1
382	gb|AF533173.1| Homo sapiens isolate HCP12 chromosome 3 cytochrom...	42	2.1
383	gb|AF533172.1| Homo sapiens isolate HCP11 chromosome 3 cytochrom...	42	2.1
384	emb|AL034405.16|HS537K23 Human DNA sequence from clone RP4-537K2...	42	2.1
385	emb|BX053422.1|CNS09DDU Single read from an extremity of a full-...	42	2.1
386	emb|BX068184.1|CNS09ORW Single read from an extremity of a full-...	42	2.1
387	emb|BX064777.1|CNS09M59 Single read from an extremity of a full-...	42	2.1
388	emb|BX056282.1|CNS09FLA Single read from an extremity of a full-...	42	2.1
389	emb|BX040808.1|CNS093NG Single read from an extremity of a full-...	42	2.1
390	emb|BX025596.1|CNS08RWW Single read from an extremity of a full-...	42	2.1
391	emb|BX014427.1|CNS08JAN Single read from an extremity of a full-...	42	2.1
392	emb|BX007154.1|CNS08DOM Single read from an extremity of a full-...	42	2.1
393	dbj|AP008932.1| Rhodococcus erythropolis PR4 plasmid pREC1, comp...	42	2.1
394	gb|AC104126.2| Homo sapiens chromosome 5 clone RP11-526F3, compl...	42	2.1
395	gb|AC007999.13|AC007999 Homo sapiens 3q25-26 BAC CTB-177N7 (Cali...	42	2.1
396	gb|AC069461.2| Homo sapiens chromosome 3 clone RP11-1022P15 map ...	42	2.1
397	gb|AC010261.5| Homo sapiens chromosome 5 clone CTC-459M5, comple...	42	2.1
398	gb|AC090958.3| Homo sapiens chromosome 3 clone RP11-758G22 map 3...	42	2.1
399	ref|NG_002962.1| Homo sapiens cytochrome c, somatic pseudogene 1...	42	2.1
400	ref|NG_002963.1| Homo sapiens cytochrome c, somatic pseudogene 1...	42	2.1
401	ref|NG_002964.1| Homo sapiens cytochrome c, somatic pseudogene 1...	42	2.1
402	gb|AC124029.15| Mus musculus chromosome 1, clone RP23-238E7, com...	42	2.1
403	emb|CR392343.29| Zebrafish DNA sequence from clone CH211-195G6 i...	42	2.1
404	gb|DQ341263.1| Homo sapiens Fanconi anemia, complementation grou...	42	2.1
405	gb|AC102045.14| Mus musculus chromosome 1, clone RP23-335P21, co...	42	2.1
406	gb|AC018828.4| Homo sapiens chromosome 3 clone RP11-382A21 map 3...	42	2.1
407	gb|AC034193.5| Homo sapiens chromosome 3 clone RP11-572M14 map 3...	42	2.1
408	gb|AC018808.5| Homo sapiens chromosome 3 clone RP11-1016H17 map ...	42	2.1
409	gb|AY697432.1| Lactobacillus parabuchneri strain 33 glucansucras...	40	8.3
410	gb|BT016049.1| Drosophila melanogaster LP18465 full insert cDNA	40	8.3
411	gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr...	40	8.3
412	ref|XM_455840.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F16940g ...	40	8.3
413	ref|XM_455841.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F16929g ...	40	8.3
414	gb|AC129206.3| Mus musculus BAC clone RP24-269P22 from chromosom...	40	8.3
415	gb|AC165343.3| Mus musculus BAC clone RP23-476C24 from chromosom...	40	8.3
416	gb|AF533197.1| Homo sapiens isolate HCP36 chromosome 14 cytochro...	40	8.3
417	gb|AF091485.1| Tigriopus californicus isolate SD18 cytochrome c ...	40	8.3
418	gb|AF091464.1| Tigriopus californicus isolate AB3 cytochrome c (...	40	8.3
419	gb|AF091463.1| Tigriopus californicus isolate AB2 cytochrome c (...	40	8.3
420	gb|AF091462.1| Tigriopus californicus isolate AB1 cytochrome c (...	40	8.3
421	gb|AF091461.1| Tigriopus californicus isolate AB1 cytochrome c (...	40	8.3
422	emb|AL109825.23|HSJ148H17 Human DNA sequence from clone RP1-148H...	40	8.3
423	emb|BX068624.1|CNS09P44 Single read from an extremity of a full-...	40	8.3
424	emb|BX068183.1|CNS09ORV Single read from an extremity of a full-...	40	8.3
425	emb|BX066632.1|CNS09NKS Single read from an extremity of a full-...	40	8.3
426	emb|BX062870.1|CNS09KOA Single read from an extremity of a full-...	40	8.3
427	emb|BX062444.1|CNS09KCG Single read from an extremity of a full-...	40	8.3
428	emb|BX040878.1|CNS093PE Single read from an extremity of a full-...	40	8.3
429	emb|BX040776.1|CNS093MK Single read from an extremity of a full-...	40	8.3
430	emb|BX027739.1|CNS08TKF Single read from an extremity of a full-...	40	8.3
431	emb|BX022007.1|CNS08P57 Single read from an extremity of a full-...	40	8.3
432	emb|BX019287.1|CNS08N1N Single read from an extremity of a full-...	40	8.3
433	emb|BX014046.1|CNS08J02 Single read from an extremity of a full-...	40	8.3
434	emb|BX013262.1|CNS08IEA Single read from an extremity of a full-...	40	8.3
435	emb|X60834.1|KLCYCKG K.lactis CYCK gene for cytochrome C	40	8.3
436	emb|X58150.1|KLCYTC1 K.lactis cytc1 gene for cytochrome C	40	8.3
437	emb|X53770.1|SOCYC1 Schwanniomyces occidentalis CYC1 gene for cy...	40	8.3
438	emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	40	8.3
439	emb|BX927152.1| Corynebacterium glutamicum ATCC 13032, IS finger...	40	8.3
440	emb|BX324156.6| Zebrafish DNA sequence from clone CH211-215C3 in...	40	8.3
441	ref|NM_133004.1| Drosophila melanogaster CG8211-RA (CG8211), mRNA	40	8.3
442	gb|AC024900.20| Homo sapiens 12 BAC RP11-549E9 (Roswell Park Can...	40	8.3
443	gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	40	8.3
444	dbj|AK049471.1| Mus musculus 7 days embryo whole body cDNA, RIKE...	40	8.3
445	ref|NG_002985.1| Homo sapiens cytochrome c, somatic pseudogene 1...	40	8.3
446	gb|DQ350650.1| Ajellomyces capsulatus cytochrome c-like protein ...	40	8.3
447	gb|AC012161.8|AC012161 Drosophila melanogaster, chromosome X, re...	40	8.3
448	gb|AC011703.8|AC011703 Drosophila melanogaster, chromosome X, re...	40	8.3
449	gb|AC011702.10|AC011702 Drosophila melanogaster, chromosome X, r...	40	8.3
450	gb|AC157657.2| Mus musculus BAC clone RP23-429C4 from chromosome...	40	8.3
451	dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, compl...	40	8.3
452	gb|AC012456.10| Homo sapiens BAC clone RP11-484O9 from 2, comple...	40	8.3
453	gb|AC008050.6|AC008050 Homo sapiens chromosome 14 clone RP11-141...	40	8.3
454	gb|AC007376.9|AC007376 Homo sapiens chromosome 14 clone 99E15 co...	40	8.3
455	gb|AC175664.2| Mus musculus BAC clone RP24-391A3 from chromosome...	40	8.3
456	emb|AL954339.10| Zebrafish DNA sequence from clone CH211-221J21 ...	40	8.3
457	emb|BX469897.6| Zebrafish DNA sequence from clone CH211-39F22 in...	40	8.3
458	dbj|AB017069.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	40	8.3
459	ref|NM_211262.1| Eremothecium gossypii AFR360Wp (AFR360W), mRNA	40	8.3
460	dbj|AP000894.6| Homo sapiens genomic DNA, chromosome 18 clone:RP...	40	8.3
461	gb|AE003506.3| Drosophila melanogaster chromosome X, section 58 ...	40	8.3
462	gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co...	40	8.3
463	gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome	40	8.3
464	gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ...	40	8.3
465	gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome	40	8.3
466	gb|AY552545.2| Uncultured marine gamma proteobacterium EBAC20E09...	40	8.3
467	gb|AC127320.4| Mus musculus BAC clone RP23-230O23 from chromosom...	40	8.3
468	emb|AL731735.14| Mouse DNA sequence from clone RP23-139P21 on ch...	40	8.3
469	gb|M22886.1|HUMCYCPSE Human somatic cytochrome c (HC5) processed...	40	8.3
470	dbj|AB033762.1| Fusarium oxysporum cyc1 gene for cytochrome c549...	40	8.3

---

>dbj|AK060267.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-005-D04, full
           insert sequence
          Length = 742

 Score =  341 bits (172), Expect = 2e-90
 Identities = 265/296 (89%)
 Strand = Plus / Minus

                                                                       
Query: 310 gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369
           ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 422 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 363

                                                                       
Query: 370 gggaagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatacaga 429
           ||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||| || 
Sbjct: 362 gggaagaccatcttggttccagggatgtacttcttaggattaagcaggtagtcataaagt 303

                                                                       
Query: 430 gtgttctcctcccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcg 489
           ||||||||||||||   ||||||| |||||||||| |||| ||||||||| ||||||| |
Sbjct: 302 gtgttctcctcccagatcacagccatgttcttgttggccgtagagtaggaataaccaggg 243

                                                                       
Query: 490 gtggtgcccgactgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcg 549
           ||||| || |||||||| ||||||||||||| |||||||||||||||||||||||| |||
Sbjct: 242 gtggtacctgactgccttccaaacagaccattcaagtttggaccttgcttgtggccggcg 183

                                                                   
Query: 550 cccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605
           |||  |||||||||||||||||| |||||||||||||||||||||||  |||||||
Sbjct: 182 cccttgtcgacggtgtggcactgggcgcacttggtcttgaagatcttctcgccggc 127



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 181 caagataattgtctcgtggat 201
           |||||||||||||||||||||
Sbjct: 547 caagataattgtctcgtggat 527

---

>dbj|D12634.1|RICYCYTC Oryza sativa (japonica cultivar-group) mRNA for cytochrome C,
           complete cds
          Length = 654

 Score =  341 bits (172), Expect = 2e-90
 Identities = 265/296 (89%)
 Strand = Plus / Minus

                                                                       
Query: 310 gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369
           ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 340 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 281

                                                                       
Query: 370 gggaagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatacaga 429
           ||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||| || 
Sbjct: 280 gggaagaccatcttggttccagggatgtacttcttaggattaagcaggtagtcataaagt 221

                                                                       
Query: 430 gtgttctcctcccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcg 489
           ||||||||||||||   ||||||| |||||||||| |||| ||||||||| ||||||| |
Sbjct: 220 gtgttctcctcccagatcacagccatgttcttgttggccgtagagtaggaataaccaggg 161

                                                                       
Query: 490 gtggtgcccgactgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcg 549
           ||||| || |||||||| ||||||||||||| |||||||||||||||||||||||| |||
Sbjct: 160 gtggtacctgactgccttccaaacagaccattcaagtttggaccttgcttgtggccggcg 101

                                                                   
Query: 550 cccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605
           |||  |||||||||||||||||| |||||||||||||||||||||||  |||||||
Sbjct: 100 cccttgtcgacggtgtggcactgggcgcacttggtcttgaagatcttctcgccggc 45



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 181 caagataattgtctcgtggat 201
           |||||||||||||||||||||
Sbjct: 465 caagataattgtctcgtggat 445

---

>gb|AF017367.1|AF017367 Oryza sativa cytochrome C mRNA, complete cds
          Length = 609

 Score =  280 bits (141), Expect = 5e-72
 Identities = 250/285 (87%), Gaps = 1/285 (0%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| | ||| ||||||||||| |||||||| || ||||  ||||||||||||||
Sbjct: 410 cttcaggtaggaaataagatcagcacgctcctgtggttt-ttcaacccagggaagaccat 352

                                                                       
Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctc 440
           ||||||| |||| ||||||||||| |||||||||| ||||||||| || ||||| || ||
Sbjct: 351 cttggtttcagggatgtacttcttaggattaagcaggtagtcataaagtgtgttttcttc 292

                                                                       
Query: 441 ccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccga 500
           |||   ||||||| |||||||||| |||| ||||||||| ||||||| |||||| || ||
Sbjct: 291 ccagatcacagccatgttcttgttggccgtagagtaggaataaccaggggtggtacctga 232

                                                                       
Query: 501 ctgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgac 560
           |||||| ||||||||||||| |||||||||||||||||||||||| ||||||  ||||||
Sbjct: 231 ctgccttccaaacagaccattcaagtttggaccttgcttgtggccggcgcccttgtcgac 172

                                                        
Query: 561 ggtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605
           |||||||||||| ||||||||||| |||||||||||  |||||||
Sbjct: 171 ggtgtggcactgggcgcacttggttttgaagatcttctcgccggc 127

---

>dbj|D21275.1|RICSS393 Oryza sativa SS393 mRNA for cytochrome c, partial sequence
          Length = 344

 Score =  278 bits (140), Expect = 2e-71
 Identities = 216/240 (90%), Gaps = 1/240 (0%)
 Strand = Plus / Minus

                                                                       
Query: 367 ccagggaagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatac 426
           |||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||| 
Sbjct: 327 ccagggaagaccatcttggttccagggatgtacttcttaggattaagcaggtagtcataa 268

                                                                       
Query: 427 agagtgttctcctcccactccac-agccttgttcttgtttgccgcagagtaggagtaacc 485
           || ||||||||||||||   ||| |||| |||||||||| |||| ||||||||| |||||
Sbjct: 267 agtgtgttctcctcccagatcacnagccatgttcttgttggccgtagagtaggaataacc 208

                                                                       
Query: 486 agcggtggtgcccgactgcctcccaaacagaccatgcaagtttggaccttgcttgtggcc 545
           || |||||| || |||||||| ||||||||||||| ||||||||||||||||||||||||
Sbjct: 207 aggggtggtacctgactgccttccaaacagaccattcaagtttggaccttgcttgtggcc 148

                                                                       
Query: 546 cgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605
            ||||||  |||||||||||||||||| |||||||||||||||||||||||  |||||||
Sbjct: 147 ggcgcccttgtcgacggtgtggcactgggcgcacttggtcttgaagatcttctcgccggc 88

---

>gb|AF031540.1|AF031540 Fritillaria agrestis cytochrome C (cytC) mRNA, complete cds
          Length = 570

 Score =  262 bits (132), Expect = 1e-66
 Identities = 246/284 (86%)
 Strand = Plus / Minus

                                                                       
Query: 313 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccaggg 372
           ||||||| ||| ||||| ||||| || || || || || |||||||||||||||||||||
Sbjct: 386 gtggcttccttgaggtaagcaatcaggtccgctcgatcttgtggcttcttcagaccaggg 327

                                                                       
Query: 373 aagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtg 432
           || ||||||||||| |||||||| |||||||| ||||| |||||||| ||||||||||||
Sbjct: 326 aacaccatcttggtaccaggaatatacttcttaggattgagcaagtaatcatacagagtg 267

                                                                       
Query: 433 ttctcctcccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtg 492
           ||||| ||||| | ||| ||||||||||| || ||||||||||| || || ||||| || 
Sbjct: 266 ttctcatcccaattcaccgccttgttcttattcgccgcagagtacgaatacccagccgta 207

                                                                       
Query: 493 gtgcccgactgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgccc 552
           |||||||| |||||||| || || || | ||| || |||||||||||||| || ||||||
Sbjct: 206 gtgcccgattgcctcccgaaaagcccgttcaaattcggaccttgcttgtgaccggcgccc 147

                                                       
Query: 553 gcgtcgacggtgtggcactgcgcgcacttggtcttgaagatctt 596
             ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 146 ttgtcgacggtgtggcactgcgcgcacttggtcttgaagatctt 103

---

>dbj|D10421.1|RICT76 Oryza sativa mRNA for cytochrome C (T76 gene), partial sequence
          Length = 241

 Score =  178 bits (90), Expect = 1e-41
 Identities = 171/198 (86%), Gaps = 1/198 (0%)
 Strand = Plus / Minus

                                                                       
Query: 408 attaagcaagtagtcatacagagtgttctcctcccactccacagccttgttcttgtttgc 467
           |||||||| ||||||||| || |||||||||||| |   ||||||| |||||||||| ||
Sbjct: 241 attaagcaggtagtcataaagtgtgttctcctccaagatcacagccatgttcttgttggc 182

                                                                       
Query: 468 cgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagaccatgcaagtt 527
            | ||||||||| |||| || |||||| |  |||||||| |||||||||| || ||||||
Sbjct: 181 ngnagagtaggaataacnaggggtggtacntgactgccttccaaacagacaattcaagtt 122

                                                                       
Query: 528 tggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtctt 587
           |||||||||||||| ||| ||||||  |||||||||||||||||| ||||||||||||||
Sbjct: 121 tggaccttgcttgt-gccggcgcccttgtcgacggtgtggcactgggcgcacttggtctt 63

                             
Query: 588 gaagatcttggcgccggc 605
           |||||||||  |||||||
Sbjct: 62  gaagatcttctcgccggc 45

---

>ref|NM_102130.2| Arabidopsis thaliana electron carrier/ electron transporter
           AT1G22840 mRNA, complete cds
          Length = 727

 Score =  159 bits (80), Expect = 1e-35
 Identities = 227/276 (82%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 418 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 359

                                                                       
Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctc 440
           |||||| || || |||||||||||||| || |||||||| || ||||  |  ||||| ||
Sbjct: 358 cttggtacctggtatgtacttcttggggttgagcaagtaatcgtacaaggccttctcttc 299

                                                                       
Query: 441 ccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccga 500
           ||| |||||||| ||||||||||| || |||||||| ||||||||||| || || || ||
Sbjct: 298 ccattccacagctttgttcttgttagcagcagagtaagagtaaccagcagttgtaccaga 239

                                                                       
Query: 501 ctgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgac 560
            || || ||||| ||||| |  |  || || ||||| ||||| || ||||| || |||||
Sbjct: 238 ttgtcttccaaatagaccgtttagattgggtccttgtttgtgaccggcgcctgcttcgac 179

                                               
Query: 561 ggtgtggcactgcgcgcacttggtcttgaagatctt 596
           |||||| ||||| || ||||||||| ||||||||||
Sbjct: 178 ggtgtgacactgagcacacttggtcctgaagatctt 143

---

>gb|AY114580.1| Arabidopsis thaliana cytochrome C (At1g22840) mRNA, complete cds
          Length = 475

 Score =  159 bits (80), Expect = 1e-35
 Identities = 227/276 (82%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 324 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 265

                                                                       
Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctc 440
           |||||| || || |||||||||||||| || |||||||| || ||||  |  ||||| ||
Sbjct: 264 cttggtacctggtatgtacttcttggggttgagcaagtaatcgtacaaggccttctcttc 205

                                                                       
Query: 441 ccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccga 500
           ||| |||||||| ||||||||||| || |||||||| ||||||||||| || || || ||
Sbjct: 204 ccattccacagctttgttcttgttagcagcagagtaagagtaaccagcagttgtaccaga 145

                                                                       
Query: 501 ctgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgac 560
            || || ||||| ||||| |  |  || || ||||| ||||| || ||||| || |||||
Sbjct: 144 ttgtcttccaaatagaccgtttagattgggtccttgtttgtgaccggcgcctgcttcgac 85

                                               
Query: 561 ggtgtggcactgcgcgcacttggtcttgaagatctt 596
           |||||| ||||| || ||||||||| ||||||||||
Sbjct: 84  ggtgtgacactgagcacacttggtcctgaagatctt 49

---

>gb|AY062853.1| Arabidopsis thaliana cytochrome C (At1g22840; F19G10.20) mRNA,
           complete cds
          Length = 619

 Score =  159 bits (80), Expect = 1e-35
 Identities = 227/276 (82%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 411 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 352

                                                                       
Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctc 440
           |||||| || || |||||||||||||| || |||||||| || ||||  |  ||||| ||
Sbjct: 351 cttggtacctggtatgtacttcttggggttgagcaagtaatcgtacaaggccttctcttc 292

                                                                       
Query: 441 ccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccga 500
           ||| |||||||| ||||||||||| || |||||||| ||||||||||| || || || ||
Sbjct: 291 ccattccacagctttgttcttgttagcagcagagtaagagtaaccagcagttgtaccaga 232

                                                                       
Query: 501 ctgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgac 560
            || || ||||| ||||| |  |  || || ||||| ||||| || ||||| || |||||
Sbjct: 231 ttgtcttccaaatagaccgtttagattgggtccttgtttgtgaccggcgcctgcttcgac 172

                                               
Query: 561 ggtgtggcactgcgcgcacttggtcttgaagatctt 596
           |||||| ||||| || ||||||||| ||||||||||
Sbjct: 171 ggtgtgacactgagcacacttggtcctgaagatctt 136

---

>gb|AY087108.1| Arabidopsis thaliana clone 31770 mRNA, complete sequence
          Length = 627

 Score =  159 bits (80), Expect = 1e-35
 Identities = 227/276 (82%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 418 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 359

                                                                       
Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctc 440
           |||||| || || |||||||||||||| || |||||||| || ||||  |  ||||| ||
Sbjct: 358 cttggtacctggtatgtacttcttggggttgagcaagtaatcgtacaaggccttctcttc 299

                                                                       
Query: 441 ccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccga 500
           ||| |||||||| ||||||||||| || |||||||| ||||||||||| || || || ||
Sbjct: 298 ccattccacagctttgttcttgttagcagcagagtaagagtaaccagcagttgtaccaga 239

                                                                       
Query: 501 ctgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgac 560
            || || ||||| ||||| |  |  || || ||||| ||||| || ||||| || |||||
Sbjct: 238 ttgtcttccaaatagaccgtttagattgggtccttgtttgtgaccggcgcctgcttcgac 179

                                               
Query: 561 ggtgtggcactgcgcgcacttggtcttgaagatctt 596
           |||||| ||||| || ||||||||| ||||||||||
Sbjct: 178 ggtgtgacactgagcacacttggtcctgaagatctt 143

---

>emb|AJ539068.1|NTA539068 Nicotiana tabacum cDNA-AFLP-fragment BT42-M1-010
          Length = 450

 Score =  157 bits (79), Expect = 5e-35
 Identities = 163/191 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381
           |||||||| |||||||| || ||||| |||||||||||||||| ||||||||| ||||||
Sbjct: 269 ttcaggtaggcaatgaggtctgcacgctcctgtggcttcttcaaaccagggaaaaccatc 210

                                                                       
Query: 382 ttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctcc 441
           || |||||||| |||||||||||||| || ||||| || ||||||| ||| || || |||
Sbjct: 209 tttgttccaggtatgtacttcttggggttgagcaaataatcatacaaagtcttttcttcc 150

                                                                       
Query: 442 cactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgac 501
           |||  ||||||| | ||||| || || |||||||||||||||||||| || || || |||
Sbjct: 149 cacatcacagccatattcttattggcagcagagtaggagtaaccagcagtagttccagac 90

                      
Query: 502 tgcctcccaaa 512
           ||||| |||||
Sbjct: 89  tgccttccaaa 79

---

>gb|AY466606.1| Helianthus annuus cytochrome c mRNA, complete cds
          Length = 684

 Score =  153 bits (77), Expect = 8e-34
 Identities = 227/277 (81%)
 Strand = Plus / Minus

                                                                       
Query: 320 tcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagacca 379
           |||||| ||| ||||||||||| ||||| ||||||||||| ||| | || ||||| ||||
Sbjct: 443 tcttcaagtatgcaatgagatctgcacgctcctgtggctttttcggtcctgggaaaacca 384

                                                                       
Query: 380 tcttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcct 439
           |||| |||||||| ||||||||||| || || | ||||||||| |||| |||||| ||||
Sbjct: 383 tctttgttccagggatgtacttcttcgggttcaacaagtagtcgtacaaagtgttttcct 324

                                                                       
Query: 440 cccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccg 499
           ||||    || ||||||||||||||  | |||||||| || || ||||| ||||| || |
Sbjct: 323 cccagataactgccttgttcttgttaccagcagagtaagaatatccagcagtggttccag 264

                                                                       
Query: 500 actgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcga 559
           ||||||| |||||||| ||||  | ||| || ||||| ||||| || |||||    ||||
Sbjct: 263 actgccttccaaacagtccatttaggttgggtccttgtttgtgaccagcgcctttctcga 204

                                                
Query: 560 cggtgtggcactgcgcgcacttggtcttgaagatctt 596
           ||||||| || || |||||||| ||||||||||||||
Sbjct: 203 cggtgtgacattgagcgcactttgtcttgaagatctt 167

---

>gb|L77113.1|HNNCYTC Helianthus annuus L. cytochrome c (cytc1) mRNA, complete cds
          Length = 559

 Score =  145 bits (73), Expect = 2e-31
 Identities = 226/277 (81%)
 Strand = Plus / Minus

                                                                       
Query: 320 tcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagacca 379
           |||||| ||| ||||||||||| ||||| ||||||||||| || |  || ||||| ||||
Sbjct: 335 tcttcaagtatgcaatgagatctgcacgctcctgtggcttttttaagcctgggaaaacca 276

                                                                       
Query: 380 tcttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcct 439
           |||| |||||||| ||||||||||| || || | ||||||||| |||| |||||| ||||
Sbjct: 275 tctttgttccagggatgtacttcttcgggttcaacaagtagtcgtacaaagtgttttcct 216

                                                                       
Query: 440 cccactccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccg 499
           ||||    || ||||||||||||||  | |||||||| || || ||||| ||||| || |
Sbjct: 215 cccagataactgccttgttcttgttaccagcagagtaagaatatccagcagtggttccag 156

                                                                       
Query: 500 actgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcga 559
           ||||||| |||||||| ||||  | ||| || ||||| ||||| || |||||    ||||
Sbjct: 155 actgccttccaaacagtccatttaggttgggcccttgtttgtgaccagcgcctttctcga 96

                                                
Query: 560 cggtgtggcactgcgcgcacttggtcttgaagatctt 596
           ||||||| || || |||||||| ||||||||||||||
Sbjct: 95  cggtgtgacattgagcgcactttgtcttgaagatctt 59

---

>gb|AC137623.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0426G01,
              complete sequence
          Length = 173074

 Score =  143 bits (72), Expect = 8e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                          
Query: 399    cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458
              |||||| |||||||||| ||||||||| || ||||||||||||||   ||||||| ||||
Sbjct: 158696 cttcttaggattaagcaggtagtcataaagtgtgttctcctcccagatcacagccatgtt 158637

                                                                          
Query: 459    cttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagacc 518
              |||||| |||| ||||||||| ||||||| |||||| || |||||||| |||||||||||
Sbjct: 158636 cttgttggccgtagagtaggaataaccaggggtggtacctgactgccttccaaacagacc 158577

                              
Query: 519    atgcaagtttggacct 534
              || |||||||||||||
Sbjct: 158576 attcaagtttggacct 158561



 Score =  109 bits (55), Expect = 1e-20
 Identities = 82/91 (90%)
 Strand = Plus / Minus

                                                                          
Query: 310    gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369
              ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 159501 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 159442

                                             
Query: 370    gggaagaccatcttggttccaggaatgtact 400
              ||||||||||||||||||||||| |||||||
Sbjct: 159441 gggaagaccatcttggttccagggatgtact 159411



 Score =  101 bits (51), Expect = 3e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                          
Query: 531    accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590
              ||||||||||||||| ||||||  |||||||||||||||||| |||||||||||||||||
Sbjct: 157742 accttgcttgtggccggcgcccttgtcgacggtgtggcactgggcgcacttggtcttgaa 157683

                             
Query: 591    gatcttggcgccggc 605
              ||||||  |||||||
Sbjct: 157682 gatcttctcgccggc 157668



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 181    caagataattgtctcgtggat 201
              |||||||||||||||||||||
Sbjct: 159626 caagataattgtctcgtggat 159606

---

>gb|AC124836.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0092E21, complete sequence
          Length = 132649

 Score =  143 bits (72), Expect = 8e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                         
Query: 399   cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458
             |||||| |||||||||| ||||||||| || ||||||||||||||   ||||||| ||||
Sbjct: 30430 cttcttaggattaagcaggtagtcataaagtgtgttctcctcccagatcacagccatgtt 30371

                                                                         
Query: 459   cttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagacc 518
             |||||| |||| ||||||||| ||||||| |||||| || |||||||| |||||||||||
Sbjct: 30370 cttgttggccgtagagtaggaataaccaggggtggtacctgactgccttccaaacagacc 30311

                             
Query: 519   atgcaagtttggacct 534
             || |||||||||||||
Sbjct: 30310 attcaagtttggacct 30295



 Score =  109 bits (55), Expect = 1e-20
 Identities = 82/91 (90%)
 Strand = Plus / Minus

                                                                         
Query: 310   gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369
             ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 31235 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 31176

                                            
Query: 370   gggaagaccatcttggttccaggaatgtact 400
             ||||||||||||||||||||||| |||||||
Sbjct: 31175 gggaagaccatcttggttccagggatgtact 31145



 Score =  101 bits (51), Expect = 3e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                         
Query: 531   accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590
             ||||||||||||||| ||||||  |||||||||||||||||| |||||||||||||||||
Sbjct: 29476 accttgcttgtggccggcgcccttgtcgacggtgtggcactgggcgcacttggtcttgaa 29417

                            
Query: 591   gatcttggcgccggc 605
             ||||||  |||||||
Sbjct: 29416 gatcttctcgccggc 29402



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 181   caagataattgtctcgtggat 201
             |||||||||||||||||||||
Sbjct: 31360 caagataattgtctcgtggat 31340

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  143 bits (72), Expect = 8e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                            
Query: 399      cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458
                |||||| |||||||||| ||||||||| || ||||||||||||||   ||||||| ||||
Sbjct: 20486951 cttcttaggattaagcaggtagtcataaagtgtgttctcctcccagatcacagccatgtt 20486892

                                                                            
Query: 459      cttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagacc 518
                |||||| |||| ||||||||| ||||||| |||||| || |||||||| |||||||||||
Sbjct: 20486891 cttgttggccgtagagtaggaataaccaggggtggtacctgactgccttccaaacagacc 20486832

                                
Query: 519      atgcaagtttggacct 534
                || |||||||||||||
Sbjct: 20486831 attcaagtttggacct 20486816



 Score =  109 bits (55), Expect = 1e-20
 Identities = 82/91 (90%)
 Strand = Plus / Minus

                                                                            
Query: 310      gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369
                ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 20487756 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 20487697

                                               
Query: 370      gggaagaccatcttggttccaggaatgtact 400
                ||||||||||||||||||||||| |||||||
Sbjct: 20487696 gggaagaccatcttggttccagggatgtact 20487666



 Score =  101 bits (51), Expect = 3e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                            
Query: 531      accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590
                ||||||||||||||| ||||||  |||||||||||||||||| |||||||||||||||||
Sbjct: 20485997 accttgcttgtggccggcgcccttgtcgacggtgtggcactgggcgcacttggtcttgaa 20485938

                               
Query: 591      gatcttggcgccggc 605
                ||||||  |||||||
Sbjct: 20485937 gatcttctcgccggc 20485923



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 181      caagataattgtctcgtggat 201
                |||||||||||||||||||||
Sbjct: 20487881 caagataattgtctcgtggat 20487861

---

>gb|M63704.1|RICCYTC Rice cytochrome c (OsCc-1) gene, complete cds
          Length = 2408

 Score =  143 bits (72), Expect = 8e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                        
Query: 399  cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458
            |||||| |||||||||| ||||||||| || ||||||||||||||   ||||||| ||||
Sbjct: 1382 cttcttaggattaagcaggtagtcataaagtgtgttctcctcccagatcacagccatgtt 1323

                                                                        
Query: 459  cttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagacc 518
            |||||| |||| ||||||||| ||||||| |||||| || |||||||| |||||||||||
Sbjct: 1322 cttgttggccgtagagtaggaataaccaggggtggtacctgactgccttccaaacagacc 1263

                            
Query: 519  atgcaagtttggacct 534
            || |||||||||||||
Sbjct: 1262 attcaagtttggacct 1247



 Score =  109 bits (55), Expect = 1e-20
 Identities = 82/91 (90%)
 Strand = Plus / Minus

                                                                        
Query: 310  gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 369
            ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 2219 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 2160

                                           
Query: 370  gggaagaccatcttggttccaggaatgtact 400
            ||||||||||||||||||||||| |||||||
Sbjct: 2159 gggaagaccatcttggttccagggatgtact 2129



 Score =  101 bits (51), Expect = 3e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 531 accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590
           ||||||||||||||| ||||||  |||||||||||||||||| |||||||||||||||||
Sbjct: 433 accttgcttgtggccggcgcccttgtcgacggtgtggcactgggcgcacttggtcttgaa 374

                          
Query: 591 gatcttggcgccggc 605
           ||||||  |||||||
Sbjct: 373 gatcttctcgccggc 359



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 181  caagataattgtctcgtggat 201
            |||||||||||||||||||||
Sbjct: 2344 caagataattgtctcgtggat 2324

---

>ref|XM_463549.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 336

 Score =  113 bits (57), Expect = 7e-22
 Identities = 113/131 (86%), Gaps = 3/131 (2%)
 Strand = Plus / Minus

                                                                       
Query: 313 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccaggg 372
           ||||| ||||||||||| || ||||||||||||||||||||||||| |||||| |||  |
Sbjct: 329 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcagtccattg 270

                                                                       
Query: 373 aagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtg 432
           ||  |||||||||   ||||| |||||||||| ||| |||||| ||||||||||| ||||
Sbjct: 269 aaccccatcttgg---caggagtgtacttcttaggagtaagcaggtagtcatacaaagtg 213

                      
Query: 433 ttctcctccca 443
           ||||| |||||
Sbjct: 212 ttctcttccca 202



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                       
Query: 502 tgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacg 561
           ||||||||||||| ||| | ||||||||| || ||||||||||| ||| ||  |||||||
Sbjct: 143 tgcctcccaaacaaaccgttcaagtttggcccatgcttgtggccggcggccttgtcgacg 84

                                                       
Query: 562 gtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605
           |  ||||| | ||||||||||||| ||||||||||  |||||||
Sbjct: 83  gcatggcagtacgcgcacttggtcctgaagatcttctcgccggc 40

---

>dbj|AK121662.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033064H20, full
           insert sequence
          Length = 696

 Score =  113 bits (57), Expect = 7e-22
 Identities = 113/131 (86%), Gaps = 3/131 (2%)
 Strand = Plus / Minus

                                                                       
Query: 313 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccaggg 372
           ||||| ||||||||||| || ||||||||||||||||||||||||| |||||| |||  |
Sbjct: 402 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcagtccattg 343

                                                                       
Query: 373 aagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtg 432
           ||  |||||||||   ||||| |||||||||| ||| |||||| ||||||||||| ||||
Sbjct: 342 aaccccatcttgg---caggagtgtacttcttaggagtaagcaggtagtcatacaaagtg 286

                      
Query: 433 ttctcctccca 443
           ||||| |||||
Sbjct: 285 ttctcttccca 275



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                       
Query: 502 tgcctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacg 561
           ||||||||||||| ||| | ||||||||| || ||||||||||| ||| ||  |||||||
Sbjct: 216 tgcctcccaaacaaaccgttcaagtttggcccatgcttgtggccggcggccttgtcgacg 157

                                                       
Query: 562 gtgtggcactgcgcgcacttggtcttgaagatcttggcgccggc 605
           |  ||||| | ||||||||||||| ||||||||||  |||||||
Sbjct: 156 gcatggcagtacgcgcacttggtcctgaagatcttctcgccggc 113

---

>gb|AF101422.1|AF101422 Cichorium intybus cytochrome mRNA, partial cds
          Length = 336

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 216/272 (79%)
 Strand = Plus / Minus

                                                                       
Query: 325 aggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttg 384
           ||||| ||||| ||||| ||||| || || ||||| ||||| || ||||| |||||||| 
Sbjct: 320 aggtatgcaataagatctgcacgctcttgaggctttttcagtcctgggaaaaccatcttt 261

                                                                       
Query: 385 gttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccac 444
           |||||||| |||||||||||||| || |||| |||||||||||  || || |||||||| 
Sbjct: 260 gttccagggatgtacttcttggggttgagcaggtagtcatacaatgtattttcctcccat 201

                                                                       
Query: 445 tccacagccttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgc 504
              || ||||||   ||||| || ||||| || ||||| ||||| || || || ||||||
Sbjct: 200 gtaaccgccttggatttgttagcagcagaataagagtatccagcagtcgttccagactgc 141

                                                                       
Query: 505 ctcccaaacagaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtg 564
           || ||||| || ||||  |  || || ||||| |||||||| |||||    |||||||||
Sbjct: 140 cttccaaatagtccattaagattgggtccttgtttgtggccggcgcctttctcgacggtg 81

                                           
Query: 565 tggcactgcgcgcacttggtcttgaagatctt 596
           || || || ||||| || ||||||||||||||
Sbjct: 80  tgacattgagcgcatttagtcttgaagatctt 49

---

>gb|AC155340.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone
              KBrH020D15, complete sequence
          Length = 143633

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                          
Query: 321    cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
              ||||| ||| || ||||||||||||||||| || |||||||| || ||||||||||||||
Sbjct: 102836 cttcaagtaggcgatgagatcagcacggtcttgaggcttcttgagcccagggaagaccat 102895

                                  
Query: 381    cttggttccaggaatgtact 400
              ||| ||||||||||||||||
Sbjct: 102896 cttcgttccaggaatgtact 102915



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 101/120 (84%)
 Strand = Plus / Plus

                                                                          
Query: 399    cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458
              ||||||||| || |||||||| || ||||  || ||||| ||||| |||||||| |||||
Sbjct: 103005 cttcttggggttgagcaagtaatcgtacaaggtcttctcttcccattccacagctttgtt 103064

                                                                          
Query: 459    cttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaacagacc 518
              |||||| || |||||||| ||||||||||| || || || ||||| || |||||||||||
Sbjct: 103065 cttgttagcagcagagtaagagtaaccagctgttgttccagactgtcttccaaacagacc 103124



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                        
Query: 555    gtcgacggtgtggcactgcgcgcacttggtcttgaagatctt 596
              |||||||||||| ||||| || ||||||||| ||||||||||
Sbjct: 103473 gtcgacggtgtgacactgagcacacttggtcctgaagatctt 103514

---

>dbj|AK060676.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-B03, full
           insert sequence
          Length = 295

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 96/112 (85%), Gaps = 3/112 (2%)
 Strand = Plus / Minus

                                                                       
Query: 313 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccaggg 372
           ||||| ||||||||||| || ||||||||||||||||||||||||| |||||| |||  |
Sbjct: 109 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcagtccattg 50

                                                               
Query: 373 aagaccatcttggttccaggaatgtacttcttgggattaagcaagtagtcat 424
           ||  |||||||||   ||||| |||||||||| ||| |||||| ||||||||
Sbjct: 49  aaccccatcttgg---caggagtgtacttcttaggagtaagcaggtagtcat 1

---

>gb|AC142095.9| Medicago truncatula clone mth2-14c17, complete sequence
          Length = 110037

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                         
Query: 399   cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458
             ||||||||| || |||||||| |||||||  || || |||||||| ||||||||||||||
Sbjct: 58340 cttcttggggttcagcaagtaatcatacaaggtcttttcctcccaatccacagccttgtt 58399

                                  
Query: 459   cttgtttgccgcagagtagga 479
             |||||| |||||||| |||||
Sbjct: 58400 cttgttggccgcagaatagga 58420



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                         
Query: 531   accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590
             |||||| |||||||| |||||   |||||||||||||||||| |||||||||||  ||||
Sbjct: 59819 accttgtttgtggccggcgcctttgtcgacggtgtggcactgagcgcacttggttctgaa 59878

                             
Query: 591   gatcttggcgccggcg 606
             ||||||  ||||||||
Sbjct: 59879 gatcttctcgccggcg 59894



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 66/79 (83%)
 Strand = Plus / Plus

                                                                         
Query: 322   ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381
             ||||| || ||||| ||||||||||| || || |||||||| |||||||| || ||||||
Sbjct: 58014 ttcagatatgcaataagatcagcacgttcttgaggcttcttaagaccaggaaaaaccatc 58073

                                
Query: 382   ttggttccaggaatgtact 400
             || || || || |||||||
Sbjct: 58074 tttgtccctgggatgtact 58092

---

>gb|AC171534.4| Medicago truncatula chromosome 7 BAC clone mth2-90a20, complete
             sequence
          Length = 88903

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                         
Query: 399   cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458
             ||||||||| || |||||||| |||||||  || || |||||||| ||||||||||||||
Sbjct: 80291 cttcttggggttcagcaagtaatcatacaaggtcttttcctcccaatccacagccttgtt 80350

                                  
Query: 459   cttgtttgccgcagagtagga 479
             |||||| |||||||| |||||
Sbjct: 80351 cttgttggccgcagaatagga 80371



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                         
Query: 531   accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590
             |||||| |||||||| |||||   |||||||||||||||||| |||||||||||  ||||
Sbjct: 81770 accttgtttgtggccggcgcctttgtcgacggtgtggcactgagcgcacttggttctgaa 81829

                             
Query: 591   gatcttggcgccggcg 606
             ||||||  ||||||||
Sbjct: 81830 gatcttctcgccggcg 81845



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 66/79 (83%)
 Strand = Plus / Plus

                                                                         
Query: 322   ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381
             ||||| || ||||| ||||||||||| || || |||||||| |||||||| || ||||||
Sbjct: 79965 ttcagatatgcaataagatcagcacgttcttgaggcttcttaagaccaggaaaaaccatc 80024

                                
Query: 382   ttggttccaggaatgtact 400
             || || || || |||||||
Sbjct: 80025 tttgtccctgggatgtact 80043

---

>ref|NM_117072.2| Arabidopsis thaliana electron carrier/ electron transporter
           AT4G10040 mRNA, complete cds
          Length = 647

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 207/263 (78%)
 Strand = Plus / Minus

                                                                       
Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393
           |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| 
Sbjct: 396 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 337

                                                                       
Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453
           ||||||||||| ||||| | |||||| || || ||||| ||||||||||| | |||||||
Sbjct: 336 atgtacttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 277

                                                                       
Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513
            || | ||||| || |||||||| || || || |  || || || || || || ||||||
Sbjct: 276 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 217

                                                                       
Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573
           |  |||| ||| || || ||||| ||||| || || ||    ||||||||||| ||||| 
Sbjct: 216 aatccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactga 157

                                  
Query: 574 gcgcacttggtcttgaagatctt 596
           |||||||||||  ||||||||||
Sbjct: 156 gcgcacttggttctgaagatctt 134

---

>gb|AY079373.1| Arabidopsis thaliana putative cytochrome c protein (At4g10040)
           mRNA, complete cds
          Length = 370

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 207/263 (78%)
 Strand = Plus / Minus

                                                                       
Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393
           |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| 
Sbjct: 311 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 252

                                                                       
Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453
           ||||||||||| ||||| | |||||| || || ||||| ||||||||||| | |||||||
Sbjct: 251 atgtacttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 192

                                                                       
Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513
            || | ||||| || |||||||| || || || |  || || || || || || ||||||
Sbjct: 191 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 132

                                                                       
Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573
           |  |||| ||| || || ||||| ||||| || || ||    ||||||||||| ||||| 
Sbjct: 131 aatccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactga 72

                                  
Query: 574 gcgcacttggtcttgaagatctt 596
           |||||||||||  ||||||||||
Sbjct: 71  gcgcacttggttctgaagatctt 49

---

>gb|AY045944.1| Arabidopsis thaliana putative cytochrome c protein (At4g10040)
           mRNA, complete cds
          Length = 664

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 207/263 (78%)
 Strand = Plus / Minus

                                                                       
Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393
           |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| 
Sbjct: 396 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 337

                                                                       
Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453
           ||||||||||| ||||| | |||||| || || ||||| ||||||||||| | |||||||
Sbjct: 336 atgtacttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 277

                                                                       
Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513
            || | ||||| || |||||||| || || || |  || || || || || || ||||||
Sbjct: 276 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 217

                                                                       
Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573
           |  |||| ||| || || ||||| ||||| || || ||    ||||||||||| ||||| 
Sbjct: 216 aatccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactga 157

                                  
Query: 574 gcgcacttggtcttgaagatctt 596
           |||||||||||  ||||||||||
Sbjct: 156 gcgcacttggttctgaagatctt 134

---

>emb|BX828516.1|CNS0A2QS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL10ZG07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 580

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 207/263 (78%)
 Strand = Plus / Minus

                                                                       
Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393
           |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| 
Sbjct: 350 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 291

                                                                       
Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453
           ||||||||||| ||||| | |||||| || || ||||| ||||||||||| | |||||||
Sbjct: 290 atgtacttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 231

                                                                       
Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513
            || | ||||| || |||||||| || || || |  || || || || || || ||||||
Sbjct: 230 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 171

                                                                       
Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573
           |  |||| ||| || || ||||| ||||| || || ||    ||||||||||| ||||| 
Sbjct: 170 aatccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactga 111

                                  
Query: 574 gcgcacttggtcttgaagatctt 596
           |||||||||||  ||||||||||
Sbjct: 110 gcgcacttggttctgaagatctt 88

---

>gb|AY087056.1| Arabidopsis thaliana clone 31115 mRNA, complete sequence
          Length = 616

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 207/263 (78%)
 Strand = Plus / Minus

                                                                       
Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393
           |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| 
Sbjct: 389 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 330

                                                                       
Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453
           ||||||||||| ||||| | |||||| || || ||||| ||||||||||| | |||||||
Sbjct: 329 atgtacttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 270

                                                                       
Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513
            || | ||||| || |||||||| || || || |  || || || || || || ||||||
Sbjct: 269 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 210

                                                                       
Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573
           |  |||| ||| || || ||||| ||||| || || ||    ||||||||||| ||||| 
Sbjct: 209 aatccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactga 150

                                  
Query: 574 gcgcacttggtcttgaagatctt 596
           |||||||||||  ||||||||||
Sbjct: 149 gcgcacttggttctgaagatctt 127

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                     
Query: 313      gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 365
                ||||| ||||||||||| || ||||||||||||||||||||||||| ||||||
Sbjct: 38439384 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 38439332



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                            
Query: 535      tgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatc 594
                ||||||||||| ||| ||  ||||||||  ||||| | ||||||||||||| ||||||||
Sbjct: 38437067 tgcttgtggccggcggccttgtcgacggcatggcagtacgcgcacttggtcctgaagatc 38437008

                           
Query: 595      ttggcgccggc 605
                ||  |||||||
Sbjct: 38437007 ttctcgccggc 38436997



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                             
Query: 399      cttcttgggattaagcaagtagtcatacagagtgttctcctccca 443
                |||||| ||| |||||| ||||||||||| ||||||||| |||||
Sbjct: 38438300 cttcttaggagtaagcaggtagtcatacaaagtgttctcttccca 38438256

---

>gb|AF229199.1|AF229199 Oryza sativa chromosome 1 clone OSJNBa0048I01, complete sequence
          Length = 193444

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                  
Query: 313   gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 365
             ||||| ||||||||||| || ||||||||||||||||||||||||| ||||||
Sbjct: 32481 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 32429



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                         
Query: 535   tgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatc 594
             ||||||||||| ||| ||  ||||||||  ||||| | ||||||||||||| ||||||||
Sbjct: 30164 tgcttgtggccggcggccttgtcgacggcatggcagtacgcgcacttggtcctgaagatc 30105

                        
Query: 595   ttggcgccggc 605
             ||  |||||||
Sbjct: 30104 ttctcgccggc 30094



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                          
Query: 399   cttcttgggattaagcaagtagtcatacagagtgttctcctccca 443
             |||||| ||| |||||| ||||||||||| ||||||||| |||||
Sbjct: 31397 cttcttaggagtaagcaggtagtcatacaaagtgttctcttccca 31353

---

>dbj|AP003379.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408G07
          Length = 126631

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                  
Query: 313   gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 365
             ||||| ||||||||||| || ||||||||||||||||||||||||| ||||||
Sbjct: 24799 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 24747



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                         
Query: 535   tgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaagatc 594
             ||||||||||| ||| ||  ||||||||  ||||| | ||||||||||||| ||||||||
Sbjct: 22482 tgcttgtggccggcggccttgtcgacggcatggcagtacgcgcacttggtcctgaagatc 22423

                        
Query: 595   ttggcgccggc 605
             ||  |||||||
Sbjct: 22422 ttctcgccggc 22412



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                          
Query: 399   cttcttgggattaagcaagtagtcatacagagtgttctcctccca 443
             |||||| ||| |||||| ||||||||||| ||||||||| |||||
Sbjct: 23715 cttcttaggagtaagcaggtagtcatacaaagtgttctcttccca 23671

---

>gb|M35173.1|CRECYCA C.reinhardtii mitochondrial apocytochrome c (cyc) mRNA, complete
           cds
          Length = 662

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 97/117 (82%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| ||||| ||||| || || ||||  ||||||||||| |||| ||| |||||
Sbjct: 365 cttcaggtaggcaatcagatcggcgcgctcctcgggcttcttcaggccagcgaacaccat 306

                                                                    
Query: 381 cttggttccaggaatgtacttcttgggattaagcaagtagtcatacagagtgttctc 437
           |||| | ||||| |||||||||||||| || |||| ||| || || |||||| ||||
Sbjct: 305 cttgttgccaggcatgtacttcttggggttcagcaggtactcgtagagagtgctctc 249



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 564 gtggcactgcgcgcacttggtcttgaagatctt 596
           |||||| |||||||||||||||||||| |||||
Sbjct: 122 gtggcattgcgcgcacttggtcttgaaaatctt 90

---

>gb|AF000657.1|ATAF000657 Arabidopsis thaliana BAC F19G10, complete sequence
          Length = 92948

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                         
Query: 321   cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
             ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 90776 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 90835

                                 
Query: 381   cttggttccaggaatgtact 400
             |||||| || || |||||||
Sbjct: 90836 cttggtacctggtatgtact 90855



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 76/90 (84%)
 Strand = Plus / Plus

                                                                         
Query: 399   cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458
             ||||||||| || |||||||| || ||||  |  ||||| ||||| |||||||| |||||
Sbjct: 90933 cttcttggggttgagcaagtaatcgtacaaggccttctcttcccattccacagctttgtt 90992

                                           
Query: 459   cttgtttgccgcagagtaggagtaaccagc 488
             |||||| || |||||||| |||||||||||
Sbjct: 90993 cttgttagcagcagagtaagagtaaccagc 91022



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 531   accttgcttgtggcccgcgcccgcgtcgacggtgtggcactgcgcgcacttggtcttgaa 590
             |||||| ||||| || ||||| || ||||||||||| ||||| || ||||||||| ||||
Sbjct: 91544 accttgtttgtgaccggcgcctgcttcgacggtgtgacactgagcacacttggtcctgaa 91603

                   
Query: 591   gatctt 596
             ||||||
Sbjct: 91604 gatctt 91609

---

>emb|BX826474.1|CNS0A37Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB2ZB01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 540

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 206/263 (78%)
 Strand = Plus / Minus

                                                                       
Query: 334 atgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttggttccagga 393
           |||||||| ||||| || || || || ||||| ||||| || ||||| || |||||||| 
Sbjct: 290 atgagatcggcacgatcttgcggttttttcagtccaggaaacaccatttttgttccaggg 231

                                                                       
Query: 394 atgtacttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagcc 453
           |||||| |||| ||||| | |||||| || || ||||| ||||||||||| | |||||||
Sbjct: 230 atgtacgtcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagcc 171

                                                                       
Query: 454 ttgttcttgtttgccgcagagtaggagtaaccagcggtggtgcccgactgcctcccaaac 513
            || | ||||| || |||||||| || || || |  || || || || || || ||||||
Sbjct: 170 atgcttttgttagcagcagagtaagaatatcctggagttgttccagattgtcttccaaac 111

                                                                       
Query: 514 agaccatgcaagtttggaccttgcttgtggcccgcgcccgcgtcgacggtgtggcactgc 573
           |  |||| ||| || || ||||| ||||| || || ||    ||||||||||| ||||| 
Sbjct: 110 aagccattcaaattcggtccttgtttgtgaccggcacctttctcgacggtgtgacactgt 51

                                  
Query: 574 gcgcacttggtcttgaagatctt 596
           |||||||||||  ||||||||||
Sbjct: 50  gcgcacttggttctgaagatctt 28

---

>ref|NM_102131.3| Arabidopsis thaliana unknown protein AT1G22850 mRNA, complete cds
          Length = 1563

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                        
Query: 321  cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
            ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 1500 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 1559

                
Query: 381  cttg 384
            ||||
Sbjct: 1560 cttg 1563

---

>gb|AY431227.1| Aedes aegypti ASAP ID: 35977 cyctochrome c mRNA sequence
          Length = 1095

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 322 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381
           |||||||| || |||||||| ||||| || |  ||||||||||| |||| ||||| ||||
Sbjct: 420 ttcaggtaagcgatgagatcggcacgctcattgggcttcttcaggccagcgaagatcatc 361

                                  
Query: 382 ttggttccaggaatgtacttctt 404
           || || ||||| |||||||||||
Sbjct: 360 ttcgtgccagggatgtacttctt 338

---

>gb|DQ440105.1| Aedes aegypti clone AE-442 mitochondrial cytochrome c mRNA,
           complete cds; nuclear gene for mitochondrial product
          Length = 327

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 322 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381
           |||||||| || |||||||| ||||| || |  ||||||||||| |||| ||||| ||||
Sbjct: 311 ttcaggtaagcgatgagatcggcacgctcattgggcttcttcaggccagcgaagatcatc 252

                                  
Query: 382 ttggttccaggaatgtacttctt 404
           || || ||||| |||||||||||
Sbjct: 251 ttcgtgccagggatgtacttctt 229

---

>ref|XM_567012.1| Cryptococcus neoformans var. neoformans JEC21 electron carrier
           (CNA06950) partial mRNA
          Length = 482

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||| |||||||  ||| |||||||||| ||||||||||||||||||||
Sbjct: 335 cttcttgagaccagcaaaggccatcttggtaccaggaatgtacttcttggg 285

---

>emb|CR937943.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YP13AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 785

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 322 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 381
           |||||||| || |||||||| ||||| || |  ||||||||||| |||| ||||| ||||
Sbjct: 414 ttcaggtaagcgatgagatcggcacgctcgttgggcttcttcaggccagcgaagatcatc 355

                                  
Query: 382 ttggttccaggaatgtacttctt 404
           || || ||||| |||||||||||
Sbjct: 354 ttcgtgccagggatgtacttctt 332

---

>gb|DQ122874.1| Chlamydomonas incerta mitochondrial apocytochrome c (CYC) mRNA,
           complete cds; nuclear gene for mitochondrial product
          Length = 609

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttgggattaagc 414
           ||||||||||| |||| ||| ||||||||| | || || |||||||||||||| || |||
Sbjct: 305 ggcttcttcaggccagcgaacaccatcttgttgccgggcatgtacttcttggggttcagc 246

                                  
Query: 415 aagtagtcatacagagtgttctc 437
           | ||| || ||||||||| ||||
Sbjct: 245 aggtactcgtacagagtgctctc 223



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 564 gtggcactgcgcgcacttggtcttgaagatctt 596
           |||||| |||||||||||||||||||| |||||
Sbjct: 96  gtggcattgcgcgcacttggtcttgaaaatctt 64

---

>gb|DQ176429.1| Capra hircus mitochondrial cytochrome c mRNA, partial cds; nuclear
           gene for mitochondrial product
          Length = 315

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| ||||||||||||||| |||||||||||||||||
Sbjct: 245 aagatcatcttggttccagggatgtacttcttgggatt 208

---

>emb|X59459.1|ATATCC1G A.thaliana AtCc-1 gene for cytochrome c
          Length = 1263

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 346 cggtcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttg 405
           |||||||  |||||||| ||||||  |||| |||||||||| || |||||||||||||||
Sbjct: 634 cggtccttgggcttcttgagaccaccgaaggccatcttggtaccgggaatgtacttcttg 575

             
Query: 406 gg 407
           ||
Sbjct: 574 gg 573

---

>gb|M85253.1|ATHATCC1A Arabidoposis thaliana AtCc-1 DNA, complete cds
          Length = 1264

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 346 cggtcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttg 405
           |||||||  |||||||| ||||||  |||| |||||||||| || |||||||||||||||
Sbjct: 634 cggtccttgggcttcttgagaccaccgaaggccatcttggtaccgggaatgtacttcttg 575

             
Query: 406 gg 407
           ||
Sbjct: 574 gg 573

---

>gb|AY071701.1| Drosophila melanogaster RH17228 full insert cDNA
          Length = 763

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||||||||||| | ||||| ||||||||| || || ||||||||||||||
Sbjct: 422 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 370

---

>ref|XM_971011.1| PREDICTED: Tribolium castaneum similar to CG17903-PA, transcript
           variant 2 (LOC659690), mRNA
          Length = 685

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||||||||||||| ||||||||| || ||||| || ||||| ||||||||
Sbjct: 327 ggcttcttcagaccagcgaagaccatttttgttccggggatgtatttcttggg 275



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||| ||||||||||||||||||
Sbjct: 126 tcgacagtgtggcactgcgcgcac 103

---

>ref|XM_962134.1| PREDICTED: Tribolium castaneum similar to CG17903-PA, transcript
           variant 1 (LOC659690), mRNA
          Length = 823

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||||||||||||| ||||||||| || ||||| || ||||| ||||||||
Sbjct: 465 ggcttcttcagaccagcgaagaccatttttgttccggggatgtatttcttggg 413



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||| ||||||||||||||||||
Sbjct: 264 tcgacagtgtggcactgcgcgcac 241

---

>emb|X01760.1|DMCYCDC4 Drosophila melanogaster cytochrome c gene DC4
          Length = 1559

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 355  ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
            |||||||||||||| | ||||| ||||||||| || || ||||||||||||||
Sbjct: 1045 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 993

---

>ref|NM_057828.3| Drosophila melanogaster Cytochrome c proximal CG17903-RA (Cyt-c-p),
           mRNA
          Length = 754

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||||||||||| | ||||| ||||||||| || || ||||||||||||||
Sbjct: 422 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 370

---

>gb|AC093097.1| Drosophila melanogaster, chromosome 2L, region 36A-36B, BAC clone
             BACR26O03, complete sequence
          Length = 175413

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                  
Query: 355   ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
             |||||||||||||| | ||||| ||||||||| || || ||||||||||||||
Sbjct: 95417 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 95365

---

>gb|AC006214.1|AC006214 Drosophila melanogaster, chromosome 2L, region 36A7-36A13, P1 clones
              DS04680 and DS00592, complete sequence
          Length = 129779

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                   
Query: 355    ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
              |||||||||||||| | ||||| ||||||||| || || ||||||||||||||
Sbjct: 127326 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 127274

---

>gb|AE003652.2| Drosophila melanogaster chromosome 2L, section 61 of 83 of the complete
              sequence
          Length = 262525

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                   
Query: 355    ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
              |||||||||||||| | ||||| ||||||||| || || ||||||||||||||
Sbjct: 106451 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 106399

---

>gb|M11381.1|DROCYCE D.melanogaster cytochrome C gene
          Length = 1015

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||||||||||| | ||||| ||||||||| || || ||||||||||||||
Sbjct: 621 ggcttcttcagaccggcgaagatcatcttggtgccggggatgtacttcttggg 569

---

>emb|BX071915.1|CNS09RNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 727 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 786

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 787 cttcgtgccggggatgtacttctt 810



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 962 tcgacggtgtggcactgggcgcac 985

---

>emb|BX069282.1|CNS09PME Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1030

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 742 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 801

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 802 cttcgtgccggggatgtacttctt 825



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 556  tcgacggtgtggcactgcgcgcac 579
            ||||||||||||||||| ||||||
Sbjct: 977  tcgacggtgtggcactgggcgcac 1000

---

>emb|BX068476.1|CNS09P00 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 713 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 772

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 773 cttcgtgccggggatgtacttctt 796

---

>emb|BX068178.1|CNS09ORQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 735 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 794

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 795 cttcgtgccggggatgtacttctt 818

---

>emb|BX067682.1|CNS09ODY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 715 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 774

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 775 cttcgtgccggggatgtacttctt 798



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 950 tcgacggtgtggcactgggcgcac 973

---

>emb|BX066463.1|CNS09NG3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 723 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 782

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 783 cttcgtgccggggatgtacttctt 806

---

>emb|BX064703.1|CNS09M37 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 258

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 62  cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 121

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 122 cttcgtgccggggatgtacttctt 145

---

>emb|BX062557.1|CNS09KFL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 730 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 789

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 790 cttcgtgccggggatgtacttctt 813

---

>emb|BX061603.1|CNS09JP3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 709 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 768

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 769 cttcgtgccggggatgtacttctt 792

---

>emb|BX060541.1|CNS09IVL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 715 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 774

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 775 cttcgtgccggggatgtacttctt 798

---

>emb|BX060188.1|CNS09ILS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 716 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 775

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 776 cttcgtgccggggatgtacttctt 799

---

>emb|BX058941.1|CNS09HN5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 716 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 775

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 776 cttcgtgccggggatgtacttctt 799



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 951 tcgacggtgtggcactgggcgcac 974

---

>emb|BX058045.1|CNS09GY9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 721 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 780

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 781 cttcgtgccggggatgtacttctt 804

---

>emb|BX058044.1|CNS09GY8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 344 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 285

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 284 cttcgtgccggggatgtacttctt 261



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 109 tcgacggtgtggcactgggcgcac 86

---

>emb|BX057320.1|CNS09GE4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 735 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 794

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 795 cttcgtgccggggatgtacttctt 818

---

>emb|BX057317.1|CNS09GE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 400 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 341

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 340 cttcgtgccggggatgtacttctt 317



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 165 tcgacggtgtggcactgggcgcac 142

---

>emb|BX055390.1|CNS09EWI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 708 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 767

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 768 cttcgtgccggggatgtacttctt 791

---

>emb|BX055389.1|CNS09EWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 394 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 335

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 334 cttcgtgccggggatgtacttctt 311



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 159 tcgacggtgtggcactgggcgcac 136

---

>emb|BX053158.1|CNS09D6I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 344 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 285

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 284 cttcgtgccggggatgtacttctt 261



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 109 tcgacggtgtggcactgggcgcac 86

---

>emb|BX052789.1|CNS09CW9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 708 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 767

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 768 cttcgtgccggggatgtacttctt 791

---

>emb|BX030987.1|CNS08W2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 735 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 794

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 795 cttcgtgccggggatgtacttctt 818

---

>emb|BX043390.1|CNS095N6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 740 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 799

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 800 cttcgtgccggggatgtacttctt 823

---

>emb|BX043132.1|CNS095G0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 373 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 432

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 433 cttcgtgccggggatgtacttctt 456

---

>emb|BX040506.1|CNS093F2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 677

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 524 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 583

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 584 cttcgtgccggggatgtacttctt 607

---

>emb|BX039822.1|CNS092W2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 708 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 767

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 768 cttcgtgccggggatgtacttctt 791

---

>emb|BX039821.1|CNS092W1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 345 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 286

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 285 cttcgtgccggggatgtacttctt 262

---

>emb|BX036850.1|CNS090LI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 717 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 776

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 777 cttcgtgccggggatgtacttctt 800



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 952 tcgacggtgtggcactgggcgcac 975

---

>emb|BX036056.1|CNS08ZZG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 371

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 262 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 321

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 322 cttcgtgccggggatgtacttctt 345

---

>emb|BX036052.1|CNS08ZZC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 714 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 773

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 774 cttcgtgccggggatgtacttctt 797

---

>emb|BX035216.1|CNS08ZC4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 700 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 759

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 760 cttcgtgccggggatgtacttctt 783

---

>emb|BX032226.1|CNS08X12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 737 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 796

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 797 cttcgtgccggggatgtacttctt 820



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 972 tcgacggtgtggcactgggcgcac 995

---

>emb|BX031975.1|CNS08WU3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 713 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 772

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 773 cttcgtgccggggatgtacttctt 796

---

>emb|BX030340.1|CNS08VKO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA45BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 709 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 768

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 769 cttcgtgccggggatgtacttctt 792

---

>emb|BX027835.1|CNS08TN3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 704 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 763

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 764 cttcgtgccggggatgtacttctt 787

---

>emb|BX026220.1|CNS08SE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 678 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 737

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 738 cttcgtgccggggatgtacttctt 761

---

>emb|BX024107.1|CNS08QRJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 668 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 727

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 728 cttcgtgccggggatgtacttctt 751

---

>emb|BX024106.1|CNS08QRI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 433

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 217 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 158

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 157 cttcgtgccggggatgtacttctt 134

---

>emb|BX023752.1|CNS08QHO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 753 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 812

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 813 cttcgtgccggggatgtacttctt 836

---

>emb|BX019497.1|CNS08N7H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 728 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 787

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 788 cttcgtgccggggatgtacttctt 811

---

>emb|BX018904.1|CNS08MR0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 715 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 774

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 775 cttcgtgccggggatgtacttctt 798

---

>emb|BX018903.1|CNS08MQZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 785

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 307 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 248

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 247 cttcgtgccggggatgtacttctt 224



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 72  tcgacggtgtggcactgggcgcac 49

---

>emb|BX017251.1|CNS08LH3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 504

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 298 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 239

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 238 cttcgtgccggggatgtacttctt 215



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 63  tcgacggtgtggcactgggcgcac 40

---

>emb|BX015930.1|CNS08KGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 712 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 771

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 772 cttcgtgccggggatgtacttctt 795

---

>emb|BX015215.1|CNS08JWJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 727 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 786

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 787 cttcgtgccggggatgtacttctt 810

---

>emb|BX010251.1|CNS08G2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 678 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 737

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 738 cttcgtgccggggatgtacttctt 761



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 913 tcgacggtgtggcactgggcgcac 936

---

>emb|BX007964.1|CNS08EB4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 721 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 780

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 781 cttcgtgccggggatgtacttctt 804



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 956 tcgacggtgtggcactgggcgcac 979

---

>dbj|AK121277.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108A04, full
           insert sequence
          Length = 781

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 349 tcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtact 400
           ||||| ||||||||||| || ||||| ||||||||||| || ||||||||||
Sbjct: 564 tcctgcggcttcttcaggccggggaacaccatcttggtgcccggaatgtact 513



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 562 gtgtggcactgcgcgcacttggtcttgaagatctt 596
           ||||||||||||||||||||||||  |||||||||
Sbjct: 202 gtgtggcactgcgcgcacttggtccggaagatctt 168

---

>ref|XM_310154.2| Anopheles gambiae str. PEST ENSANGP00000020091
           (ENSANGG00000017602), mRNA
          Length = 1083

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 407 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 348

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 347 cttcgtgccggggatgtacttctt 324



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 172 tcgacggtgtggcactgggcgcac 149

---

>ref|XM_951393.1| Neurospora crassa OR74A CYTOCHROME C (NCU01808.1) partial mRNA
          Length = 357

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||| ||||||  |||| |||||||||| ||||| ||||||||||||||
Sbjct: 276 cttcttgagaccaccgaaggccatcttggtaccagggatgtacttcttggg 226

---

>ref|XM_328246.1| Neurospora crassa OR74A CYTOCHROME C (NCU01808.1) partial mRNA
          Length = 357

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||| ||||||  |||| |||||||||| ||||| ||||||||||||||
Sbjct: 276 cttcttgagaccaccgaaggccatcttggtaccagggatgtacttcttggg 226

---

>emb|BX036717.1|CNS090HT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 270

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| ||||| |||||
Sbjct: 193 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggggaacaccat 252

              
Query: 381 ctt 383
           |||
Sbjct: 253 ctt 255

---

>emb|BX012845.1|CNS08I2P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| ||||| |||||
Sbjct: 727 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggggaacaccat 786

              
Query: 381 ctt 383
           |||
Sbjct: 787 ctt 789

---

>emb|Z99829.1|CRCYC1GEN Chlamydomonas reinhardtii CYC1 gene encoding cytochrome c
          Length = 3078

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 66/79 (83%)
 Strand = Plus / Minus

                                                                        
Query: 321  cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
            ||||||||| ||||| ||||| || || ||||  ||||||||||| |||| ||| |||||
Sbjct: 2540 cttcaggtaggcaatcagatcggcgcgctcctcgggcttcttcaggccagcgaacaccat 2481

                               
Query: 381  cttggttccaggaatgtac 399
            |||| | ||||| ||||||
Sbjct: 2480 cttgttgccaggcatgtac 2462



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 564  gtggcactgcgcgcacttggtcttgaagatctt 596
            |||||| |||||||||||||||||||| |||||
Sbjct: 1916 gtggcattgcgcgcacttggtcttgaaaatctt 1884

---

>emb|X05506.1|NCCYTCR N.crassa mRNA for cytochrome c
          Length = 665

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||| ||||||  |||| |||||||||| ||||| ||||||||||||||
Sbjct: 381 cttcttgagaccaccgaaggccatcttggtaccagggatgtacttcttggg 331

---

>emb|AL669998.1|NCB1K11 Neurospora crassa DNA linkage group II BAC clone B1K11
          Length = 88013

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 357  cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
            |||||| ||||||  |||| |||||||||| ||||| ||||||||||||||
Sbjct: 5251 cttcttgagaccaccgaaggccatcttggtaccagggatgtacttcttggg 5301

---

>dbj|AB085853.1| Rosellinia necatrix cytc gene for cytochrome c, complete cds
          Length = 1692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 357  cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
            |||||| ||||||  |||| |||||||||| ||||| ||||||||||||||
Sbjct: 1161 cttcttgagaccaccgaaggccatcttggtgccagggatgtacttcttggg 1111

---

>gb|L19358.1|NEUCYTOC Neurospora crassa cytochrome c (cyc-1) gene, complete cds including
            cyc-1-12 mutation
          Length = 1465

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 357  cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
            |||||| ||||||  |||| |||||||||| ||||| ||||||||||||||
Sbjct: 1221 cttcttgagaccaccgaaggccatcttggtaccagggatgtacttcttggg 1171

---

>ref|XM_587961.2| PREDICTED: Bos taurus similar to Cytochrome c, somatic (LOC510767),
           mRNA
          Length = 1386

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| |||||||| |||||||||||||||||
Sbjct: 359 aagatcatctttgttccagggatgtacttcttgggatt 322

---

>gb|BC074190.1| Xenopus laevis MGC82081 protein, mRNA (cDNA clone MGC:82081
           IMAGE:7011609), complete cds
          Length = 668

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| |||||||||||||||||||| |||||
Sbjct: 296 aagatcatctttgttccaggaatgtacttcttaggatt 259

---

>ref|XM_583465.2| PREDICTED: Bos taurus similar to Cytochrome c, somatic (LOC506941),
           mRNA
          Length = 911

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| |||||||| |||||||||||||||||
Sbjct: 311 aagatcatctttgttccagggatgtacttcttgggatt 274

---

>gb|BC059740.1| Xenopus tropicalis cytochrome c, testis, mRNA (cDNA clone MGC:75709
           IMAGE:5380711), complete cds
          Length = 758

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| |||||||||||||||||||| |||||
Sbjct: 421 aagatcatctttgttccaggaatgtacttcttaggatt 384

---

>gb|BC105397.1| Bos taurus similar to Cytochrome c, somatic, mRNA (cDNA clone
           MGC:128356 IMAGE:7987141), complete cds
          Length = 992

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| |||||||| |||||||||||||||||
Sbjct: 379 aagatcatctttgttccagggatgtacttcttgggatt 342

---

>ref|NM_203564.1| Xenopus tropicalis cytochrome c, testis (cyct), mRNA
          Length = 758

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| |||||||||||||||||||| |||||
Sbjct: 421 aagatcatctttgttccaggaatgtacttcttaggatt 384

---

>emb|CR760663.2| Xenopus tropicalis finished cDNA, clone TEgg084a23
          Length = 594

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| |||||||||||||||||||| |||||
Sbjct: 277 aagatcatctttgttccaggaatgtacttcttaggatt 240

---

>emb|AJ416378.1|PSP416378 Polytomella sp. 'Pringsheim 198.80' mRNA for mitochondrial
           cytochrome c (cyc gene)
          Length = 643

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 564 gtggcactgcgcgcacttggtcttgaagatctt 596
           ||||||||| ||||||||||||||||| |||||
Sbjct: 118 gtggcactgagcgcacttggtcttgaaaatctt 86

---

>emb|BX033449.1|CNS08XZ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 344 cacggtcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttct 403
           |||| |||| ||||||||||||||| | ||| |||||||| || || || ||||||||||
Sbjct: 690 cacgctcctttggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttct 749

            
Query: 404 t 404
           |
Sbjct: 750 t 750



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 902 tcgacggtgtggcactgggcgcac 925

---

>emb|AL161516.2|ATCHRIV28 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 28
          Length = 198005

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                       
Query: 556    tcgacggtgtggcactgcgcgcacttggtcttgaagatctt 596
              ||||||||||| ||||| |||||||||||  ||||||||||
Sbjct: 102405 tcgacggtgtgacactgagcgcacttggttctgaagatctt 102365



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                          
Query: 399    cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458
              |||||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| || |
Sbjct: 102751 cttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagccatgct 102692

                                
Query: 459    cttgtttgccgcagagta 476
               ||||| || ||||||||
Sbjct: 102691 tttgttagcagcagagta 102674

---

>emb|AL049487.1|ATF28M11 Arabidopsis thaliana DNA chromosome 4, BAC clone F28M11 (ESSA
            project)
          Length = 85907

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 556  tcgacggtgtggcactgcgcgcacttggtcttgaagatctt 596
            ||||||||||| ||||| |||||||||||  ||||||||||
Sbjct: 4045 tcgacggtgtgacactgagcgcacttggttctgaagatctt 4005



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                        
Query: 399  cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458
            |||||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| || |
Sbjct: 4391 cttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagccatgct 4332

                              
Query: 459  cttgtttgccgcagagta 476
             ||||| || ||||||||
Sbjct: 4331 tttgttagcagcagagta 4314

---

>emb|AL049481.1|ATT5L19 Arabidopsis thaliana DNA chromosome 4, BAC clone  T5L19 (ESSA project)
          Length = 92495

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 556   tcgacggtgtggcactgcgcgcacttggtcttgaagatctt 596
             ||||||||||| ||||| |||||||||||  ||||||||||
Sbjct: 62977 tcgacggtgtgacactgagcgcacttggttctgaagatctt 62937



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                         
Query: 399   cttcttgggattaagcaagtagtcatacagagtgttctcctcccactccacagccttgtt 458
             |||||| ||||| | |||||| || || ||||| ||||||||||| | ||||||| || |
Sbjct: 63323 cttcttaggattcaacaagtaatcgtaaagagtcttctcctcccaattcacagccatgct 63264

                               
Query: 459   cttgtttgccgcagagta 476
              ||||| || ||||||||
Sbjct: 63263 tttgttagcagcagagta 63246

---

>gb|DQ084330.1| Dermacentor variabilis clone 2 cytochrome C mRNA, complete cds;
           mitochondrial
          Length = 409

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtactt 401
           |||||| || |||| ||||||||||||||| || |||||||||||
Sbjct: 325 cttcttgaggccagcgaagaccatcttggtgcccggaatgtactt 281

---

>gb|DQ084329.1| Dermacentor variabilis clone 1 cytochrome C mRNA, complete cds;
           mitochondrial
          Length = 480

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtactt 401
           |||||| || |||| ||||||||||||||| || |||||||||||
Sbjct: 396 cttcttgaggccagcgaagaccatcttggtgcccggaatgtactt 352

---

>gb|AF038611.2| Caenorhabditis elegans cosmid E04A4, complete sequence
          Length = 23046

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 357   cttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
             |||||| || |||| ||| |||||||||||||| || |||||||||||
Sbjct: 21380 cttcttgagtccagcgaacaccatcttggttcctgggatgtacttctt 21427

---

>gb|AY559323.1| Pichia pastoris cytochrome c (CYC1) gene, complete cds
          Length = 333

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 377 ccatcttggttccaggaatgtacttctt 404
           ||||||||||||| ||||||||||||||
Sbjct: 262 ccatcttggttcctggaatgtacttctt 235

---

>ref|XM_532493.2| PREDICTED: Canis familiaris similar to Cytochrome c, somatic
           (LOC475258), mRNA
          Length = 1321

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 367 ccagggaagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| ||||| ||| || |||||||| |||||||||||||||||
Sbjct: 382 ccagcgaagatcatttttgttccagggatgtacttcttgggatt 339

---

>emb|BX053121.1|CNS09D5H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 438

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| | ||| |||||||||||||| | ||| |||||
Sbjct: 337 cttcaggtaggcgatcagatcgccacgcttctgcggcttcttcagaccggcgaacaccat 278

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 277 cttcgtgccggggatgtacttctt 254



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 102 tcgacggtgtggcactgggcgcac 79

---

>emb|BX054543.1|CNS09E8Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 349 tcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           ||||| |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 733 tcctgcggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 788

---

>emb|BX054542.1|CNS09E8Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 560

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 349 tcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           ||||| |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 318 tcctgcggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 263



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 111 tcgacggtgtggcactgggcgcac 88

---

>emb|BX045253.1|CNS0972X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 332

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| | ||| |||||||||||||| | ||| |||||
Sbjct: 326 cttcaggtaggcgatcagatcgccacgcttctgcggcttcttcagaccggcgaacaccat 267

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 266 cttcgtgccggggatgtacttctt 243

---

>emb|BX022008.1|CNS08P58 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 389

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||| ||||||| | ||| |||||
Sbjct: 198 cttcaggtaggcgatcagatcgccacgctcctgcggcttcctcagaccggcgaacaccat 257

                                   
Query: 381 cttggttccaggaatgtacttctt 404
           ||| || || || |||||||||||
Sbjct: 258 cttcgtgccggggatgtacttctt 281

---

>ref|NM_073755.2| Caenorhabditis elegans ZC116.2 (ZC116.2) mRNA, complete cds
          Length = 390

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 358 ttcttcagaccagggaagaccatcttggttccaggaatgtactt 401
           ||||||| ||||| |||||||||||| ||||| || ||||||||
Sbjct: 305 ttcttcaaaccagcgaagaccatcttagttccggggatgtactt 262

---

>ref|NM_068228.3| Caenorhabditis elegans E04A4.7 (E04A4.7) mRNA, complete cds
          Length = 525

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||| || |||| ||| |||||||||||||| || |||||||||||
Sbjct: 329 cttcttgagtccagcgaacaccatcttggttcctgggatgtacttctt 282

---

>gb|AY864613.1| Sus scrofa cytochrome c-like protein mRNA, complete cds
          Length = 1327

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 367 ccagggaagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| ||||| ||| || |||||||| |||||||||||||||||
Sbjct: 341 ccagcgaagatcatttttgttccagggatgtacttcttgggatt 298

---

>gb|AY610503.1| Sus scrofa clone rptbr0104_o5.y1.abd, mRNA sequence
          Length = 566

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 367 ccagggaagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| ||||| ||| || |||||||| |||||||||||||||||
Sbjct: 364 ccagcgaagatcatttttgttccagggatgtacttcttgggatt 321

---

>gb|AY610281.1| Sus scrofa clone rcki23_k5.y1.abd, mRNA sequence
          Length = 565

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 367 ccagggaagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| ||||| ||| || |||||||| |||||||||||||||||
Sbjct: 294 ccagcgaagatcatttttgttccagggatgtacttcttgggatt 251

---

>ref|XM_750550.1| Aspergillus fumigatus Af293 cytochrome c (Afu2g13110) partial mRNA
          Length = 708

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||||||||||  |||| |||||||||| || || ||| ||||||||||
Sbjct: 453 cttcttcagaccaccgaaggccatcttggtaccggggatgaacttcttggg 403

---

>ref|XM_391057.1| Gibberella zeae PH-1 chromosome 3 CYC_NEUCR Cytochrome c
           (FG10881.1) partial mRNA
          Length = 330

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| |||  |||| |||||||||| || || ||||||||||||||
Sbjct: 279 cttcttcaggccaccgaaggccatcttggtaccggggatgtacttcttggg 229

---

>emb|CR732655.1|CNS0GS9G Tetraodon nigroviridis full-length cDNA
          Length = 1192

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 aagaccatcttggttccaggaatgtacttcttggg 407
           |||| ||| |||||||||||||| |||||||||||
Sbjct: 306 aagatcattttggttccaggaatatacttcttggg 272

---

>emb|CR685667.2|CNS0FS0F Tetraodon nigroviridis full-length cDNA
          Length = 1202

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 aagaccatcttggttccaggaatgtacttcttggg 407
           |||| ||| |||||||||||||| |||||||||||
Sbjct: 320 aagatcattttggttccaggaatatacttcttggg 286

---

>emb|CR682724.1|CNS0FPQO Tetraodon nigroviridis full-length cDNA
          Length = 1218

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 aagaccatcttggttccaggaatgtacttcttggg 407
           |||| ||| |||||||||||||| |||||||||||
Sbjct: 354 aagatcattttggttccaggaatatacttcttggg 320

---

>emb|CR675102.2|CNS0FJVO Tetraodon nigroviridis full-length cDNA
          Length = 1144

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 aagaccatcttggttccaggaatgtacttcttggg 407
           |||| ||| |||||||||||||| |||||||||||
Sbjct: 241 aagatcattttggttccaggaatatacttcttggg 207

---

>emb|CR673433.2|CNS0FILB Tetraodon nigroviridis full-length cDNA
          Length = 1156

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 373 aagaccatcttggttccaggaatgtacttcttggg 407
           |||| ||| |||||||||||||| |||||||||||
Sbjct: 254 aagatcattttggttccaggaatatacttcttggg 220

---

>ref|XM_502612.1| Yarrowia lipolytica CLIB122, YALI0D09273g predicted mRNA
          Length = 324

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 377 ccatcttggttccaggaatgtacttcttggg 407
           |||||||||| || |||||||||||||||||
Sbjct: 256 ccatcttggtaccgggaatgtacttcttggg 226

---

>gb|AF091484.1| Tigriopus californicus isolate SD18 cytochrome c (CYC) gene, CYC-1
           allele, complete cds
          Length = 803

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 732 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 682

---

>gb|AF091483.1| Tigriopus californicus isolate SD16 cytochrome c (CYC) gene, CYC-2
           allele, complete cds
          Length = 860

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 786 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 736

---

>gb|AF091482.1| Tigriopus californicus isolate SD16 cytochrome c (CYC) gene, CYC-1
           allele, complete cds
          Length = 855

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 781 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 731

---

>gb|AF091481.1| Tigriopus californicus isolate SD15 cytochrome c (CYC) gene,
           partial cds
          Length = 799

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 727 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 677

---

>gb|AF091480.1| Tigriopus californicus isolate SD12 cytochrome c (CYC) gene,
           partial cds
          Length = 790

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 727 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 677

---

>gb|AF091479.1| Tigriopus californicus isolate SD11 cytochrome c (CYC) gene,
           partial cds
          Length = 798

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 727 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 677

---

>gb|AF091478.1| Tigriopus californicus isolate SC17 cytochrome c (CYC) gene,
           complete cds
          Length = 874

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 813 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 763

---

>gb|AF091477.1| Tigriopus californicus isolate SC16 cytochrome c (CYC) gene, CYC-2
           allele, partial cds
          Length = 867

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 799 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 749

---

>gb|AF091476.1| Tigriopus californicus isolate SC16 cytochrome c (CYC) gene, CYC-1
           allele, partial cds
          Length = 870

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 805 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 755

---

>gb|AF091475.1| Tigriopus californicus isolate SC15 cytochrome c (CYC) gene,
           partial cds
          Length = 878

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 808 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 758

---

>gb|AF091474.1| Tigriopus californicus isolate SC14 cytochrome c (CYC) gene,
           partial cds
          Length = 877

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 808 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 758

---

>gb|AF091473.1| Tigriopus californicus isolate SC13 cytochrome c (CYC) gene, CYC-2
           allele, complete cds
          Length = 887

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 813 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 763

---

>gb|AF091472.1| Tigriopus californicus isolate SC13 cytochrome c (CYC) gene, CYC-1
           allele, complete cds
          Length = 894

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 820 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 770

---

>gb|AF091471.1| Tigriopus californicus isolate CA11 cytochrome c (CYC) gene,
           complete cds
          Length = 862

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 801 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 751

---

>gb|AF091470.1| Tigriopus californicus isolate CA3 cytochrome c (CYC) gene, CYC-2
           allele, complete cds
          Length = 887

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 813 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 763

---

>gb|AF091469.1| Tigriopus californicus isolate CA3 cytochrome c (CYC) gene, CYC-1
           allele, complete cds
          Length = 897

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 823 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 773

---

>gb|AF091468.1| Tigriopus californicus isolate CA2 cytochrome c (CYC) gene, CYC-2
           allele, complete cds
          Length = 875

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 801 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 751

---

>gb|AF091467.1| Tigriopus californicus isolate CA2 cytochrome c (CYC) gene, CYC-1
           allele, complete cds
          Length = 874

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 800 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 750

---

>gb|AF091466.1| Tigriopus californicus isolate CA1 cytochrome c (CYC) gene, CYC-2
           allele, complete cds
          Length = 874

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 800 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 750

---

>gb|AF091465.1| Tigriopus californicus isolate CA1 cytochrome c (CYC) gene, CYC-1
           allele, complete cds
          Length = 884

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 810 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 760

---

>gb|AF091460.1| Tigriopus californicus cytochrome c (CYC) mRNA, complete cds
          Length = 537

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           ||||||||| || | ||| ||||||||||| || ||||||||||| |||||
Sbjct: 314 cttcttcaggcctgcgaacaccatcttggtaccgggaatgtactttttggg 264

---

>emb|BX070970.1|CNS09QXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 699 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 758

              
Query: 381 ctt 383
           |||
Sbjct: 759 ctt 761

---

>emb|BX068625.1|CNS09P45 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||  |||||||||||||| ||||| |||||
Sbjct: 478 cttcaggtaggcgatcagatcgccacgctccttcggcttcttcagaccggggaacaccat 537

              
Query: 381 ctt 383
           |||
Sbjct: 538 ctt 540

---

>emb|BX048689.1|CNS099QD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 588

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 521 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 580

              
Query: 381 ctt 383
           |||
Sbjct: 581 ctt 583

---

>emb|BX026468.1|CNS08SL4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 321 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 380
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 702 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 761

              
Query: 381 ctt 383
           |||
Sbjct: 762 ctt 764

---

>gb|DQ445531.1| Graphocephala atropunctata isolate WHGA0824 cytochrome c-like
           protein mRNA, complete cds; mitochondrial
          Length = 327

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 349 tcctgtggcttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||||| ||||| |  |||| ||| |||||||| ||||| ||||| |||||||||||
Sbjct: 284 tcctgtggtttcttgatgccagcgaacaccatcttcgttcctggaatatacttcttggg 226

---

>dbj|AB225913.1| Aspergillus oryzae cDNA, contig sequence: AoEST2768
          Length = 684

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 357 cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
           |||||| ||||||  |||| |||||||||| || || ||||||||||||||
Sbjct: 391 cttcttgagaccaccgaaggccatcttggtaccggggatgtacttcttggg 341

---

>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026
          Length = 2324132

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 357    cttcttcagaccagggaagaccatcttggttccaggaatgtacttcttggg 407
              |||||| ||||||  |||| |||||||||| || || ||||||||||||||
Sbjct: 769735 cttcttgagaccaccgaaggccatcttggtaccggggatgtacttcttggg 769785

---

>gb|AY034827.1| Curvularia lunata cytochrome c mRNA, complete cds
          Length = 608

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 377 ccatcttggttccaggaatgtacttcttggg 407
           |||||||||| || |||||||||||||||||
Sbjct: 327 ccatcttggtgccgggaatgtacttcttggg 297

---

>gb|AY918494.1| Tarsius bancanus mitochondrial cytochrome c somatic (CYCS) gene,
            complete cds; nuclear gene for mitochondrial product
          Length = 1676

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 372  gaagaccatcttggttccaggaatgtacttcttgggatt 410
            ||||| ||| || |||||||| |||||||||||||||||
Sbjct: 1502 gaagatcatttttgttccagggatgtacttcttgggatt 1464

---

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 377     ccatcttggttccaggaatgtacttcttggg 407
               |||||||||| || |||||||||||||||||
Sbjct: 1176930 ccatcttggtaccgggaatgtacttcttggg 1176900

---

>gb|M83141.1|EMECYTC Emericella nidulans cytochrome c (CYTc) gene, complete cds
          Length = 1312

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 377 ccatcttggttccaggaatgtacttcttggg 407
           |||||||||| ||||| ||||||||||||||
Sbjct: 974 ccatcttggtaccagggatgtacttcttggg 944

---

>ref|XM_528718.1| PREDICTED: Pan troglodytes similar to cytochrome c (LOC473347), mRNA
          Length = 1407

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 385  gttccaggaatgtacttcttgggatt 410
            |||||||| |||||||||||||||||
Sbjct: 1334 gttccagggatgtacttcttgggatt 1309

---

>ref|XM_520960.1| PREDICTED: Pan troglodytes similar to cytochrome c (LOC465522),
           mRNA
          Length = 576

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 300 gttccagggatgtacttcttgggatt 275

---

>ref|XM_519702.1| PREDICTED: Pan troglodytes similar to cytochrome c (LOC464105),
           mRNA
          Length = 1272

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 299 gttccagggatgtacttcttgggatt 274

---

>ref|XM_519001.1| PREDICTED: Pan troglodytes similar to Chromosome 7 open reading frame
            31 (LOC463297), mRNA
          Length = 2591

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 385  gttccaggaatgtacttcttgggatt 410
            |||||||| |||||||||||||||||
Sbjct: 2213 gttccagggatgtacttcttgggatt 2188

---

>ref|XM_518413.1| PREDICTED: Pan troglodytes similar to cytochrome c (LOC462623),
           mRNA
          Length = 600

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 290 gttccagggatgtacttcttgggatt 265

---

>ref|XM_524863.1| PREDICTED: Pan troglodytes LOC469480 (LOC469480), mRNA
          Length = 333

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 236 gttccagggatgtacttcttgggatt 211

---

>gb|BC021994.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:24510
           IMAGE:4096609), complete cds
          Length = 1295

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 309 gttccagggatgtacttcttgggatt 284

---

>gb|AY440406.1| Armigeres subalbatus ASAP ID: 39155 cytochrome c mRNA sequence
          Length = 888

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 325 aggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatcttg 384
           ||||| || |||||||| ||||| || |  ||||| |||||||| |  |||| |||||| 
Sbjct: 494 aggtatgcgatgagatcggcacgctcgttgggctttttcagaccggcraagatcatcttc 435

                               
Query: 385 gttccaggaatgtacttctt 404
           || ||||| |||||||||||
Sbjct: 434 gtgccagggatgtacttctt 415

---

>ref|XM_370188.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein
           (MG06685.4) partial mRNA
          Length = 654

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 553 gcgtcgacggtgtggcactgcgcgca 578
           ||||||||||||||||||||| ||||
Sbjct: 407 gcgtcgacggtgtggcactgctcgca 382

---

>gb|BC070346.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:88352
           IMAGE:3826017), complete cds
          Length = 1279

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 306 gttccagggatgtacttcttgggatt 281

---

>gb|BC070156.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:88136
           IMAGE:6451982), complete cds
          Length = 1269

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 305 gttccagggatgtacttcttgggatt 280

---

>gb|BC067222.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:72005
           IMAGE:3685258), complete cds
          Length = 1019

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 309 gttccagggatgtacttcttgggatt 284

---

>gb|BC016006.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:27280
           IMAGE:4656402), complete cds
          Length = 1284

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 309 gttccagggatgtacttcttgggatt 284

---

>gb|BC022330.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:22759
           IMAGE:4280695), complete cds
          Length = 1018

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 305 gttccagggatgtacttcttgggatt 280

---

>gb|BC008477.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:14765
           IMAGE:4290897), complete cds
          Length = 1288

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 305 gttccagggatgtacttcttgggatt 280

---

>gb|BC008475.1| Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:14760
           IMAGE:4284529), complete cds
          Length = 1283

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 305 gttccagggatgtacttcttgggatt 280

---

>gb|AC183376.4| Pan troglodytes BAC clone CH251-735O6 from chromosome 13, complete
             sequence
          Length = 188255

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 385   gttccaggaatgtacttcttgggatt 410
             |||||||||||||||||| |||||||
Sbjct: 94812 gttccaggaatgtacttcctgggatt 94837

---

>gb|DQ481668.1| Takifugu rubripes HoxDa gene cluster, complete sequence
          Length = 366816

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 373    aagaccatcttggttccaggaatgtacttcttgggatt 410
              |||| |||||| ||||| |||||||| |||||||||||
Sbjct: 311095 aagatcatctttgttcctggaatgtatttcttgggatt 311132

---

>gb|DQ176430.1| Bubalus bubalis mitochondrial cytochrome c mRNA, partial cds;
           nuclear gene for mitochondrial product
          Length = 315

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 233 gttccagggatgtacttcttgggatt 208

---

>gb|AC183388.3| Pan troglodytes BAC clone CH251-53D20 from chromosome 16, complete
             sequence
          Length = 161327

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 385   gttccaggaatgtacttcttgggatt 410
             |||||||| |||||||||||||||||
Sbjct: 70460 gttccagggatgtacttcttgggatt 70435

---

>gb|AC183528.2| Pan troglodytes BAC clone CH251-737P22 from chromosome 13, complete
             sequence
          Length = 202694

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 385   gttccaggaatgtacttcttgggatt 410
             |||||||||||||||||| |||||||
Sbjct: 85498 gttccaggaatgtacttcctgggatt 85523

---

>gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-249B10, complete sequence
          Length = 213633

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 385    gttccaggaatgtacttcttgggatt 410
              |||||||| |||||||||||||||||
Sbjct: 101039 gttccagggatgtacttcttgggatt 101014

---

>gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, complete sequence
          Length = 215866

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 385    gttccaggaatgtacttcttgggatt 410
              |||||||| |||||||||||||||||
Sbjct: 114822 gttccagggatgtacttcttgggatt 114847

---

>emb|CR722155.2|CNS0GK5T Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| || || ||||||||||||||||||||
Sbjct: 332 aagatcatctttgtccctggaatgtacttcttgggatt 295

---

>emb|CR721647.2|CNS0GJRP Tetraodon nigroviridis full-length cDNA
          Length = 731

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| || || ||||||||||||||||||||
Sbjct: 299 aagatcatctttgtccctggaatgtacttcttgggatt 262

---

>emb|CR710570.2|CNS0GB86 Tetraodon nigroviridis full-length cDNA
          Length = 789

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| || || ||||||||||||||||||||
Sbjct: 374 aagatcatctttgtccctggaatgtacttcttgggatt 337

---

>gb|AC007487.2| Homo sapiens BAC clone CTA-232J20 from 7, complete sequence
          Length = 23179

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 385   gttccaggaatgtacttcttgggatt 410
             |||||||| |||||||||||||||||
Sbjct: 21896 gttccagggatgtacttcttgggatt 21921

---

>emb|CR677377.2|CNS0FLML Tetraodon nigroviridis full-length cDNA
          Length = 805

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| || || ||||||||||||||||||||
Sbjct: 352 aagatcatctttgtccctggaatgtacttcttgggatt 315

---

>emb|CR669860.1|CNS0FFU2 Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 382 ttggttccaggaatgtacttcttggg 407
           |||||||||||||| |||||||||||
Sbjct: 215 ttggttccaggaatatacttcttggg 190

---

>emb|CR657236.2|CNS0F63E Tetraodon nigroviridis full-length cDNA
          Length = 766

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 373 aagaccatcttggttccaggaatgtacttcttgggatt 410
           |||| |||||| || || ||||||||||||||||||||
Sbjct: 333 aagatcatctttgtccctggaatgtacttcttgggatt 296

---

>gb|AC142296.1| Pan troglodytes BAC clone RP43-97L1 from Y, complete sequence
          Length = 158231

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 385   gttccaggaatgtacttcttgggatt 410
             ||||||| ||||||||||||||||||
Sbjct: 33381 gttccagcaatgtacttcttgggatt 33406

---

>gb|AC146549.8| Medicago truncatula clone mth2-7p18, complete sequence
          Length = 96612

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 93    ttttccagcaactgaatcaaaa 114
             ||||||||||||||||||||||
Sbjct: 89901 ttttccagcaactgaatcaaaa 89922

---

>gb|AC146709.11| Medicago truncatula clone mth2-90m14, complete sequence
          Length = 110472

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 93    ttttccagcaactgaatcaaaa 114
             ||||||||||||||||||||||
Sbjct: 51396 ttttccagcaactgaatcaaaa 51417



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 93    ttttccagcaactgaatcaaaa 114
             ||||||||||||||||||||||
Sbjct: 36211 ttttccagcaactgaatcaaaa 36232

---

>emb|AL589762.16| Human DNA sequence from clone RP11-396D18 on chromosome 1 Contains the
             5' end of the PPP1R12B gene for protein phosphatase 1
             regulatory (inhibitor) subunit 12B and a somatic
             cytochrome c (CYCS) pseudogene, complete sequence
          Length = 74089

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 385   gttccaggaatgtacttcttgggatt 410
             |||||||| |||||||||||||||||
Sbjct: 11283 gttccagggatgtacttcttgggatt 11308

---

>emb|AL590064.9| Human DNA sequence from clone RP11-471M10 on chromosome 13 Contains
             part of a novel gene  similar to TPTE and PTEN homologous
             inositol lipid phosphatase (TPIP), a TPIP pseudogene and a
             cytochrome C (HCS) pseudogene, complete sequence
          Length = 73766

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 385   gttccaggaatgtacttcttgggatt 410
             |||||||| |||||||||||||||||
Sbjct: 40141 gttccagggatgtacttcttgggatt 40166

---

>emb|AL590076.4| Human DNA sequence from clone RP11-408K19 on chromosome 13 Contains the
             gene for TPTE and PTEN homologous inositol lipid
             phosphatase (TPIP) and a cytochrome c (HCS) pseudogene,
             complete sequence
          Length = 119330

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 385   gttccaggaatgtacttcttgggatt 410
             |||||||||||||||||| |||||||
Sbjct: 42295 gttccaggaatgtacttcctgggatt 42320

---

>emb|AL360020.15| Human DNA sequence from clone RP11-490F3 on chromosome 9 Contains a
             cytochrome C pseudogene, the gene for   protein tyrosine
             phosphatase PTP9Q22 and a CpG island, complete sequence
          Length = 158710

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 385   gttccaggaatgtacttcttgggatt 410
             |||||||| |||||||||||||||||
Sbjct: 56919 gttccagggatgtacttcttgggatt 56894

---

>emb|AL357080.13| Human DNA sequence from clone RP11-432L12 on chromosome 6 Contains STSs
             and GSSs, complete sequence
          Length = 172073

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 227   ctattaatgtctaatcttattatttt 252
             |||||||||||||| |||||||||||
Sbjct: 67056 ctattaatgtctaaacttattatttt 67081

---

>emb|AL359763.9| Human DNA sequence from clone RP11-169O17 on chromosome 13 Contains a
             cytochrome c pseudogene, a novel gene, the ADPRTL1 gene
             for ADP-ribosyltransferase (NAD+; poly (ADP-ribose)
             polymerase)-like protein 1 , part of a TPTE and PTEN
             homologous inositol lipid phosphatase (TPIP) pseudogene
             and four CpG islands, complete sequence
          Length = 190765

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 385   gttccaggaatgtacttcttgggatt 410
             |||||||||||||||||| |||||||
Sbjct: 69277 gttccaggaatgtacttcctgggatt 69252

---

>gb|AF533200.1| Homo sapiens isolate HCP39 chromosome 16 cytochrome c pseudogene,
           complete sequence
          Length = 309

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 227 gttccagggatgtacttcttgggatt 202

---

>gb|AF533196.1| Homo sapiens isolate HCP35 chromosome 13 cytochrome c pseudogene,
           complete sequence
          Length = 313

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 234 gttccagggatgtacttcttgggatt 209

---

>gb|AF533195.1| Homo sapiens isolate HCP34 chromosome 13 cytochrome c pseudogene,
           complete sequence
          Length = 313

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 235 gttccagggatgtacttcttgggatt 210

---

>gb|AF533194.1| Homo sapiens isolate HCP33 chromosome 13 cytochrome c pseudogene,
           complete sequence
          Length = 318

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||||||||||||| |||||||
Sbjct: 236 gttccaggaatgtacttcctgggatt 211

---

>gb|AF533193.1| Homo sapiens isolate HCP32 chromosome 13 cytochrome c pseudogene,
           complete sequence
          Length = 318

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||||||||||||| |||||||
Sbjct: 236 gttccaggaatgtacttcctgggatt 211

---

>gb|AF533192.1| Homo sapiens isolate HCP31 chromosome 13 cytochrome c pseudogene,
           complete sequence
          Length = 316

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 236 gttccagggatgtacttcttgggatt 211

---

>gb|AF533185.1| Homo sapiens isolate HCP24 chromosome 9 cytochrome c pseudogene,
           complete sequence
          Length = 316

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 236 gttccagggatgtacttcttgggatt 211

---

>gb|AF533182.1| Homo sapiens isolate HCP21 chromosome 8 cytochrome c pseudogene,
           complete sequence
          Length = 318

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 236 gttccagggatgtacttcttgggatt 211

---

>gb|AF533176.1| Homo sapiens isolate HCP15 chromosome 6 cytochrome c pseudogene,
           complete sequence
          Length = 633

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 236 gttccagggatgtacttcttgggatt 211

---

>gb|AF533165.1| Homo sapiens isolate HCP4 chromosome 1 cytochrome c pseudogene,
           complete sequence
          Length = 277

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 195 gttccagggatgtacttcttgggatt 170

---

>gb|AF533162.1| Homo sapiens isolate HCP1 chromosome 1 cytochrome c pseudogene,
           complete sequence
          Length = 318

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 385 gttccaggaatgtacttcttgggatt 410
           |||||||| |||||||||||||||||
Sbjct: 236 gttccagggatgtacttcttgggatt 211

---

>emb|AL356423.15| Human DNA sequence from clone RP11-295B17 on chromosome 13 Contains the
              5' end of the STK24 gene for serine/threonine kinase 24, a
              novel gene, a novel pseudogene, a cytochrome c pseudogene,
              a calmodulin 2 (CALM2) pseudogene and a CpG island,
              complete sequence
          Length = 174041

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 385    gttccaggaatgtacttcttgggatt 410
              |||||||| |||||||||||||||||
Sbjct: 131443 gttccagggatgtacttcttgggatt 131468

---

>emb|AL355860.12| Human DNA sequence from clone RP11-235D19 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)
              (UBE2D3) pseudogene, the 5' end of the CTSK gene for
              cathepsin K (pycnodysostosis), the ARNT gene for aryl
              hydrocarbon receptor nuclear translocator, a ribosomal
              protein S27a (RPS27A) pseudogene, a cytochrome c, somatic
              (CYCS) pseudogene and a CpG island, complete sequence
          Length = 116451

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 385    gttccaggaatgtacttcttgggatt 410
              |||||||| |||||||||||||||||
Sbjct: 104775 gttccagggatgtacttcttgggatt 104750

---

>emb|AL354740.29| Human DNA sequence from clone RP11-513I15 on chromosome 6 Contains the
             5' end of the GRM4 gene for glutamate receptor
             metabotropic 4, keratin 18 pseudogene 1 (KRT18P1), a
             cytochrome c, somatic (CYCS) pseudogene, the HMGA1 gene
             for high mobility group AT-hook 1, a ribosomal protein L35
             (RPL35) pseudogene, part of a novel gene and CpG islands,
             complete sequence
          Length = 151828

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 385   gttccaggaatgtacttcttgggatt 410
             |||||||| |||||||||||||||||
Sbjct: 87015 gttccagggatgtacttcttgggatt 86990

---

>emb|BX053421.1|CNS09DDT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 355 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 306



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 154 tcgacggtgtggcactgggcgcac 131

---

>emb|BX071914.1|CNS09RNI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 370 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 321



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 169 tcgacggtgtggcactgggcgcac 146

---

>emb|BX070969.1|CNS09QX9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 314 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 265



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 113 tcgacggtgtggcactgggcgcac 90

---

>emb|BX069281.1|CNS09PMD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1053

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 391 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 342



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 190 tcgacggtgtggcactgggcgcac 167

---

>emb|BX068475.1|CNS09OZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 308 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 259



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 107 tcgacggtgtggcactgggcgcac 84

---

>emb|BX068177.1|CNS09ORP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 391 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 342



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 190 tcgacggtgtggcactgggcgcac 167

---

>emb|BX067681.1|CNS09ODX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 367 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 318



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 166 tcgacggtgtggcactgggcgcac 143

---

>emb|BX067077.1|CNS09NX5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 397 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 348



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 196 tcgacggtgtggcactgggcgcac 173

---

>emb|BX066876.1|CNS09NRK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 361

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 334 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 285



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 133 tcgacggtgtggcactgggcgcac 110

---

>emb|BX066631.1|CNS09NKR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 326 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 277



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 125 tcgacggtgtggcactgggcgcac 102

---

>emb|BX066462.1|CNS09NG2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 427 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 378



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 226 tcgacggtgtggcactgggcgcac 203

---

>emb|BX064776.1|CNS09M58 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 310 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 261



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 108 tcgacggtgtggcactgggcgcac 85

---

>emb|BX064702.1|CNS09M36 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 320 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 271



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 119 tcgacggtgtggcactgggcgcac 96

---

>emb|BX064486.1|CNS09LX6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 385 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 336

---

>emb|BX063948.1|CNS09LI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 401 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 352



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 200 tcgacggtgtggcactgggcgcac 177

---

>emb|BX062556.1|CNS09KFK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 335 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 286



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 134 tcgacggtgtggcactgggcgcac 111

---

>emb|BX062284.1|CNS09K80 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 471

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 373 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 324

---

>emb|BX061602.1|CNS09JP2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 171 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 122

---

>emb|BX060540.1|CNS09IVK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 313 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 264



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 112 tcgacggtgtggcactgggcgcac 89

---

>emb|BX060187.1|CNS09ILR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 355 ggcttcttcagaccagggaagaccatcttggttccaggaatgtacttctt 404
           |||||||||||||| | ||| |||||||| || || || |||||||||||
Sbjct: 320 ggcttcttcagaccggcgaacaccatcttcgtgccggggatgtacttctt 271



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 556 tcgacggtgtggcactgcgcgcac 579
           ||||||||||||||||| ||||||
Sbjct: 119 tcgacggtgtggcactgggcgcac 96


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,815,610
Number of Sequences: 3902068
Number of extensions: 5815610
Number of successful extensions: 111601
Number of sequences better than 10.0: 470
Number of HSP's better than 10.0 without gapping: 465
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 110405
Number of HSP's gapped (non-prelim): 1192
length of query: 610
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 587
effective length of database: 17,143,297,704
effective search space: 10063115752248
effective search space used: 10063115752248
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---