>gb|BT017828.1| Zea mays clone EL01N0508G02.c mRNA sequence
          Length = 731

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 83/95 (87%), Gaps = 1/95 (1%)
 Strand = Plus / Minus

                                                                       
Query: 509 tcttctcgtcctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattg 568
           ||||||| ||||||||||||||||| |||| ||| ||||| ||||||||||||||||| |
Sbjct: 525 tcttctcatcctcaaaagcttgcttaaggtactcaagctctttgtctagatcattgatag 466

                                              
Query: 569 cttgggtatacgccctgcgttggggaggattggct 603
           | ||||| || | ||||||| |||||||| |||||
Sbjct: 465 cctgggtgta-ggcctgcgtcggggaggactggct 432

>ref|XM_476775.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 363

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 91/106 (85%), Gaps = 1/106 (0%)
 Strand = Plus / Minus

                                                                       
Query: 509 tcttctcgtcctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattg 568
           ||||||| ||||||||||||||||| || ||||| ||||||||||||| |||||||||||
Sbjct: 328 tcttctcatcctcaaaagcttgcttgagattctcaagctccttgtctaaatcattgattg 269

                                                         
Query: 569 cttgggtatacgccctgcgttggggaggattggcttgcagtatgga 614
           | || || |||| | || || |||| ||| ||| ||||||||||||
Sbjct: 268 cctgtgtgtacg-cttgagtaggggtggactggtttgcagtatgga 224

>dbj|AK099622.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013053F13, full
           insert sequence
          Length = 787

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 91/106 (85%), Gaps = 1/106 (0%)
 Strand = Plus / Minus

                                                                       
Query: 509 tcttctcgtcctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattg 568
           ||||||| ||||||||||||||||| || ||||| ||||||||||||| |||||||||||
Sbjct: 505 tcttctcatcctcaaaagcttgcttgagattctcaagctccttgtctaaatcattgattg 446

                                                         
Query: 569 cttgggtatacgccctgcgttggggaggattggcttgcagtatgga 614
           | || || |||| | || || |||| ||| ||| ||||||||||||
Sbjct: 445 cctgtgtgtacg-cttgagtaggggtggactggtttgcagtatgga 401

>dbj|AK068132.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013131J17, full
           insert sequence
          Length = 812

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 91/106 (85%), Gaps = 1/106 (0%)
 Strand = Plus / Minus

                                                                       
Query: 509 tcttctcgtcctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattg 568
           ||||||| ||||||||||||||||| || ||||| ||||||||||||| |||||||||||
Sbjct: 507 tcttctcatcctcaaaagcttgcttgagattctcaagctccttgtctaaatcattgattg 448

                                                         
Query: 569 cttgggtatacgccctgcgttggggaggattggcttgcagtatgga 614
           | || || |||| | || || |||| ||| ||| ||||||||||||
Sbjct: 447 cctgtgtgtacg-cttgagtaggggtggactggtttgcagtatgga 403

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 83/97 (85%), Gaps = 1/97 (1%)
 Strand = Plus / Plus

                                                                           
Query: 518     cctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattgcttgggtat 577
               |||||||||||||||| || ||||| ||||||||||||| |||||||||||| || || |
Sbjct: 3846803 cctcaaaagcttgcttgagattctcaagctccttgtctaaatcattgattgcctgtgtgt 3846862

                                                    
Query: 578     acgccctgcgttggggaggattggcttgcagtatgga 614
               ||| | || || |||| ||| ||| ||||||||||||
Sbjct: 3846863 acg-cttgagtaggggtggactggtttgcagtatgga 3846898

>dbj|AP004670.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0496D04
          Length = 197358

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 83/97 (85%), Gaps = 1/97 (1%)
 Strand = Plus / Plus

                                                                         
Query: 518   cctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattgcttgggtat 577
             |||||||||||||||| || ||||| ||||||||||||| |||||||||||| || || |
Sbjct: 85915 cctcaaaagcttgcttgagattctcaagctccttgtctaaatcattgattgcctgtgtgt 85974

                                                  
Query: 578   acgccctgcgttggggaggattggcttgcagtatgga 614
             ||| | || || |||| ||| ||| ||||||||||||
Sbjct: 85975 acg-cttgagtaggggtggactggtttgcagtatgga 86010

>gb|AC160340.2| Mus musculus BAC clone RP23-436E24 from chromosome 12, complete
             sequence
          Length = 209911

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 411   aggagttcagagactcatcgactagc 436
             |||||||||||||||||| |||||||
Sbjct: 57811 aggagttcagagactcatagactagc 57836

>emb|BX294148.1| Pirellula sp. strain 1 complete genome; segment 16/24
          Length = 294850

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 27     cgtcagtccaattttcggtgg 47
              |||||||||||||||||||||
Sbjct: 151490 cgtcagtccaattttcggtgg 151470

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 226     gtcggtttccatgatcacat 245
               ||||||||||||||||||||
Sbjct: 3323931 gtcggtttccatgatcacat 3323950

>emb|AL162408.8| Human DNA sequence from clone RP11-397O4 on chromosome 10 Contains a
            novel gene, the 5' end of a novel gene and a CpG island,
            complete sequence
          Length = 28205

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 225  agtcggtttccatgatcaca 244
            ||||||||||||||||||||
Sbjct: 4876 agtcggtttccatgatcaca 4857

>emb|CR861457.1| Pongo pygmaeus mRNA; cDNA DKFZp459D042 (from clone DKFZp459D042)
          Length = 4369

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 216  tctccaagcagtcggtttccatga 239
            |||||||| |||||||||||||||
Sbjct: 1942 tctccaagaagtcggtttccatga 1919

>gb|AF314199.1|AF314199S1 Homo sapiens neuroplastoma apoptosis-related RNA-binding protein
             (CUGBP2) gene, exons 1a and 1b
          Length = 59000

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 225   agtcggtttccatgatcaca 244
             ||||||||||||||||||||
Sbjct: 25653 agtcggtttccatgatcaca 25634

>emb|BX679675.28| Zebrafish DNA sequence from clone CH211-37L23 in linkage group 17,
             complete sequence
          Length = 119154

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 224   cagtcggtttccatgatcac 243
             ||||||||||||||||||||
Sbjct: 78819 cagtcggtttccatgatcac 78800

>gb|AC004475.1|AC004475 Homo sapiens chromosome 19, cosmid F23858, complete sequence
          Length = 42146

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 216   tctccaagcagtcggtttccatga 239
             |||||||| |||||||||||||||
Sbjct: 29074 tctccaagaagtcggtttccatga 29097


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,532,921
Number of Sequences: 3902068
Number of extensions: 3532921
Number of successful extensions: 55590
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55547
Number of HSP's gapped (non-prelim): 43
length of query: 617
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 594
effective length of database: 17,143,297,704
effective search space: 10183118836176
effective search space used: 10183118836176
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)