ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags8j15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X63052.1|HVCP29 Hordeum vulgare gene for CP29 precursor for ... 504 e-139
2gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome... 228 9e-57
3dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 228 9e-57
4dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clon... 228 9e-57
5dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clon... 228 9e-57
6dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clon... 228 9e-57
7gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 228 9e-57
8dbj|D85512.1| Oryza sativa (japonica cultivar-group) CP26 mRNA, ... 224 1e-55
9gb|AY105650.1| Zea mays PCO135935 mRNA sequence 186 3e-44
10gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein... 186 3e-44
11gb|AY855171.1| Eleusine coracana subsp. coracana clone 1 light h... 157 3e-35
12gb|U23189.1|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein... 157 3e-35
13gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 86 8e-14
14ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 84 3e-13
15dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
16dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
17dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
18dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
19dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
20dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
21dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
22emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 84 3e-13
23dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
24dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
25dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
26dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
27dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
28ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 80 5e-12
29gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 80 5e-12
30dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 80 5e-12
31dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 5e-12
32dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 5e-12
33dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 5e-12
34dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 5e-12
35gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 78 2e-11
36gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 78 2e-11
37gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 78 2e-11
38dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 78 2e-11
39dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 78 2e-11
40gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 76 8e-11
41gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 76 8e-11
42emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 76 8e-11
43gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 76 8e-11
44dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 76 8e-11
45dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 8e-11
46dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 8e-11
47gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 76 8e-11
48gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 76 8e-11
49dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 76 8e-11
50ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 74 3e-10
51ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 74 3e-10
52ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 74 3e-10
53ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 74 3e-10
54ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 74 3e-10
55ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 74 3e-10
56ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 74 3e-10
57ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 74 3e-10
58gb|AF104631.3| Chlamydomonas reinhardtii light harvesting comple... 74 3e-10
59dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 74 3e-10
60dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 74 3e-10
61dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
62dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
63dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
64emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 74 3e-10
65dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
66dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
67dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
68dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
69dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
70dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
71dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 74 3e-10
72gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 72 1e-09
73gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvestin... 70 5e-09
74gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin... 70 5e-09
75dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 5e-09
76dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 5e-09
77dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest... 70 5e-09
78dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest... 70 5e-09
79gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 68 2e-08
80emb|X61915.1|PTCABP P.thunbergii cab gene 68 2e-08
81emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 68 2e-08
82gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ... 68 2e-08
83gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 68 2e-08
84gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 68 2e-08
85gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 68 2e-08
86gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 68 2e-08
87gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 68 2e-08
88gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 68 2e-08
89gb|M37489.1|PINCABII2 Pinus sylvestris chlorophyll a/b-binding p... 68 2e-08
90gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 68 2e-08
91dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 68 2e-08
92emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 68 2e-08
93dbj|AB050007.2| Chlamydomonas reinhardtii lhcb5 mRNA for CP26, c... 68 2e-08
94emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 68 2e-08
95emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 68 2e-08
96emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 68 2e-08
97gb|AY112240.1| Zea mays CL187_6 mRNA sequence 68 2e-08
98gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 68 2e-08
99gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 68 2e-08
100gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 68 2e-08
101gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 68 2e-08
102dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 68 2e-08
103dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest... 68 2e-08
104dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 7e-08
105emb|X06602.1|EGLHCPAB Euglena gracilis mRNA for light harvesting... 66 7e-08
106gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 64 3e-07
107gb|U51634.1|PPU51634 Pinus palustris type 2 light-harvesting chl... 64 3e-07
108gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 62 1e-06
109dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 62 1e-06
110emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 62 1e-06
111emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 62 1e-06
112emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 62 1e-06
113emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 62 1e-06
114gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 62 1e-06
115emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chloro... 60 5e-06
116gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 60 5e-06
117gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 60 5e-06
118gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 60 5e-06
119gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 60 5e-06
120gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 60 5e-06
121gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 60 5e-06
122gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ... 60 5e-06
123emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMW... 60 5e-06
124emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 60 5e-06
125emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 60 5e-06
126emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 60 5e-06
127gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 60 5e-06
128gb|L29644.1|EGRLHCPII Euglena gracilis chlorophyll a/b binding p... 60 5e-06
129dbj|AB122118.1| Chlamydomonas reinhardtii LhcI-5 gene for light-... 58 2e-05
130gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 58 2e-05
131gb|AY786530.1| Haematococcus pluvialis chloroplast major light-h... 54 3e-04
132emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 54 3e-04
133gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ... 54 3e-04
134gb|AY617096.1| Picea sitchensis chloroplast light harvesting chl... 54 3e-04
135dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 54 3e-04
136emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig... 54 3e-04
137emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh... 54 3e-04
138gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b bin... 54 3e-04
139gb|AY109324.1| Zea mays CL187_1 mRNA sequence 54 3e-04
140gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 54 3e-04
141gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 54 3e-04
142gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 54 3e-04
143gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi... 54 3e-04
144dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 54 3e-04
145emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin... 52 0.001
146gb|AY267624.1| Bigelowiella natans chlorophyll a/b-binding prote... 52 0.001
147gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest... 52 0.001
148gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 52 0.001
149gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 52 0.001
150gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 52 0.001
151gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 52 0.001
152gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 52 0.001
153gb|AF398746.1|AF398746 Carlquistia muirii ASCAB9 (ASCAB9) gene, ... 52 0.001
154gb|AF398740.1|AF398740 Wilkesia gymnoxiphium ASCAB9-B (ASCAB9-B)... 52 0.001
155emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC... 52 0.001
156emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 52 0.001
157emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 52 0.001
158gb|K00973.1|PETCAB3 Petunia major chlorophyll a/b binding protei... 52 0.001
159emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 52 0.001
160gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 52 0.001
161gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 52 0.001
162gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab... 52 0.001
163gb|BT014450.1| Lycopersicon esculentum clone 133776F, mRNA sequence 50 0.004
164gb|AF104633.2| Chlamydomonas reinhardtii light harvesting comple... 50 0.004
165gb|S68728.1| LHC Ib-21=light-harvesting complex I [Hordeum vulga... 50 0.004
166gb|AF110786.1|AF110786 Volvox carteri f. nagariensis clone G18 l... 50 0.004
167gb|AF195794.1|AF195794 Chlamydomonas reinhardtii chlorophyll A-B... 50 0.004
168dbj|AP004756.2| Oryza sativa (japonica cultivar-group) genomic D... 50 0.004
169dbj|AB122119.1| Chlamydomonas reinhardtii LhcI-6 gene for light-... 50 0.004
170dbj|AB122114.1| Chlamydomonas reinhardtii LhcI-1 gene for light-... 50 0.004
171emb|X61287.1|LECAB9 L.esculentum Cab9 gene for type I (26 kD) CP... 50 0.004
172emb|X65119.1|CRCABI1MR C.reinhardtii cabI-1 mRNA for light harve... 50 0.004
173gb|AF218305.1|AF218305 Hordeum vulgare chlorophyll a/b binding p... 50 0.004
174dbj|AK066997.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.004
175gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 50 0.004
176gb|DQ185425.1| Rosa roxburghii clone C40 defense-related mRNA, p... 48 0.017
177gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding prote... 48 0.017
178gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting c... 48 0.017
179gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting c... 48 0.017
180gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting c... 48 0.017
181emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 48 0.017
182emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 48 0.017
183gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding prot... 48 0.017
184gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote... 48 0.017
185gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protei... 48 0.017
186ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll bindi... 46 0.069
187ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ p... 46 0.069
188ref|XM_507384.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.069
189ref|XM_507383.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.069
190ref|XM_507382.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.069
191ref|XM_478841.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.069
192ref|XM_507381.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.069
193ref|XM_507380.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.069
194ref|XM_507379.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.069
195ref|XM_506426.2| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.069
196gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 46 0.069
197gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 46 0.069
198gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 46 0.069
199gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 46 0.069
200gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b bin... 46 0.069
201gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genom... 46 0.069
202gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 46 0.069
203gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 46 0.069
204gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b bin... 46 0.069
205gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 46 0.069
206emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Co... 46 0.069
207emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Co... 46 0.069
208emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Co... 46 0.069
209emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Co... 46 0.069
210emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Co... 46 0.069
211emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Co... 46 0.069
212gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA... 46 0.069
213gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA... 46 0.069
214dbj|AP003804.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.069
215dbj|AB122116.1| Chlamydomonas reinhardtii LhcI-3 gene for light-... 46 0.069
216dbj|AK119176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.069
217emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 46 0.069
218emb|X84308.1|HVLHCA2 H.vulgare mRNA for photosysteme I antenna p... 46 0.069
219emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 46 0.069
220dbj|AK104651.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.069
221dbj|AK104608.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.069
222dbj|AK104283.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.069
223dbj|AK104177.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.069
224dbj|AK104127.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.069
225dbj|AK104016.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.069
226dbj|AK103966.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.069
227dbj|AK070051.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.069
228dbj|AK060987.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.069
229gb|AY105333.1| Zea mays PCO095488 mRNA sequence 46 0.069
230gb|U22329.1|VCU22329 Volvox carteri light harvesting complex a m... 46 0.069
231dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone... 46 0.069
232gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p... 46 0.069
233gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-... 46 0.069
234gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-... 46 0.069
235gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-... 46 0.069
236gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ... 46 0.069
237gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mR... 46 0.069
238gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 46 0.069
239dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 46 0.069
240gb|AY954738.1| Ostreococcus tauri chloroplast chlorophyll a/b-bi... 44 0.27
241gb|AF517869.1| Griffithsia japonica isolate Gj446 light-harvest ... 44 0.27
242gb|AF398747.1|AF398747 Anisocarpus scabridus ASCAB9 (ASCAB9) gen... 44 0.27
243gb|AF398745.1|AF398745 Osmadenia tenella ASCAB9 (ASCAB9) gene, e... 44 0.27
244gb|AF398744.1|AF398744 Madia nutans ASCAB9 (ASCAB9) gene, exons ... 44 0.27
245gb|AF398743.1|AF398743 Deinandra lobbii ASCAB9 (ASCAB9) gene, ex... 44 0.27
246gb|AF398741.1|AF398741 Wilkesia gymnoxiphium ASCAB9-C (ASCAB9-C)... 44 0.27
247gb|AF398739.1|AF398739 Dubautia scabra ASCAB9-C (ASCAB9-C) gene,... 44 0.27
248gb|AF398738.1|AF398738 Dubautia plantaginea ASCAB9-B (ASCAB9-B) ... 44 0.27
249gb|AF398737.1|AF398737 Dubautia laxa ASCAB9-C (ASCAB9-C) gene, e... 44 0.27
250gb|AF398736.1|AF398736 Dubautia latifolia ASCAB9-C (ASCAB9-C) ge... 44 0.27
251gb|AF398735.1|AF398735 Dubautia laevigata ASCAB9-B (ASCAB9-B) ge... 44 0.27
252gb|AF398734.1|AF398734 Argyroxiphium sandwicense ASCAB9-C (ASCAB... 44 0.27
253gb|AF398733.1|AF398733 Argyroxiphium sandwicense ASCAB9-B (ASCAB... 44 0.27
254gb|AF398732.1|AF398732 Argyroxiphium caliginis ASCAB9-B (ASCAB9-... 44 0.27
255gb|AF398731.1|AF398731 Wilkesia gymnoxiphium ASCAB9-A (ASCAB9-A)... 44 0.27
256gb|AF398730.1|AF398730 Dubautia sherffiana ASCAB9-A (ASCAB9-A) g... 44 0.27
257gb|AF398729.1|AF398729 Dubautia raillardioides ASCAB9-A (ASCAB9-... 44 0.27
258gb|AF398728.1|AF398728 Dubautia plantaginea ASCAB9-A (ASCAB9-A) ... 44 0.27
259gb|AF398727.1|AF398727 Dubautia laxa ASCAB9-A (ASCAB9-A) gene, e... 44 0.27
260gb|AF398726.1|AF398726 Dubautia latifolia ASCAB9-A (ASCAB9-A) ge... 44 0.27
261gb|AF398725.1|AF398725 Dubautia laevigata ASCAB9-A (ASCAB9-A) ge... 44 0.27
262gb|AF398724.1|AF398724 Argyroxiphium sandwicense ASCAB9-A (ASCAB... 44 0.27
263gb|AF398723.1|AF398723 Argyroxiphium caliginis ASCAB9-A (ASCAB9-... 44 0.27
264dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 44 0.27
265emb|X16535.1|GMCAB4 G.max DNA for Cab4 44 0.27
266gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin... 44 0.27
267dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 44 0.27
268dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 44 0.27
269emb|X95727.1|BJMCAB1GE B.juncea mRNA for chlorophyll a/b-binding... 42 1.1
270gb|AY104614.1| Zea mays PCO084486 mRNA sequence 42 1.1
271gb|U25812.1|PSU25812 Pseudomonas syringae pv. syringae hrp gene ... 42 1.1
272emb|X12861.1|EGLHCI38 Euglena gracilis mRNA fragment for LHCI pr... 42 1.1
273gb|AC139637.17| Mus musculus chromosome 15, clone RP24-253M12, c... 40 4.2
274ref|NM_001039970.1| Homo sapiens protein tyrosine phosphatase, n... 40 4.2
275ref|NM_032781.3| Homo sapiens protein tyrosine phosphatase, non-... 40 4.2
276ref|NM_006906.1| Homo sapiens protein tyrosine phosphatase, non-... 40 4.2
277gb|AC142474.4| Mus musculus BAC clone RP24-362N7 from chromosome... 40 4.2
278gb|AC003084.1| Homo sapiens BAC clone CTB-84D4 from 7, complete ... 40 4.2
279gb|BC046435.1| Homo sapiens protein tyrosine phosphatase, non-re... 40 4.2
280gb|BC064807.1| Homo sapiens protein tyrosine phosphatase, non-re... 40 4.2
281emb|AL591048.7| Human DNA sequence from clone RP11-612M16 on chr... 40 4.2
282gb|AF517872.1| Griffithsia japonica isolate Gj241 light-harvest ... 40 4.2
283gb|BC039897.1| Homo sapiens protein tyrosine phosphatase, non-re... 40 4.2
284emb|AL832541.1|HSM803850 Homo sapiens mRNA; cDNA DKFZp547A0817 (... 40 4.2
285gb|AC091606.8| Mus Musculus Strain C57BL6/J chromosome X BAC, RP... 40 4.2
286dbj|AK127312.1| Homo sapiens cDNA FLJ45381 fis, clone BRHIP30210... 40 4.2
287dbj|AK090923.1| Homo sapiens cDNA FLJ33604 fis, clone BRAMY20152... 40 4.2
288dbj|AK027333.1| Homo sapiens cDNA FLJ14427 fis, clone HEMBA1006173 40 4.2
289dbj|AK055450.1| Homo sapiens cDNA FLJ30888 fis, clone FEBRA20050... 40 4.2
290gb|AC103974.6| Homo sapiens chromosome 11, clone RP11-1081L13, c... 40 4.2
291gb|AF398742.1|AF398742 Centromadia pungens ASCAB9 (ASCAB9) gene,... 40 4.2
292gb|DQ356257.1| Homo sapiens isolate cftr10471_A cystic fibrosis ... 40 4.2
293emb|BX530075.7| Zebrafish DNA sequence from clone CH211-1O14 in ... 40 4.2
294dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.2
295gb|DP000025.1| Gorilla gorilla gorilla target 1 genomic scaffold 40 4.2
296gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec... 40 4.2
297gb|BC047349.1| Mus musculus, clone IMAGE:3595895, mRNA 40 4.2
298emb|AJ538931.1|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT... 40 4.2
299emb|AJ538874.1|NTA538874 Nicotiana tabacum cDNA-AFLP-fragment BT... 40 4.2
300emb|AJ538840.1|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT... 40 4.2
301dbj|AP004877.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.2
302dbj|AP004847.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.2
303dbj|AB060245.1| Macaca fascicularis brain cDNA clone:QflA-15249,... 40 4.2
304emb|X61609.1|BNLHCB3B B.napus gene for LHC II Type III chlorophy... 40 4.2
305emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p... 40 4.2
306emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 40 4.2
307emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 40 4.2
308emb|AJ308530.2|RSP308530 Rhodomonas sp. CS24 lhcc1 gene (partial... 40 4.2
309gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding prot... 40 4.2
310gb|U68715.1|BFU68715 Botryotinia fuckeliana endopolygalacturonas... 40 4.2
311gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 40 4.2
312emb|AL390254.6|CNS06C7M Human chromosome 14 DNA sequence BAC R-9... 40 4.2
313gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 40 4.2
314emb|AL671706.8| Mouse DNA sequence from clone RP23-330O24 on chr... 40 4.2
315emb|X12860.1|EGLHCI35 Euglena gracilis mRNA fragment for LHCI pr... 40 4.2
316dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 40 4.2

>emb|X63052.1|HVCP29 Hordeum vulgare gene for CP29 precursor for core chlorophyll a/b
            binding (CAB) protein of photosystem II (PSII)
          Length = 2689

 Score =  504 bits (254), Expect = e-139
 Identities = 287/297 (96%), Gaps = 2/297 (0%)
 Strand = Plus / Minus

                                                                        
Query: 24   cttttccccggtaaaaaacacacagcacatcatgctgcatcgcacgcacgcatgcagctg 83
            ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2350 cttttccccggtaaaattcacacagcacatcatgctgcatcgcacgcacgcatgcagctg 2291

                                                                        
Query: 84   agcatcaacagccgacggcggcggncgggcaatcaacggccagctcacaggctgggcacc 143
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 2290 agcatcaacagccgacggcggcggacgggcaatcaacggccagctcacaggctgggcacc 2231

                                                                        
Query: 144  ctctcggcggcgccgggagatgacggtgagcaggttgttgccgaaggggtcgctgnggtg 203
            |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 2230 ctctcggcggcgcc-ggagatgacggtgagcaggttgttgccgaaggggtcgctgaggtg 2172

                                                                        
Query: 204  ggcgcacaggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagccca 263
            |||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 2171 ggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaag-aagccca 2113

                                                                     
Query: 264  gcatggataacatggccagccgnccgttcttgatctccttcaccttgagcagcgccg 320
            ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 2112 gcatggagaacatggccagccgtccgttcttgatctccttcaccttgagcagcgccg 2056



to top

>gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0091I11, complete sequence
          Length = 135993

 Score =  228 bits (115), Expect = 9e-57
 Identities = 173/191 (90%), Gaps = 2/191 (1%)
 Strand = Plus / Minus

                                                                         
Query: 130   acaggctgggcaccctctcggcggcgccgggagatgacggtgagcaggttgttgccgaag 189
             |||||||||||  ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 40261 acaggctgggcgtcctctcggcggcgccgg-agatgacggtgagcaggttgttgccgaag 40203

                                                                         
Query: 190   gggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggtgacgtaggcctgg 249
             ||||||||| ||||   | | ||||| | || ||| ||||||||||||||||||||||||
Sbjct: 40202 gggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgg 40143

                                                                         
Query: 250   atgaagnaagcccagcatggataacatggccagccgnccgttcttgatctccttcacctt 309
             |||||| || ||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 40142 atgaag-aaccccagcatggagaacatggccagccgcccgttcttgatctccttcacctt 40084

                        
Query: 310   gagcagcgccg 320
              ||||||||||
Sbjct: 40083 cagcagcgccg 40073



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  228 bits (115), Expect = 9e-57
 Identities = 173/191 (90%), Gaps = 2/191 (1%)
 Strand = Plus / Minus

                                                                           
Query: 130     acaggctgggcaccctctcggcggcgccgggagatgacggtgagcaggttgttgccgaag 189
               |||||||||||  ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 7581175 acaggctgggcgtcctctcggcggcgccgg-agatgacggtgagcaggttgttgccgaag 7581117

                                                                           
Query: 190     gggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggtgacgtaggcctgg 249
               ||||||||| ||||   | | ||||| | || ||| ||||||||||||||||||||||||
Sbjct: 7581116 gggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgg 7581057

                                                                           
Query: 250     atgaagnaagcccagcatggataacatggccagccgnccgttcttgatctccttcacctt 309
               |||||| || ||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 7581056 atgaag-aaccccagcatggagaacatggccagccgcccgttcttgatctccttcacctt 7580998

                          
Query: 310     gagcagcgccg 320
                ||||||||||
Sbjct: 7580997 cagcagcgccg 7580987



to top

>dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-F05, full
           insert sequence
          Length = 1157

 Score =  228 bits (115), Expect = 9e-57
 Identities = 173/191 (90%), Gaps = 2/191 (1%)
 Strand = Plus / Minus

                                                                       
Query: 130 acaggctgggcaccctctcggcggcgccgggagatgacggtgagcaggttgttgccgaag 189
           |||||||||||  ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 940 acaggctgggcgtcctctcggcggcgccgg-agatgacggtgagcaggttgttgccgaag 882

                                                                       
Query: 190 gggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggtgacgtaggcctgg 249
           ||||||||| ||||   | | ||||| | || ||| ||||||||||||||||||||||||
Sbjct: 881 gggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgg 822

                                                                       
Query: 250 atgaagnaagcccagcatggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| || ||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 821 atgaag-aaccccagcatggagaacatggccagccgcccgttcttgatctccttcacctt 763

                      
Query: 310 gagcagcgccg 320
            ||||||||||
Sbjct: 762 cagcagcgccg 752



to top

>dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001B10, full
           insert sequence
          Length = 1101

 Score =  228 bits (115), Expect = 9e-57
 Identities = 173/191 (90%), Gaps = 2/191 (1%)
 Strand = Plus / Minus

                                                                       
Query: 130 acaggctgggcaccctctcggcggcgccgggagatgacggtgagcaggttgttgccgaag 189
           |||||||||||  ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 930 acaggctgggcgtcctctcggcggcgccgg-agatgacggtgagcaggttgttgccgaag 872

                                                                       
Query: 190 gggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggtgacgtaggcctgg 249
           ||||||||| ||||   | | ||||| | || ||| ||||||||||||||||||||||||
Sbjct: 871 gggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgg 812

                                                                       
Query: 250 atgaagnaagcccagcatggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| || ||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 811 atgaag-aaccccagcatggagaacatggccagccgcccgttcttgatctccttcacctt 753

                      
Query: 310 gagcagcgccg 320
            ||||||||||
Sbjct: 752 cagcagcgccg 742



to top

>dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D05, full
           insert sequence
          Length = 1186

 Score =  228 bits (115), Expect = 9e-57
 Identities = 173/191 (90%), Gaps = 2/191 (1%)
 Strand = Plus / Minus

                                                                       
Query: 130 acaggctgggcaccctctcggcggcgccgggagatgacggtgagcaggttgttgccgaag 189
           |||||||||||  ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 941 acaggctgggcgtcctctcggcggcgccgg-agatgacggtgagcaggttgttgccgaag 883

                                                                       
Query: 190 gggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggtgacgtaggcctgg 249
           ||||||||| ||||   | | ||||| | || ||| ||||||||||||||||||||||||
Sbjct: 882 gggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgg 823

                                                                       
Query: 250 atgaagnaagcccagcatggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| || ||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 822 atgaag-aaccccagcatggagaacatggccagccgcccgttcttgatctccttcacctt 764

                      
Query: 310 gagcagcgccg 320
            ||||||||||
Sbjct: 763 cagcagcgccg 753



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  228 bits (115), Expect = 9e-57
 Identities = 173/191 (90%), Gaps = 2/191 (1%)
 Strand = Plus / Minus

                                                                           
Query: 130     acaggctgggcaccctctcggcggcgccgggagatgacggtgagcaggttgttgccgaag 189
               |||||||||||  ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 7651262 acaggctgggcgtcctctcggcggcgccgg-agatgacggtgagcaggttgttgccgaag 7651204

                                                                           
Query: 190     gggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggtgacgtaggcctgg 249
               ||||||||| ||||   | | ||||| | || ||| ||||||||||||||||||||||||
Sbjct: 7651203 gggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgg 7651144

                                                                           
Query: 250     atgaagnaagcccagcatggataacatggccagccgnccgttcttgatctccttcacctt 309
               |||||| || ||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 7651143 atgaag-aaccccagcatggagaacatggccagccgcccgttcttgatctccttcacctt 7651085

                          
Query: 310     gagcagcgccg 320
                ||||||||||
Sbjct: 7651084 cagcagcgccg 7651074



to top

>dbj|D85512.1| Oryza sativa (japonica cultivar-group) CP26 mRNA, partial sequence
          Length = 556

 Score =  224 bits (113), Expect = 1e-55
 Identities = 174/193 (90%), Gaps = 2/193 (1%)
 Strand = Plus / Minus

                                                                       
Query: 130 acaggctgggcaccctctcggcggcgccgggagatgacggtgagcaggttgttgccgaag 189
           |||||||||||  ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 395 acaggctgggcgtcctctcggcggcgccgg-agatgacggtgagcaggttgttgccgaag 337

                                                                       
Query: 190 gggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggtgacgtaggcctgg 249
           ||||||||| ||||   | | ||||| | || ||| ||||||||||||||||||||||||
Sbjct: 336 gggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgg 277

                                                                       
Query: 250 atgaagnaagcccagcatggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| || ||||||||||| |||||||||||||| ||||||||||||||||||| |||
Sbjct: 276 atgaag-aaccccagcatggagaacatggccagccgcccgttcttgatctccttcaactt 218

                        
Query: 310 gagcagcgccgtc 322
            ||||||||||||
Sbjct: 217 cagcagcgccgtc 205



to top

>gb|AY105650.1| Zea mays PCO135935 mRNA sequence
          Length = 1366

 Score =  186 bits (94), Expect = 3e-44
 Identities = 164/186 (88%), Gaps = 2/186 (1%)
 Strand = Plus / Minus

                                                                        
Query: 127  ctcacaggctgggcaccctctcggcggcgccgggagatgacggtgagcaggttgttgccg 186
            ||||||||||||||  ||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1028 ctcacaggctgggcgtcctctcggcggcgccgg-agatgacggtgagcaggttgttgccg 970

                                                                        
Query: 187  aaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggtgacgtaggcc 246
            |||||||||||| ||||   |   ||||| | || ||| || ||||||||||||||||||
Sbjct: 969  aaggggtcgctgaggtgcttggcgaggttctcgacggggccttcgccggtgacgtaggcc 910

                                                                        
Query: 247  tggatgaagnaagcccagcatggataacatggccagccgnccgttcttgatctccttcac 306
            ||||||||| ||| | | |||||| |||||||| ||||| ||||||||||||||||||||
Sbjct: 909  tggatgaag-aaggcgaacatggagaacatggcgagccggccgttcttgatctccttcac 851

                  
Query: 307  cttgag 312
            ||||||
Sbjct: 850  cttgag 845



to top

>gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-1) mRNA,
           complete cds
          Length = 957

 Score =  186 bits (94), Expect = 3e-44
 Identities = 164/186 (88%), Gaps = 2/186 (1%)
 Strand = Plus / Minus

                                                                       
Query: 127 ctcacaggctgggcaccctctcggcggcgccgggagatgacggtgagcaggttgttgccg 186
           ||||||||||||||  ||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 886 ctcacaggctgggcgtcctctcggcggcgccgg-agatgacggtgagcaggttgttgccg 828

                                                                       
Query: 187 aaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggtgacgtaggcc 246
           |||||||||||| ||||   |   ||||| | || ||| || ||||||||||||||||||
Sbjct: 827 aaggggtcgctgaggtgcttggcgaggttctcgacggggccttcgccggtgacgtaggcc 768

                                                                       
Query: 247 tggatgaagnaagcccagcatggataacatggccagccgnccgttcttgatctccttcac 306
           ||||||||| ||| | | |||||| |||||||| ||||| ||||||||||||||||||||
Sbjct: 767 tggatgaag-aaggcgaacatggagaacatggcgagccggccgttcttgatctccttcac 709

                 
Query: 307 cttgag 312
           ||||||
Sbjct: 708 cttgag 703



to top

>gb|AY855171.1| Eleusine coracana subsp. coracana clone 1 light harvesting protein
           mRNA, partial cds
          Length = 364

 Score =  157 bits (79), Expect = 3e-35
 Identities = 164/191 (85%), Gaps = 2/191 (1%)
 Strand = Plus / Minus

                                                                       
Query: 130 acaggctgggcaccctctcggcggcgccgggagatgacggtgagcaggttgttgccgaag 189
           ||||||||||  ||||||||||||| || | |||||||||||||||||||||||||||||
Sbjct: 193 acaggctgggtgccctctcggcggcaccag-agatgacggtgagcaggttgttgccgaag 135

                                                                       
Query: 190 gggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggtgacgtaggcctgg 249
           ||||||||| ||||   |   ||||| | || ||| ||| |||| |||||||||||||||
Sbjct: 134 gggtcgctgaggtgcttggcgaggttctcgacgggacccccgcctgtgacgtaggcctgg 75

                                                                       
Query: 250 atgaagnaagcccagcatggataacatggccagccgnccgttcttgatctccttcacctt 309
           || ||| ||| | | |||||| |||||||||||||  |||||||||||||||||||||||
Sbjct: 74  ataaag-aaggcgaacatggagaacatggccagcctgccgttcttgatctccttcacctt 16

                      
Query: 310 gagcagcgccg 320
           |||||| ||||
Sbjct: 15  gagcagagccg 5



to top

>gb|U23189.1|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-2) mRNA,
           complete cds
          Length = 1073

 Score =  157 bits (79), Expect = 3e-35
 Identities = 158/183 (86%), Gaps = 2/183 (1%)
 Strand = Plus / Minus

                                                                       
Query: 130 acaggctgggcaccctctcggcggcgccgggagatgacggtgagcaggttgttgccgaag 189
           ||||||| |||  ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 881 acaggctaggcgtcctctcggcggcgccgg-agatgacggtgagcaggttgttgccgaag 823

                                                                       
Query: 190 gggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggtgacgtaggcctgg 249
           ||||||||| ||||   |   ||||| |  | ||| || |||||||||||||||||||||
Sbjct: 822 gggtcgctgaggtgcttggcgaggttctccacggggccttcgccggtgacgtaggcctgg 763

                                                                       
Query: 250 atgaagnaagcccagcatggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||| | | |||||| ||||| || ||||| |||||||||||||||||||||||
Sbjct: 762 atgaag-aaggcgaacatggagaacatcgcgagccggccgttcttgatctccttcacctt 704

              
Query: 310 gag 312
           |||
Sbjct: 703 gag 701



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score = 85.7 bits (43), Expect = 8e-14
 Identities = 86/100 (86%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                        
Query: 210  caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
            |||||| | || ||| |||| ||||||||||  |||||| | |||| ||||| | |||||
Sbjct: 1462 caggttctcgatggggcccttgccggtgacgatggcctgaacgaag-aagccgaacatgg 1404

                                                    
Query: 270  ataacatggccagccgnccgttcttgatctccttcacctt 309
            | |||||||||||||| |||||||||||||||||||||||
Sbjct: 1403 agaacatggccagccgcccgttcttgatctccttcacctt 1364



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 713 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 655

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 654 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 612



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                            
Query: 211      aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
                ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 10793709 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 10793651

                                                           
Query: 271      taacatggccagccgnccgttcttgatctccttcaccttgagc 313
                 |||||||| || || |||||||||||||||||||||||||||
Sbjct: 10793650 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 10793608



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 278     gccagccgnccgttcttgatctccttcacctt 309
               ||||| || |||||||||||||||||||||||
Sbjct: 7133596 gccaggcgaccgttcttgatctccttcacctt 7133565



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                            
Query: 211      aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
                ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 23604256 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 23604198

                                                           
Query: 271      taacatggccagccgnccgttcttgatctccttcaccttgagc 313
                 |||||||| || || |||||||||||||||||||||||||||
Sbjct: 23604197 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 23604155



 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 79/91 (86%), Gaps = 1/91 (1%)
 Strand = Plus / Minus

                                                                            
Query: 223      ggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccag 282
                ||||||| ||||||||||  |||||||| |||| || || | |||||| |||||||| ||
Sbjct: 30025050 ggccccttgccggtgacgatggcctggacgaag-aacccgaacatggagaacatggcgag 30024992

                                               
Query: 283      ccgnccgttcttgatctccttcaccttgagc 313
                 || |||||||||||||||||||||||||||
Sbjct: 30024991 gcggccgttcttgatctccttcaccttgagc 30024961



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                         
Query: 211   aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
             ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 17432 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 17374

                                                        
Query: 271   taacatggccagccgnccgttcttgatctccttcaccttgagc 313
              |||||||| || || |||||||||||||||||||||||||||
Sbjct: 17373 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 17331



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                         
Query: 211   aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
             ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 66955 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 66897

                                                        
Query: 271   taacatggccagccgnccgttcttgatctccttcaccttgagc 313
              |||||||| || || |||||||||||||||||||||||||||
Sbjct: 66896 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 66854



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                          
Query: 211    aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
              ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 130327 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 130269

                                                         
Query: 271    taacatggccagccgnccgttcttgatctccttcaccttgagc 313
               |||||||| || || |||||||||||||||||||||||||||
Sbjct: 130268 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 130226



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 784 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 726

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 725 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 683



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 783 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 725

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 724 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 682



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                        
Query: 211  aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
            ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 1213 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 1155

                                                       
Query: 271  taacatggccagccgnccgttcttgatctccttcaccttgagc 313
             |||||||| || || |||||||||||||||||||||||||||
Sbjct: 1154 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 1112



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 777 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 719

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 718 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 676



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 724

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 723 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 681



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 784 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 726

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 725 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 683



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 724

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 723 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 681



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 724

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 723 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 681



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 79/91 (86%), Gaps = 1/91 (1%)
 Strand = Plus / Minus

                                                                       
Query: 223 ggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccag 282
           ||||||| ||||||||||  |||||||| |||| || || | |||||| |||||||| ||
Sbjct: 713 ggccccttgccggtgacgatggcctggacgaag-aacccgaacatggagaacatggcgag 655

                                          
Query: 283 ccgnccgttcttgatctccttcaccttgagc 313
            || |||||||||||||||||||||||||||
Sbjct: 654 gcggccgttcttgatctccttcaccttgagc 624



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 79/91 (86%), Gaps = 1/91 (1%)
 Strand = Plus / Plus

                                                                         
Query: 223   ggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccag 282
             ||||||| ||||||||||  |||||||| |||| || || | |||||| |||||||| ||
Sbjct: 13961 ggccccttgccggtgacgatggcctggacgaag-aacccgaacatggagaacatggcgag 14019

                                            
Query: 283   ccgnccgttcttgatctccttcaccttgagc 313
              || |||||||||||||||||||||||||||
Sbjct: 14020 gcggccgttcttgatctccttcaccttgagc 14050



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 79/91 (86%), Gaps = 1/91 (1%)
 Strand = Plus / Minus

                                                                         
Query: 223   ggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccag 282
             ||||||| ||||||||||  |||||||| |||| || || | |||||| |||||||| ||
Sbjct: 21040 ggccccttgccggtgacgatggcctggacgaag-aacccgaacatggagaacatggcgag 20982

                                            
Query: 283   ccgnccgttcttgatctccttcaccttgagc 313
              || |||||||||||||||||||||||||||
Sbjct: 20981 gcggccgttcttgatctccttcaccttgagc 20951



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 79/91 (86%), Gaps = 1/91 (1%)
 Strand = Plus / Minus

                                                                       
Query: 223 ggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccag 282
           ||||||| ||||||||||  |||||||| |||| || || | |||||| |||||||| ||
Sbjct: 794 ggccccttgccggtgacgatggcctggacgaag-aacccgaacatggagaacatggcgag 736

                                          
Query: 283 ccgnccgttcttgatctccttcaccttgagc 313
            || |||||||||||||||||||||||||||
Sbjct: 735 gcggccgttcttgatctccttcaccttgagc 705



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 79/91 (86%), Gaps = 1/91 (1%)
 Strand = Plus / Minus

                                                                       
Query: 223 ggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccag 282
           ||||||| ||||||||||  |||||||| |||| || || | |||||| |||||||| ||
Sbjct: 794 ggccccttgccggtgacgatggcctggacgaag-aacccgaacatggagaacatggcgag 736

                                          
Query: 283 ccgnccgttcttgatctccttcaccttgagc 313
            || |||||||||||||||||||||||||||
Sbjct: 735 gcggccgttcttgatctccttcaccttgagc 705



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 79/91 (86%), Gaps = 1/91 (1%)
 Strand = Plus / Minus

                                                                       
Query: 223 ggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccag 282
           ||||||| ||||||||||  |||||||| |||| || || | |||||| |||||||| ||
Sbjct: 796 ggccccttgccggtgacgatggcctggacgaag-aacccgaacatggagaacatggcgag 738

                                          
Query: 283 ccgnccgttcttgatctccttcaccttgagc 313
            || |||||||||||||||||||||||||||
Sbjct: 737 gcggccgttcttgatctccttcaccttgagc 707



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 79/91 (86%), Gaps = 1/91 (1%)
 Strand = Plus / Minus

                                                                       
Query: 223 ggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccag 282
           ||||||| ||||||||||  |||||||| |||| || || | |||||| |||||||| ||
Sbjct: 796 ggccccttgccggtgacgatggcctggacgaag-aacccgaacatggagaacatggcgag 738

                                          
Query: 283 ccgnccgttcttgatctccttcaccttgagc 313
            || |||||||||||||||||||||||||||
Sbjct: 737 gcggccgttcttgatctccttcaccttgagc 707



to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 85/100 (85%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 210 caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
           |||||| | || ||| |||| |||||| |||  |||||||| |||| ||||| | |||||
Sbjct: 719 caggttctggatggggcccttgccggtcacgatggcctggacgaag-aagccgaacatgg 661

                                                   
Query: 270 ataacatggccagccgnccgttcttgatctccttcacctt 309
           | ||||||||||| || |||||||||||||||||||||||
Sbjct: 660 agaacatggccaggcggccgttcttgatctccttcacctt 621



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 85/100 (85%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 210 caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
           |||||| | || ||| |||| |||||| |||  |||||||| |||| ||||| | |||||
Sbjct: 720 caggttctggatggggcccttgccggtcacgatggcctggacgaag-aagccgaacatgg 662

                                                   
Query: 270 ataacatggccagccgnccgttcttgatctccttcacctt 309
           | ||||||||||| || |||||||||||||||||||||||
Sbjct: 661 agaacatggccaggcggccgttcttgatctccttcacctt 622



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 85/100 (85%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 210 caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
           |||||| | || ||| |||| |||||| |||  |||||||| |||| ||||| | |||||
Sbjct: 714 caggttctggacggggcccttgccggtcacgatggcctggacgaag-aagccgaacatgg 656

                                                   
Query: 270 ataacatggccagccgnccgttcttgatctccttcacctt 309
           | ||||||||||| || |||||||||||||||||||||||
Sbjct: 655 agaacatggccaggcggccgttcttgatctccttcacctt 616



to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 85/100 (85%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 210 caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
           |||||| | || ||| |||| |||||| |||  |||||||| |||| ||||| | |||||
Sbjct: 748 caggttctggatggggcccttgccggtcacgatggcctggacgaag-aagccgaacatgg 690

                                                   
Query: 270 ataacatggccagccgnccgttcttgatctccttcacctt 309
           | ||||||||||| || |||||||||||||||||||||||
Sbjct: 689 agaacatggccaggcggccgttcttgatctccttcacctt 650



to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-1.3, complete cds
          Length = 1835

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 85/100 (85%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                        
Query: 210  caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
            |||||| | || ||| |||| |||||| |||  |||||||| |||| ||||| | |||||
Sbjct: 1590 caggttctggatggggcccttgccggtcacgatggcctggacgaag-aagccgaacatgg 1532

                                                    
Query: 270  ataacatggccagccgnccgttcttgatctccttcacctt 309
            | ||||||||||| || |||||||||||||||||||||||
Sbjct: 1531 agaacatggccaggcggccgttcttgatctccttcacctt 1492



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 87/103 (84%), Gaps = 1/103 (0%)
 Strand = Plus / Plus

                                                                         
Query: 211   aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
             ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 79045 aggttctcgatggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 79103

                                                        
Query: 271   taacatggccagccgnccgttcttgatctccttcaccttgagc 313
              |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 79104 gaacatggcgaggcggccgttcttgagctccttcaccttgagc 79146



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 87/103 (84%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                            
Query: 211      aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
                ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 21808771 aggttctcgatggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 21808713

                                                           
Query: 271      taacatggccagccgnccgttcttgatctccttcaccttgagc 313
                 |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 21808712 gaacatggcgaggcggccgttcttgagctccttcaccttgagc 21808670



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 87/103 (84%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                        
Query: 211  aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
            ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 1174 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 1116

                                                       
Query: 271  taacatggccagccgnccgttcttgatctccttcaccttgagc 313
             |||||||| || || ||||||||||||| |||||||||||||
Sbjct: 1115 gaacatggcgaggcggccgttcttgatcttcttcaccttgagc 1073



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 87/103 (84%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||| | |||| ||||| | ||||||
Sbjct: 791 aggttctcgagggggcccttgccggtgacgatggcctgcacgaag-aagccgaacatgga 733

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 732 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 690



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 87/103 (84%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                            
Query: 211      aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
                ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 21801800 aggttctcgatggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 21801742

                                                           
Query: 271      taacatggccagccgnccgttcttgatctccttcaccttgagc 313
                 |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 21801741 gaacatggcgaggcggccgttcttgagctccttcaccttgagc 21801699



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 87/103 (84%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 770 aggttctcgatggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 712

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 711 gaacatggcgaggcggccgttcttgagctccttcaccttgagc 669



to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 87/103 (84%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 345 aggttctcgatggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 287

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 286 gaacatggcgaggcggccgttcttgagctccttcaccttgagc 244



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 87/103 (84%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 759 aggttctcgatggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 701

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 700 gaacatggcgaggcggccgttcttgagctccttcaccttgagc 658



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 265 catggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
           ||||||||||||||| || || |||||||||||||||||||||||||||
Sbjct: 714 catggataacatggcgaggcggccgttcttgatctccttcaccttgagc 666



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 87/103 (84%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| ||||| | ||||||
Sbjct: 763 aggttctcgagggggcccttgccggtgacgatggcctggacgaag-aagccgaacatgga 705

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || || ||||||||||||||||||||||||
Sbjct: 704 gaacatggcgaggcggcctttcttgatctccttcaccttgagc 662



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 796 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 737

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 736 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 678

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 677 tctccttgaccttgagc 661



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 760 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 702

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 701 tctccttgaccttgagc 685



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 760 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 702

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 701 tctccttgaccttgagc 685



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 822 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 763

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 762 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 704

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 703 tctccttgaccttgagc 687



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 765 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 707

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 706 tctccttgaccttgagc 690



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 765 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 707

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 706 tctccttgaccttgagc 690



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 827 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 768

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 767 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 709

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 708 tctccttgaccttgagc 692



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 860 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 801

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 800 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 742

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 741 tctccttgaccttgagc 725



to top

>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb3) mRNA, complete cds
          Length = 1314

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 73/84 (86%), Gaps = 1/84 (1%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccagccg 285
           |||| |||||| |||  |||||||| |||| ||||| | |||||| ||||||||||| ||
Sbjct: 758 cccttgccggtcacgatggcctggacgaag-aagccgaacatggagaacatggccaggcg 700

                                   
Query: 286 nccgttcttgatctccttcacctt 309
            |||||||||||||||||||||||
Sbjct: 699 gccgttcttgatctccttcacctt 676



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                            
Query: 177      gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
                ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 22434833 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 22434774

                                                                            
Query: 237      gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
                ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 22434773 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 22434715

                                 
Query: 297      tctccttcaccttgagc 313
                ||||||| |||||||||
Sbjct: 22434714 tctccttgaccttgagc 22434698



 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 274      catggccagccgnccgttcttgatctcctt 303
                |||||| ||||| |||||||||||||||||
Sbjct: 23305209 catggcgagccgcccgttcttgatctcctt 23305180



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                         
Query: 177   gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
             ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 95900 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 95841

                                                                         
Query: 237   gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
             ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 95840 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 95782

                              
Query: 297   tctccttcaccttgagc 313
             ||||||| |||||||||
Sbjct: 95781 tctccttgaccttgagc 95765



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 765 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 707

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 706 tctccttgaccttgagc 690



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 765 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 707

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 706 tctccttgaccttgagc 690



to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 765 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 707

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 706 tctccttgaccttgagc 690



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 76/88 (86%), Gaps = 1/88 (1%)
 Strand = Plus / Minus

                                                                        
Query: 226  ccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccagccg 285
            |||| ||||||||||  |||||||| |||| ||||| | |||||| |||||||| || ||
Sbjct: 1592 cccttgccggtgacgatggcctggacgaag-aagccgaacatggaaaacatggcgaggcg 1534

                                        
Query: 286  nccgttcttgatctccttcaccttgagc 313
             |||||||||| ||||||||||||||||
Sbjct: 1533 gccgttcttgagctccttcaccttgagc 1506



to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 796 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 737

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 736 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 678

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 677 tctccttgaccttgagc 661



to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 765 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 707

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 706 tctccttgaccttgagc 690



to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 760 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 702

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 701 tctccttgaccttgagc 685



to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 760 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 702

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 701 tctccttgaccttgagc 685



to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 765 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 707

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 706 tctccttgaccttgagc 690



to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 827 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 768

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 767 gacgatggcctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 709

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 708 tctccttgaccttgagc 692



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 112/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| ||||||| ||  |||| || | ||||| | || ||| |||| ||||||
Sbjct: 785 gttgttggcgacggggtcggtgacgtggtcgaagaggttctcgatggggcccttgccggt 726

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  |||||||| |||| || || | |||||| |||||||| || || ||||||||||
Sbjct: 725 gacgatggcctggacgaag-aatccgaacatggagaacatggcgaggcggccgttcttga 667

                            
Query: 297 tctccttcaccttgagc 313
            ||||||||||||||||
Sbjct: 666 gctccttcaccttgagc 650



to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 75/87 (86%), Gaps = 1/87 (1%)
 Strand = Plus / Minus

                                                                       
Query: 223 ggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccag 282
           ||||||| |||||| |||   ||||||| |||| ||||| | ||||||||||||||||||
Sbjct: 387 ggccccttgccggtcacgatcgcctggacgaag-aagccgaacatggataacatggccag 329

                                      
Query: 283 ccgnccgttcttgatctccttcacctt 309
           ||  || ||||||||||||||||||||
Sbjct: 328 cctgccattcttgatctccttcacctt 302



to top

>gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvesting complex II (Lhc
           II) mRNA, partial cds; nuclear gene for chloroplast
           product
          Length = 537

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 272 aacatggccagccgnccgttcttgatctccttcaccttgagc 313
           ||||||||||| || |||||||||||||||||||||||||||
Sbjct: 431 aacatggccagacgaccgttcttgatctccttcaccttgagc 390



to top

>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein
           precursor (cabII-2) mRNA, complete cds
          Length = 1068

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 84/100 (84%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 210 caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
           |||||| | || ||| |||| |||||| |||  |||||||| |||| ||||| | |||||
Sbjct: 702 caggttctggatggggcccttgccggtcacgatggcctggacgaag-aagccgaacatgg 644

                                                   
Query: 270 ataacatggccagccgnccgttcttgatctccttcacctt 309
           | ||||| ||||| || |||||||||||||||||||||||
Sbjct: 643 agaacatagccaggcggccgttcttgatctccttcacctt 604



to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 86/103 (83%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| | ||| | | ||||
Sbjct: 313 aggttctcgagggggcccttgccggtgacgatggcctggacgaagca-gccgaacctgga 255

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 254 gaacatggcgaggcggccgttcttgatctccttcaccttgagc 212



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 80/94 (85%), Gaps = 1/94 (1%)
 Strand = Plus / Minus

                                                                       
Query: 220 aagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggc 279
           ||||| |||| ||||||||||  |||||||| |||| ||||| | |||||| ||||||||
Sbjct: 782 aaggggcccttgccggtgacgatggcctggacgaag-aagccgaacatggagaacatggc 724

                                             
Query: 280 cagccgnccgttcttgatctccttcaccttgagc 313
            || || || |||||||||||||| |||||||||
Sbjct: 723 gaggcggccattcttgatctccttgaccttgagc 690



to top

>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1256

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 84/100 (84%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 210 caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
           |||||| | || ||| |||| |||||| |||  |||||||| |||| ||||| | |||||
Sbjct: 718 caggttctggatggggcccttgccggtcacgatggcctggacgaag-aagccgaacatgg 660

                                                   
Query: 270 ataacatggccagccgnccgttcttgatctccttcacctt 309
           | ||||| ||||| || |||||||||||||||||||||||
Sbjct: 659 agaacatagccaggcggccgttcttgatctccttcacctt 620



to top

>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-3, complete cds
          Length = 1508

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 84/100 (84%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                        
Query: 210  caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
            |||||| | || ||| |||| |||||| |||  |||||||| |||| ||||| | |||||
Sbjct: 1399 caggttctggatggggcccttgccggtcacgatggcctggacgaag-aagccgaacatgg 1341

                                                    
Query: 270  ataacatggccagccgnccgttcttgatctccttcacctt 309
            | ||||| ||||| || |||||||||||||||||||||||
Sbjct: 1340 agaacatagccaggcggccgttcttgatctccttcacctt 1301



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||| || |||||||||||||||||||||||
Sbjct: 668 catggagaacatggccaggcggccgttcttgatctccttcacctt 624



to top

>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 265  catggataacatggccagccgnccgttcttgatctccttcacctt 309
            |||||| |||||||||||||| |||||||| ||||||||||||||
Sbjct: 2943 catggagaacatggccagccgaccgttcttaatctccttcacctt 2899



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 762 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 718



to top

>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
            m1 gene, complete cds; nuclear gene for chloroplast
            product
          Length = 1934

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 265  catggataacatggccagccgnccgttcttgatctccttcacctt 309
            |||||| ||||||||||| || |||||||||||||||||||||||
Sbjct: 1376 catggagaacatggccaggcggccgttcttgatctccttcacctt 1332



to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 648



to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 648



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 648



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 648



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 648



to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 648



to top

>gb|M37489.1|PINCABII2 Pinus sylvestris chlorophyll a/b-binding protein (Cab) mRNA,
           partial cds
          Length = 583

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||||||| |||||||| ||||||||||||||
Sbjct: 329 catggagaacatggccagccgaccgttcttaatctccttcacctt 285



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 738 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 694



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| |||||||| |||||||||||||||||||||||
Sbjct: 583 catggagaacatcgccagccgtccgttcttgatctccttcacctt 539



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                             
Query: 265  catggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||| |||||||| || || |||||||||||||||||||||||||||
Sbjct: 2595 catggagaacatggcgaggcggccgttcttgatctccttcaccttgagc 2547



to top

>dbj|AB050007.2| Chlamydomonas reinhardtii lhcb5 mRNA for CP26, complete cds
          Length = 952

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 76/89 (85%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 221 agggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggcc 280
           |||| ||||||||||| ||||||| ||||| |  | |||||||||| ||| | |||||||
Sbjct: 827 aggggccctcgccggtcacgtaggactggacggcg-aagcccagcacggagaccatggcc 769

                                        
Query: 281 agccgnccgttcttgatctccttcacctt 309
           || || ||||||||||||||||| |||||
Sbjct: 768 aggcggccgttcttgatctccttgacctt 740



 Score = 46.1 bits (23), Expect = 0.069
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 165 gacggtgagcaggttgttgccgaaggggtcg 195
           |||||| |||||||||| |||||||||||||
Sbjct: 883 gacggtcagcaggttgtagccgaaggggtcg 853



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 86/103 (83%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||| | |||| ||||| | ||||||
Sbjct: 755 aggttctcgatggggcccttgccggtgacgatggcctgcacgaag-aagccgaacatgga 697

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 696 gaacatggcaaggcggccgttcttgagctccttcaccttgagc 654



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 265  catggataacatggccagccgnccgttcttgatctccttcacctt 309
            |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 1840 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 1796



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 747 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 703



to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 86/103 (83%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||| | |||| ||||| | ||||||
Sbjct: 403 aggttctcgatggggcccttgccggtgacgatggcctgcacgaag-aagccgaacatgga 345

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 344 gaacatggcaaggcggccgttcttgagctccttcaccttgagc 302



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 86/103 (83%), Gaps = 1/103 (0%)
 Strand = Plus / Minus

                                                                       
Query: 211 aggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgga 270
           ||||| | || ||| |||| ||||||||||  |||||||| |||| || || | ||||||
Sbjct: 505 aggttctcgatgggtcccttgccggtgacgatggcctggacgaag-aacccaaacatgga 447

                                                      
Query: 271 taacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 446 gaacatggcgaggcggccgttcttgagctccttcaccttgagc 404



to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 163 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 119



to top

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||||||| |||||||| ||||||||||||||
Sbjct: 615 catggagaacatggccagccgcccgttctttatctccttcacctt 571



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 265  catggataacatggccagccgnccgttcttgatctccttcacctt 309
            |||||| ||||||||||| || |||||||||||||||||||||||
Sbjct: 1069 catggagaacatggccaggcgtccgttcttgatctccttcacctt 1025



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||| || |||||||||||||||||||||||
Sbjct: 652 catggagaacatggccaggcggccgttcttgatctccttcacctt 608



to top

>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-4, complete cds
          Length = 1781

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 265  catggataacatggccagccgnccgttcttgatctccttcacctt 309
            |||||| ||||||||||| || |||||||||||||||||||||||
Sbjct: 1289 catggagaacatggccaggcggccgttcttgatctccttcacctt 1245



to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 111/137 (81%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gttgttgccgaaggggtcgctgnggtgggcgcacaggttntngaagggcccctcgccggt 236
           ||||||| ||| |||||||  | ||||| ||  |||||| |  ||||| |||| ||||||
Sbjct: 821 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 762

                                                                       
Query: 237 gacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgttcttga 296
           ||||  || ||||| |||| ||||| | |||||| |||||||| || || || |||||||
Sbjct: 761 gacgatggtctggacgaag-aagccgaacatggagaacatggcgaggcggccattcttga 703

                            
Query: 297 tctccttcaccttgagc 313
           ||||||| |||||||||
Sbjct: 702 tctccttgaccttgagc 686



to top

>emb|X06602.1|EGLHCPAB Euglena gracilis mRNA for light harvesting chlorophyll a/b protein
          Length = 681

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 274 catggccagccgnccgttcttgatctccttcacctt 309
           |||||||||||| |||||||||||||||||||||||
Sbjct: 236 catggccagccggccgttcttgatctccttcacctt 201



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 73/86 (84%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccagccg 285
           |||| ||||||||||  |||||||| |||| || |||| |||||| |||||||| || ||
Sbjct: 751 cccttgccggtgacgatggcctggacgaagaaa-cccaacatggagaacatggcgaggcg 693

                                     
Query: 286 nccgttcttgatctccttcaccttga 311
            ||||| |||| ||||||||||||||
Sbjct: 692 gccgttattgaactccttcaccttga 667



to top

>gb|U51634.1|PPU51634 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 252

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacc 307
           |||||| |||||||||||||| |||||||| ||||||||||||
Sbjct: 43  catggagaacatggccagccgaccgttcttaatctccttcacc 1



to top

>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           ||||||||||| || |||||||||||||||||||||||
Sbjct: 660 aacatggccaggcggccgttcttgatctccttcacctt 623



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 265 catggataacatggccagccgnccgttcttgatctccttcac 306
           |||||| |||||||||| ||| ||||||||||||||||||||
Sbjct: 773 catggagaacatggccaaccgtccgttcttgatctccttcac 732



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 272 aacatggccagccgnccgttcttgatctccttcaccttgagc 313
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 670 aacatggcaaggcggccgttcttgatctccttcaccttgagc 629



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 272 aacatggccagccgnccgttcttgatctccttcaccttgagc 313
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 686 aacatggcaaggcggccgttcttgatctccttcaccttgagc 645



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 265 catggataacatggccagccgnccgttcttgatctccttcac 306
           |||||| |||||||||| ||| ||||||||||||||||||||
Sbjct: 766 catggagaacatggccaaccgtccgttcttgatctccttcac 725



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 73/86 (84%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccagccg 285
           |||| ||||||||||  |||||||| |||| || || | |||||| |||||||| || ||
Sbjct: 722 cccttgccggtgacgatggcctggacgaag-aacccgaacatggagaacatggcgaggcg 664

                                     
Query: 286 nccgttcttgatctccttcaccttga 311
            |||||||||| ||||||||||||||
Sbjct: 663 gccgttcttgagctccttcaccttga 638



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 272 aacatggccagccgnccgttcttgatctccttcaccttgagc 313
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 677 aacatggcaaggcgaccgttcttgatctccttcaccttgagc 636



to top

>emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chlorophyll a/b binding protein
            of photosystem II
          Length = 7650

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 257  aagcccagcatggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 4917 aagcccagcatggccaccatggccaggcggccgttcttcagctccttcaccttgagc 4861



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 257  aagcccagcatggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 1474 aagcccagcatggccaccatggccaggcggccgttcttcagctccttcaccttgagc 1418



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 274  catggccagccgnccgttcttgatctccttcacctt 309
            |||||||||||| |||||||||| ||||||||||||
Sbjct: 7000 catggccagccggccgttcttgacctccttcacctt 6965



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 catggccagccgnccgttcttgatctccttcacctt 309
           |||||||||||| |||||||||| ||||||||||||
Sbjct: 216 catggccagccggccgttcttgacctccttcacctt 181



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 259  gcccagcatggataacatggccagccgnccgttcttgatctccttcaccttg 310
            |||||||||||  | ||||||||| || |||||||| | |||||||||||||
Sbjct: 3759 gcccagcatggccagcatggccaggcggccgttcttcacctccttcaccttg 3708



to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||  || |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaagcgcccgttcttgatctccttcacctt 648



to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||  || |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaagcgcccgttcttgatctccttcacctt 648



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||  || |||||||||||||||||||||||
Sbjct: 681 catggaaaacatggccaagcgcccgttcttgatctccttcacctt 637



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||  || |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaagcgcccgttcttgatctccttcacctt 648



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||  || |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaagcgcccgttcttgatctccttcacctt 648



to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||||||| |||||||| | ||||||||||||
Sbjct: 748 catggagaacatggccagccgcccgttctttagctccttcacctt 704



to top

>gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll a/b binding protein
           (CipLhcb3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1047

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 265 catggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
           |||||| |||||||||||||  || ||||||||||||||||| ||||||
Sbjct: 745 catggagaacatggccagccttccattcttgatctccttcactttgagc 697



to top

>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev
          Length = 326

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 265 catggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
           |||||| ||||| || || || |||||||||||||||||||||||||||
Sbjct: 72  catggaaaacattgcaagacgaccgttcttgatctccttcaccttgagc 120



to top

>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b
           binding protein
          Length = 978

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||||||| |||||||| ||||| ||||||||
Sbjct: 724 catggagaacatggccagccgaccgttcttaatctctttcacctt 680



to top

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| |||||||| |||||||| ||||||||||||||
Sbjct: 464 catggagaacatcgccagccgcccgttcttaatctccttcacctt 420



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||| || ||||||||||||||||| |||||
Sbjct: 849 catggagaacatggccaggcgtccgttcttgatctccttgacctt 805



to top

>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 265  catggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||| ||||| || || || |||||||||||||||||||||||||||
Sbjct: 1620 catggagaacatagcgagacgcccgttcttgatctccttcaccttgagc 1572



to top

>gb|L29644.1|EGRLHCPII Euglena gracilis chlorophyll a/b binding protein (LHCPII) gene exons
            1-5, 5' end
          Length = 3122

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 257  aagcccagcatggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 2926 aagcccagcatggccaccatggccagacggccgttcttcacctccttcaccttgagc 2870



to top

>dbj|AB122118.1| Chlamydomonas reinhardtii LhcI-5 gene for light-harvesting
            chlorophyll-a/b protein of photosystem I, complete cds
          Length = 1886

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 274  catggccagccgnccgttcttgatctccttcaccttgagc 313
            ||||||||| || ||||||||||||||||| |||||||||
Sbjct: 1442 catggccaggcggccgttcttgatctccttaaccttgagc 1403



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 67/79 (84%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 231 gccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgt 290
           ||||||||||  |||||||| |||| || || | |||||| ||||||||||| || ||||
Sbjct: 778 gccggtgacgatggcctggacgaagaaa-ccgaacatggagaacatggccaggcggccgt 720

                              
Query: 291 tcttgatctccttcacctt 309
           |||||| |||||| |||||
Sbjct: 719 tcttgagctccttaacctt 701



to top

>gb|AY786530.1| Haematococcus pluvialis chloroplast major light-harvesting complex
           II protein m9 mRNA, partial cds; nuclear gene for
           chloroplast product
          Length = 577

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||||| ||| ||||||||||||||||| |||||
Sbjct: 330 aacatggccaaccgcccgttcttgatctccttgacctt 293



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 69/82 (84%), Gaps = 1/82 (1%)
 Strand = Plus / Minus

                                                                        
Query: 232  ccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgtt 291
            |||||||||  |||||||| |||| || || | |||||| |||||||| || || || ||
Sbjct: 1716 ccggtgacgatggcctggacgaag-aatccgaacatggagaacatggcgaggcggccctt 1658

                                  
Query: 292  cttgatctccttcaccttgagc 313
            ||||| ||||||||||||||||
Sbjct: 1657 cttgagctccttcaccttgagc 1636



to top

>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m6 mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1094

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 82/100 (82%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 210 caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
           |||||| | || ||| |||| |||||| |||  |||||||| |||| ||||| | |||||
Sbjct: 729 caggttctggacggggcccttgccggtcacgatggcctggacgaag-aagccgaacatgg 671

                                                   
Query: 270 ataacatggccagccgnccgttcttgatctccttcacctt 309
           | |||   ||||| || |||||||||||||||||||||||
Sbjct: 670 agaacgatgccaggcggccgttcttgatctccttcacctt 631



to top

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||||| ||| |||||||||| ||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgagctccttcacctt 648



to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 272  aacatggccagccgnccgttcttgatctccttcacctt 309
            ||||||||||  || |||||||||||||||||||||||
Sbjct: 2891 aacatggccaatcgcccgttcttgatctccttcacctt 2854



to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||||| ||| |||||||||| ||||||||||||
Sbjct: 719 aacatggccaaccgcccgttcttgagctccttcacctt 682



to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||||| ||| |||||||||| ||||||||||||
Sbjct: 716 aacatggccaaccgcccgttcttgagctccttcacctt 679



to top

>gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b binding protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 600

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 287 ccgttcttgatctccttcaccttgagc 313
           |||||||||||||||||||||||||||
Sbjct: 452 ccgttcttgatctccttcaccttgagc 426



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 69/82 (84%), Gaps = 1/82 (1%)
 Strand = Plus / Minus

                                                                        
Query: 232  ccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccagccgnccgtt 291
            |||||||||  |||||||| |||| || || | |||||| |||||||| || || || ||
Sbjct: 1716 ccggtgacgatggcctggacgaag-aatccgaacatggagaacatggcgaggcggccctt 1658

                                  
Query: 292  cttgatctccttcaccttgagc 313
            ||||| ||||||||||||||||
Sbjct: 1657 cttgagctccttcaccttgagc 1636



to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 82/100 (82%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 210 caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
           |||||| | || ||| |||| |||||| |||  |||||||| |||| ||||| | |||||
Sbjct: 726 caggttctggacggggcccttgccggtcacgatggcctggacgaag-aagccgaacatgg 668

                                                   
Query: 270 ataacatggccagccgnccgttcttgatctccttcacctt 309
           | ||||||||||     |||||||||||||||||||||||
Sbjct: 667 agaacatggccaaggcgccgttcttgatctccttcacctt 628



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 287 ccgttcttgatctccttcaccttgagc 313
           |||||||||||||||||||||||||||
Sbjct: 668 ccgttcttgatctccttcaccttgagc 642



to top

>gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA, complete cds
          Length = 1041

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           ||||||||||| || ||||||||||||||||| |||||
Sbjct: 674 aacatggccaggcggccgttcttgatctccttgacctt 637



to top

>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1)
            gene, complete cds
          Length = 2290

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 82/100 (82%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                        
Query: 210  caggttntngaagggcccctcgccggtgacgtaggcctggatgaagnaagcccagcatgg 269
            |||||| | || ||| |||| |||||| |||  |||||||| |||| ||||| | |||||
Sbjct: 1750 caggttctggacggggcccttgccggtcacgatggcctggacgaag-aagccgaacatgg 1692

                                                    
Query: 270  ataacatggccagccgnccgttcttgatctccttcacctt 309
            | |||   ||||| || |||||||||||||||||||||||
Sbjct: 1691 agaacgatgccaggcggccgttcttgatctccttcacctt 1652



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 713 aacatggccaatcggccgttcttgatctccttcacctt 676



to top

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 265  catggataacatggccagccgnccgttcttgatctccttcacctt 309
            |||||| ||||| ||||| || ||||||||||||||||| |||||
Sbjct: 1215 catggagaacattgccaggcggccgttcttgatctccttaacctt 1171



to top

>gb|AY267624.1| Bigelowiella natans chlorophyll a/b-binding protein II 2 mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1147

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 257 aagcccagcatggataacatggccagccgnccgttcttgatctccttcacctt 309
           ||||| |||||||| ||||| || || || ||||||||||||||||| |||||
Sbjct: 924 aagccgagcatggagaacatagcaagacggccgttcttgatctccttgacctt 872



to top

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||  || |||||||||| ||||||||||||
Sbjct: 689 catggaaaacatggccaagcgcccgttcttgagctccttcacctt 645



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||  || |||||||||| ||||||||||||
Sbjct: 692 catggaaaacatggccaagcgcccgttcttgagctccttcacctt 648



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||  || |||||||||| ||||||||||||
Sbjct: 692 catggaaaacatggccaagcgcccgttcttgagctccttcacctt 648



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||  || |||||||||| ||||||||||||
Sbjct: 692 catggaaaacatggccaagcgcccgttcttgagctccttcacctt 648



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||  || |||||||||| ||||||||||||
Sbjct: 692 catggaaaacatggccaagcgyccgttcttgagctccttcacctt 648



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||||||||  || |||||||||| ||||||||||||
Sbjct: 692 catggaaaacatggccaagcgcccgttcttgagctccttcacctt 648



to top

>gb|AF398746.1|AF398746 Carlquistia muirii ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1100

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||| ||||  || ||||||||||||||||||||
Sbjct: 960 catggagaacatggctagcctgccattcttgatctccttcacctt 916



to top

>gb|AF398740.1|AF398740 Wilkesia gymnoxiphium ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||| ||||  || ||||||||||||||||||||
Sbjct: 963 catggagaacatggctagcctgccattcttgatctccttcacctt 919



to top

>emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC2-M14-017
          Length = 330

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 265 catggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
           |||||| |||||||| || |  ||||||||||||||||| |||||||||
Sbjct: 251 catggagaacatggcaagtctgccgttcttgatctcctttaccttgagc 203



to top

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| |||||||| |||||||| | ||||||||||||
Sbjct: 581 catggagaacatcgccagccgcccgttctttagctccttcacctt 537



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||| | ||||||||||||
Sbjct: 712 catggagaacatggccaaccgcccgttctttagctccttcacctt 668



to top

>gb|K00973.1|PETCAB3 Petunia major chlorophyll a/b binding protein (Cab) clone pCab3, 3'
           end and flank
          Length = 511

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 265 catggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
           |||||| |||||||| || |  || ||||||||||||||||||||||||
Sbjct: 285 catggaaaacatggcaagtctaccattcttgatctccttcaccttgagc 237



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 265 catggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
           |||||| |||||||| || || || |||||||||||||| |||||||||
Sbjct: 670 catggagaacatggcgaggcggccattcttgatctccttaaccttgagc 622



to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| |||||||||| ||| |||||||| | ||||||||||||
Sbjct: 270 catggagaacatggccaaccgcccgttctttagctccttcacctt 226



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 265 catggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
           |||||| |||||||| || || || |||||||||||||| |||||||||
Sbjct: 875 catggagaacatggcgaggcggccattcttgatctccttaaccttgagc 827



to top

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 265  catggataacatggccagccgnccgttcttgatctccttcaccttgagc 313
            |||||| |||||||| || |  ||||||||||||||||| |||||||||
Sbjct: 1114 catggagaacatggcaagtctgccgttcttgatctcctttaccttgagc 1066



to top

>gb|BT014450.1| Lycopersicon esculentum clone 133776F, mRNA sequence
          Length = 1196

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 162 gatgacggtgagcaggttgttgccgaaggggtc 194
           |||||||||||||| ||||||||| ||||||||
Sbjct: 907 gatgacggtgagcaagttgttgccaaaggggtc 875



to top

>gb|AF104633.2| Chlamydomonas reinhardtii light harvesting complex I protein
           precursor (Lhca1) mRNA, complete cds
          Length = 1129

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 274 catggccagccgnccgttcttgatctccttca 305
           ||||||||| || |||||||||||||||||||
Sbjct: 601 catggccaggcggccgttcttgatctccttca 570



to top

>gb|S68728.1| LHC Ib-21=light-harvesting complex I [Hordeum vulgare=barley,
           Prato, mRNA Chloroplast, 878 nt]
          Length = 878

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 278 gccagccgnccgttcttgatctccttcaccttgagc 313
           |||||||| ||||||||||||||||| | |||||||
Sbjct: 521 gccagccgcccgttcttgatctccttgagcttgagc 486



to top

>gb|AF110786.1|AF110786 Volvox carteri f. nagariensis clone G18 light harvesting complex a
           protein (lhca) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1047

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 274 catggccagccgnccgttcttgatctccttca 305
           ||||||||| || |||||||||||||||||||
Sbjct: 652 catggccagacggccgttcttgatctccttca 621



to top

>gb|AF195794.1|AF195794 Chlamydomonas reinhardtii chlorophyll A-B binding protein of LHCI
           (CAB6A) mRNA, complete cds
          Length = 1136

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 274 catggccagccgnccgttcttgatctccttca 305
           ||||||||| || |||||||||||||||||||
Sbjct: 596 catggccaggcgcccgttcttgatctccttca 565



to top

>dbj|AP004756.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0592C05
          Length = 150478

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 278   gccagccgnccgttcttgatctccttcacctt 309
             ||||| || |||||||||||||||||||||||
Sbjct: 85675 gccaggcgaccgttcttgatctccttcacctt 85644



to top

>dbj|AB122119.1| Chlamydomonas reinhardtii LhcI-6 gene for light-harvesting
            chlorophyll-a/b protein of photosystem I, complete cds
          Length = 1664

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 274  catggccagccgnccgttcttgatctccttca 305
            ||||||||| || |||||||||||||||||||
Sbjct: 1348 catggccaggcggccgttcttgatctccttca 1317



to top

>dbj|AB122114.1| Chlamydomonas reinhardtii LhcI-1 gene for light-harvesting
            chlorophyll-a/b protein of photosystem I, complete cds
          Length = 2649

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 274  catggccagccgnccgttcttgatctccttca 305
            ||||||||| || |||||||||||||||||||
Sbjct: 2318 catggccagacggccgttcttgatctccttca 2287



to top

>emb|X61287.1|LECAB9 L.esculentum Cab9 gene for type I (26 kD) CP29 polypeptide
          Length = 2327

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 162  gatgacggtgagcaggttgttgccgaaggggtc 194
            |||||||||||||| ||||||||| ||||||||
Sbjct: 1939 gatgacggtgagcaagttgttgccaaaggggtc 1907



to top

>emb|X65119.1|CRCABI1MR C.reinhardtii cabI-1 mRNA for light harvesting complex protein I-20
           (LHCPI-20)
          Length = 1073

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 274 catggccagccgnccgttcttgatctccttca 305
           ||||||||| || |||||||||||||||||||
Sbjct: 550 catggccaggcggccgttcttgatctccttca 519



to top

>gb|AF218305.1|AF218305 Hordeum vulgare chlorophyll a/b binding protein precursor (lhca1)
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 784

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 278 gccagccgnccgttcttgatctccttcaccttgagc 313
           |||||||| ||||||||||||||||| | |||||||
Sbjct: 639 gccagccgcccgttcttgatctccttgagcttgagc 604



to top

>dbj|AK066997.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091K09, full
           insert sequence
          Length = 1202

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 278 gccagccgnccgttcttgatctccttcacctt 309
           ||||| || |||||||||||||||||||||||
Sbjct: 847 gccaggcgaccgttcttgatctccttcacctt 816



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 73/88 (82%), Gaps = 1/88 (1%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccctcgccggtgacgtaggcctggatgaagnaagcccagcatggataacatggccagccg 285
           |||| ||||||||||  |||||||| |||| || || | |||||| ||||| || |||| 
Sbjct: 761 cccttgccggtgacgatggcctggacgaag-aatccgaacatggagaacatagctagcct 703

                                       
Query: 286 nccgttcttgatctccttcaccttgagc 313
            || ||||||| ||||||||||||||||
Sbjct: 702 tccattcttgagctccttcaccttgagc 675



to top

>gb|DQ185425.1| Rosa roxburghii clone C40 defense-related mRNA, partial sequence
          Length = 304

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 290 ttcttgatctccttcaccttgagc 313
           ||||||||||||||||||||||||
Sbjct: 220 ttcttgatctccttcaccttgagc 243



to top

>gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding protein II 1 mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1284

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 263 agcatggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| ||||| || || || ||||||||||||||||| |||||
Sbjct: 924 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 878



to top

>gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting complex protein LHCG12
           mRNA, complete cds
          Length = 1170

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 263 agcatggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| ||||| || || || ||||||||||||||||| |||||
Sbjct: 922 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 876



to top

>gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting complex protein LHCG11
           mRNA, complete cds
          Length = 1128

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 263 agcatggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| ||||| || || || ||||||||||||||||| |||||
Sbjct: 879 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 833



to top

>gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting complex protein LHCG4 mRNA,
           complete cds
          Length = 1191

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 263 agcatggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| ||||| || || || ||||||||||||||||| |||||
Sbjct: 919 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 873



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 290 ttcttgatctccttcaccttgagc 313
           ||||||||||||||||||||||||
Sbjct: 883 ttcttgatctccttcaccttgagc 860



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 290 ttcttgatctccttcaccttgagc 313
           ||||||||||||||||||||||||
Sbjct: 880 ttcttgatctccttcaccttgagc 857



to top

>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102,
           3' end and flank
          Length = 302

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 290 ttcttgatctccttcaccttgagc 313
           ||||||||||||||||||||||||
Sbjct: 38  ttcttgatctccttcaccttgagc 15



to top

>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10,
           3' end and flank
          Length = 367

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 290 ttcttgatctccttcaccttgagc 313
           ||||||||||||||||||||||||
Sbjct: 80  ttcttgatctccttcaccttgagc 57



to top

>gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protein (Cab) clone pCab4, 3'
           end
          Length = 387

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 290 ttcttgatctccttcaccttgagc 313
           ||||||||||||||||||||||||
Sbjct: 245 ttcttgatctccttcaccttgagc 222



to top

>ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll binding AT2G05070
           (LHCB2.2) mRNA, complete cds
          Length = 1060

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 725 aacatggcaagacgaccgttcttgagctccttcacctt 688



to top

>ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
            serine/threonine kinase/ protein-tyrosine kinase
            AT2G05060 transcript variant AT2G05060.2 mRNA, complete
            cds
          Length = 2130

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 272  aacatggccagccgnccgttcttgatctccttcacctt 309
            |||||||| || || |||||||||| ||||||||||||
Sbjct: 1415 aacatggcaagacgaccgttcttgagctccttcacctt 1452



to top

>ref|XM_507384.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1065_B06.19-1
           mRNA
          Length = 1062

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 695 catggcgagccgcccgttcttgatctcctt 666



to top

>ref|XM_507383.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1065_B06.19-1
           mRNA
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 696 catggcgagccgcccgttcttgatctcctt 667



to top

>ref|XM_507382.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1065_B06.19-1
           mRNA
          Length = 1058

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 698 catggcgagccgcccgttcttgatctcctt 669



to top

>ref|XM_478841.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1047

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 701 catggcgagccgcccgttcttgatctcctt 672



to top

>ref|XM_507381.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1065_B06.19-1
           mRNA
          Length = 1061

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 701 catggcgagccgcccgttcttgatctcctt 672



to top

>ref|XM_507380.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1065_B06.19-1
           mRNA
          Length = 1065

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 702 catggcgagccgcccgttcttgatctcctt 673



to top

>ref|XM_507379.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1065_B06.19-1
           mRNA
          Length = 1069

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 702 catggcgagccgcccgttcttgatctcctt 673



to top

>ref|XM_506426.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1065_B06.19-1
           mRNA
          Length = 1068

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 705 catggcgagccgcccgttcttgatctcctt 676



to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 287 ccgttcttgatctccttcacctt 309
           |||||||||||||||||||||||
Sbjct: 709 ccgttcttgatctccttcacctt 687



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           ||||| |||||||  || ||||||||||||||||||||
Sbjct: 541 aacatagccagcctgccattcttgatctccttcacctt 504



to top

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 287 ccgttcttgatctccttcaccttgagc 313
           ||||||||||||||||| |||||||||
Sbjct: 694 ccgttcttgatctcctttaccttgagc 668



to top

>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 287 ccgttcttgatctccttcacctt 309
           |||||||||||||||||||||||
Sbjct: 728 ccgttcttgatctccttcacctt 706



to top

>gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070) mRNA, complete cds
          Length = 881

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 665 aacatggcaagacgaccgttcttgagctccttcacctt 628



to top

>gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genomic sequence, complete
             sequence
          Length = 103889

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 272   aacatggccagccgnccgttcttgatctccttcacctt 309
             |||||||| || || |||||||||| ||||||||||||
Sbjct: 81138 aacatggcaagacgaccgttcttgagctccttcacctt 81175



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 287 ccgttcttgatctccttcacctt 309
           |||||||||||||||||||||||
Sbjct: 695 ccgttcttgatctccttcacctt 673



to top

>gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 798

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 665 aacatggcaagacgaccgttcttgagctccttcacctt 628



to top

>gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070; F1O13.20) mRNA, complete cds
          Length = 958

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 725 aacatggcaagacgaccgttcttgagctccttcacctt 688



to top

>gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 929

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 723 aacatggcaagacgaccgttcttgagctccttcacctt 686



to top

>emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 706 aacatggcaagacgaccgttcttgagctccttcacctt 669



to top

>emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 937

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 696 aacatggcaagacgaccgttcttgagctccttcacctt 659



to top

>emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 906

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 714 aacatggcaagacgaccgttcttgagctccttcacctt 677



to top

>emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZB05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 873

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 708 aacatggcaagacgaccgttcttgagctccttcacctt 671



to top

>emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS14ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 713 aacatggcaagacgaccgttcttgagctccttcacctt 676



to top

>emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB85ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 926

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 701 aacatggcaagacgaccgttcttgagctccttcacctt 664



to top

>gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA, complete cds
          Length = 943

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 715 aacatggcaagacgaccgttcttgagctccttcacctt 678



to top

>gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA, complete cds
          Length = 974

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || |||||||||| ||||||||||||
Sbjct: 723 aacatggcaagacgaccgttcttgagctccttcacctt 686



to top

>dbj|AP003804.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1065_B06
          Length = 113170

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 274   catggccagccgnccgttcttgatctcctt 303
             |||||| ||||| |||||||||||||||||
Sbjct: 60467 catggcgagccgcccgttcttgatctcctt 60438



to top

>dbj|AB122116.1| Chlamydomonas reinhardtii LhcI-3 gene for light-harvesting
            chlorophyll-a/b protein of photosystem I, complete cds
          Length = 1830

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 274  catggccagccgnccgttcttgatctcctt 303
            ||||||||| || |||||||||||||||||
Sbjct: 1271 catggccaggcggccgttcttgatctcctt 1242



to top

>dbj|AK119176.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-F08, full
           insert sequence
          Length = 1088

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 716 catggcgagccgcccgttcttgatctcctt 687



to top

>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           |||||||| || || || ||||||||||||||||||||
Sbjct: 704 aacatggcaagacggccattcttgatctccttcacctt 667



to top

>emb|X84308.1|HVLHCA2 H.vulgare mRNA for photosysteme I antenna protein
          Length = 1050

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           ||||||||| || |||||||||||||||||
Sbjct: 725 catggccaggcggccgttcttgatctcctt 696



to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 287 ccgttcttgatctccttcacctt 309
           |||||||||||||||||||||||
Sbjct: 227 ccgttcttgatctccttcacctt 205



to top

>dbj|AK104651.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-B06, full
           insert sequence
          Length = 1069

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 702 catggcgagccgcccgttcttgatctcctt 673



to top

>dbj|AK104608.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-C01, full
           insert sequence
          Length = 1065

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 702 catggcgagccgcccgttcttgatctcctt 673



to top

>dbj|AK104283.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-H09, full
           insert sequence
          Length = 1080

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 732 catggcgagccgcccgttcttgatctcctt 703



to top

>dbj|AK104177.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D02, full
           insert sequence
          Length = 1058

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 698 catggcgagccgcccgttcttgatctcctt 669



to top

>dbj|AK104127.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E10, full
           insert sequence
          Length = 1061

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 701 catggcgagccgcccgttcttgatctcctt 672



to top

>dbj|AK104016.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G05, full
           insert sequence
          Length = 1062

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 695 catggcgagccgcccgttcttgatctcctt 666



to top

>dbj|AK103966.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-H03, full
           insert sequence
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 696 catggcgagccgcccgttcttgatctcctt 667



to top

>dbj|AK070051.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023040A06, full
           insert sequence
          Length = 1646

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 992 catggcgagccgcccgttcttgatctcctt 963



to top

>dbj|AK060987.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C01, full
           insert sequence
          Length = 1068

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 705 catggcgagccgcccgttcttgatctcctt 676



to top

>gb|AY105333.1| Zea mays PCO095488 mRNA sequence
          Length = 794

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           |||||| ||||| |||||||||||||||||
Sbjct: 344 catggcgagccgcccgttcttgatctcctt 315



to top

>gb|U22329.1|VCU22329 Volvox carteri light harvesting complex a mRNA, complete cds
          Length = 1085

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 274 catggccagccgnccgttcttgatctcctt 303
           ||||||||| || |||||||||||||||||
Sbjct: 692 catggccaggcggccgttcttgatctcctt 663



to top

>dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT09I23, TM0590a,
             complete sequence
          Length = 16141

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 265   catggataacatggccagccgnccgttcttgatctccttcac 306
             |||||| |||||||||| ||  || |||||||||||||||||
Sbjct: 11294 catggagaacatggccaaccttccattcttgatctccttcac 11335



to top

>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 287 ccgttcttgatctccttcaccttgagc 313
           ||||||||||||||||| |||||||||
Sbjct: 650 ccgttcttgatctcctttaccttgagc 624



to top

>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 287 ccgttcttgatctccttcaccttgagc 313
           |||||||||||||||||||| ||||||
Sbjct: 203 ccgttcttgatctccttcactttgagc 177



to top

>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end
          Length = 351

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 287 ccgttcttgatctccttcaccttgagc 313
           ||||||||||||||||| |||||||||
Sbjct: 203 ccgttcttgatctcctttaccttgagc 177



to top

>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end
          Length = 351

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 287 ccgttcttgatctccttcaccttgagc 313
           ||||||||||||||||| |||||||||
Sbjct: 203 ccgttcttgatctcctttaccttgagc 177



to top

>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 287 ccgttcttgatctccttcaccttgagc 313
           ||||||||||||||||| |||||||||
Sbjct: 840 ccgttcttgatctcctttaccttgagc 814



to top

>gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mRNA, complete cds
          Length = 1240

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 272 aacatggccagccgnccgttcttgatctccttcacctt 309
           ||||| ||||| || ||||||||||||||||| |||||
Sbjct: 862 aacatagccaggcggccgttcttgatctccttgacctt 825



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 287 ccgttcttgatctccttcaccttgagc 313
           |||||||||||||| ||||||||||||
Sbjct: 844 ccgttcttgatctctttcaccttgagc 818



to top

>dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl+paraquat
           inducible, partial cds, clone:M27
          Length = 687

 Score = 46.1 bits (23), Expect = 0.069
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 287 ccgttcttgatctccttcacctt 309
           |||||||||||||||||||||||
Sbjct: 621 ccgttcttgatctccttcacctt 599



to top

>gb|AY954738.1| Ostreococcus tauri chloroplast chlorophyll a/b-binding protein CP26
            precursor Lhcb5 gene, complete cds; nuclear gene for
            chloroplast product
          Length = 1445

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 287  ccgttcttgatctccttcaccttgag 312
            ||||||||||||||||| ||||||||
Sbjct: 1291 ccgttcttgatctccttaaccttgag 1266



to top

>gb|AF517869.1| Griffithsia japonica isolate Gj446 light-harvest protein mRNA,
           partial cds
          Length = 758

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 273 acatggccagccgnccgttcttgatctcc 301
           |||||||||| || |||||||||||||||
Sbjct: 520 acatggccaggcgtccgttcttgatctcc 492



to top

>gb|AF398747.1|AF398747 Anisocarpus scabridus ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| || ||||  || ||||||||||||||||||||
Sbjct: 963 catggagaacattgctagcctgccattcttgatctccttcacctt 919



to top

>gb|AF398745.1|AF398745 Osmadenia tenella ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| || ||||  || ||||||||||||||||||||
Sbjct: 963 catggagaacattgctagcctgccattcttgatctccttcacctt 919



to top

>gb|AF398744.1|AF398744 Madia nutans ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial cds
          Length = 1103

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| || ||||  || ||||||||||||||||||||
Sbjct: 963 catggagaacattgctagcctgccattcttgatctccttcacctt 919



to top

>gb|AF398743.1|AF398743 Deinandra lobbii ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial
           cds
          Length = 1103

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| || ||||  || ||||||||||||||||||||
Sbjct: 963 catggagaacattgctagcctgccattcttgatctccttcacctt 919



to top

>gb|AF398741.1|AF398741 Wilkesia gymnoxiphium ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6
           and partial cds
          Length = 1083

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| || ||||  || ||||||||||||||||||||
Sbjct: 943 catggagaacattgctagcctgccattcttgatctccttcacctt 899



to top

>gb|AF398739.1|AF398739 Dubautia scabra ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1037

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| || ||||  || ||||||||||||||||||||
Sbjct: 897 catggagaacattgctagcctgccattcttgatctccttcacctt 853



to top

>gb|AF398738.1|AF398738 Dubautia plantaginea ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1102

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| || ||||  || ||||||||||||||||||||
Sbjct: 962 catggagaacattgctagcctgccattcttgatctccttcacctt 918



to top

>gb|AF398737.1|AF398737 Dubautia laxa ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1083

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| || ||||  || ||||||||||||||||||||
Sbjct: 943 catggagaacattgctagcctgccattcttgatctccttcacctt 899



to top

>gb|AF398736.1|AF398736 Dubautia latifolia ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1085

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 265 catggataacatggccagccgnccgttcttgatctccttcacctt 309
           |||||| ||||| || ||||  || ||||||||||||||||||||
Sbjct: 945 catggagaacattgctagcctgccattcttgatctccttcacctt 901


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,043,428
Number of Sequences: 3902068
Number of extensions: 2043428
Number of successful extensions: 40334
Number of sequences better than 10.0: 316
Number of HSP's better than 10.0 without gapping: 318
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39707
Number of HSP's gapped (non-prelim): 595
length of query: 322
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 300
effective length of database: 17,147,199,772
effective search space: 5144159931600
effective search space used: 5144159931600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top