>emb|Y18626.1|TAE18626 Triticum aestivum mRNA for reversibly glycosylated polypeptide
          Length = 1393

 Score = 65.9 bits (33), Expect = 1e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 43   ctacttggctgctgccttgccgttcccagcagc 75
            |||||||||||||||||||||||||||||||||
Sbjct: 1185 ctacttggctgctgccttgccgttcccagcagc 1153

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 46     cttggctgctgccttgccgtt 66
              |||||||||||||||||||||
Sbjct: 708070 cttggctgctgccttgccgtt 708050

>ref|NM_210255.1| Eremothecium gossypii AER041Wp (AER041W), mRNA
          Length = 1311

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 46  cttggctgctgccttgccgtt 66
           |||||||||||||||||||||
Sbjct: 252 cttggctgctgccttgccgtt 232

>ref|XM_956328.1| Neurospora crassa OR74A hypothetical protein ( (AL451017) related
          to septation (sepH) gene [Neurospora crassa OR74A] )
          (NCU01335.1) partial mRNA
          Length = 4518

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 50 gctgctgccttgccgttccc 69
          ||||||||||||||||||||
Sbjct: 71 gctgctgccttgccgttccc 52

>ref|XM_326827.1| Neurospora crassa OR74A hypothetical protein ( (AL451017) related
          to septation (sepH) gene [Neurospora crassa OR74A] )
          (NCU01335.1) partial mRNA
          Length = 4518

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 50 gctgctgccttgccgttccc 69
          ||||||||||||||||||||
Sbjct: 71 gctgctgccttgccgttccc 52

>emb|AL513465.1|NCB13A5 Neurospora crassa DNA linkage group V BAC clone B13A5
          Length = 72305

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 50   gctgctgccttgccgttccc 69
            ||||||||||||||||||||
Sbjct: 5756 gctgctgccttgccgttccc 5775

>emb|AL451017.1|NC12F11 Neurospora crassa DNA linkage group V Cosmid contig 12F11
          Length = 74317

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    gctgctgccttgccgttccc 69
             ||||||||||||||||||||
Sbjct: 50162 gctgctgccttgccgttccc 50181

>gb|AC137741.5| Homo sapiens chromosome 8, clone CTD-2059D3, complete sequence
          Length = 117100

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    agctacttggctgctgcctt 60
             ||||||||||||||||||||
Sbjct: 99106 agctacttggctgctgcctt 99125

>gb|AC069181.9| Homo sapiens chromosome 8, clone RP11-200A24, complete sequence
          Length = 139409

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     agctacttggctgctgcctt 60
              ||||||||||||||||||||
Sbjct: 101975 agctacttggctgctgcctt 101956

>dbj|AP006183.1| Homo sapiens genomic DNA, chromosome 8p12, clone: KB1169H7, complete
             sequence
          Length = 158699

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    agctacttggctgctgcctt 60
             ||||||||||||||||||||
Sbjct: 97255 agctacttggctgctgcctt 97236

>ref|XM_753249.1| Ustilago maydis 521 hypothetical protein (UM02195.1) partial mRNA
          Length = 1671

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 14   aaccatgcactcttgcctt 32
            |||||||||||||||||||
Sbjct: 1625 aaccatgcactcttgcctt 1607

>gb|AC016642.7| Homo sapiens chromosome 5 clone RP11-479O16, complete sequence
          Length = 160907

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 49    ggctgctgccttgccgttc 67
             |||||||||||||||||||
Sbjct: 88735 ggctgctgccttgccgttc 88717

>emb|AJ617794.1| Secale cereale mRNA for ocs-element binding factor 1 (obf1 gene)
          Length = 827

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 43  ctacttggctgctgccttg 61
           |||||||||||||||||||
Sbjct: 668 ctacttggctgctgccttg 686


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 513,873
Number of Sequences: 3902068
Number of extensions: 513873
Number of successful extensions: 30362
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 30349
Number of HSP's gapped (non-prelim): 13
length of query: 77
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 56
effective length of database: 17,151,101,840
effective search space: 960461703040
effective search space used: 960461703040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)