| Clone Name | rbags8f02 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC166486.5| Mus musculus chromosome 1, clone RP23-187M9, complete sequence Length = 187098 Score = 42.1 bits (21), Expect = 0.24 Identities = 21/21 (100%) Strand = Plus / Minus Query: 68 tcatattgctggatcttccag 88 ||||||||||||||||||||| Sbjct: 158555 tcatattgctggatcttccag 158535
>gb|AC125538.4| Mus musculus BAC clone RP24-178B2 from chromosome 15, complete sequence Length = 169576 Score = 42.1 bits (21), Expect = 0.24 Identities = 21/21 (100%) Strand = Plus / Plus Query: 68 tcatattgctggatcttccag 88 ||||||||||||||||||||| Sbjct: 87428 tcatattgctggatcttccag 87448
>gb|AC124766.3| Mus musculus BAC clone RP23-204I12 from 1, complete sequence Length = 196490 Score = 42.1 bits (21), Expect = 0.24 Identities = 21/21 (100%) Strand = Plus / Minus Query: 68 tcatattgctggatcttccag 88 ||||||||||||||||||||| Sbjct: 73513 tcatattgctggatcttccag 73493
>gb|AC154753.2| Mus musculus BAC clone RP24-404K10 from chromosome 17, complete sequence Length = 168898 Score = 42.1 bits (21), Expect = 0.24 Identities = 21/21 (100%) Strand = Plus / Plus Query: 68 tcatattgctggatcttccag 88 ||||||||||||||||||||| Sbjct: 149042 tcatattgctggatcttccag 149062
>emb|AL929555.20| Mouse DNA sequence from clone RP24-427F7 on chromosome 2, complete sequence Length = 155137 Score = 42.1 bits (21), Expect = 0.24 Identities = 21/21 (100%) Strand = Plus / Plus Query: 68 tcatattgctggatcttccag 88 ||||||||||||||||||||| Sbjct: 59179 tcatattgctggatcttccag 59199
>emb|AL672298.4| Mouse DNA sequence from clone RP23-456D8 on chromosome X, complete sequence Length = 204050 Score = 42.1 bits (21), Expect = 0.24 Identities = 21/21 (100%) Strand = Plus / Minus Query: 68 tcatattgctggatcttccag 88 ||||||||||||||||||||| Sbjct: 144357 tcatattgctggatcttccag 144337
>gb|AC127028.18| Mus musculus chromosome 18, clone RP23-345J21, complete sequence Length = 191473 Score = 40.1 bits (20), Expect = 0.96 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 catattgctggatcttccag 88 |||||||||||||||||||| Sbjct: 22101 catattgctggatcttccag 22120
>gb|AC144629.2| Mus musculus BAC clone RP23-448G2 from chromosome 5, complete sequence Length = 173370 Score = 40.1 bits (20), Expect = 0.96 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 catattgctggatcttccag 88 |||||||||||||||||||| Sbjct: 125867 catattgctggatcttccag 125848
>gb|AC124497.3| Mus musculus BAC clone RP23-480E8 from chromosome 5, complete sequence Length = 206926 Score = 40.1 bits (20), Expect = 0.96 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 catattgctggatcttccag 88 |||||||||||||||||||| Sbjct: 20698 catattgctggatcttccag 20717
>gb|AC123054.2| Mus musculus BAC clone RP24-220N11 from 5, complete sequence Length = 174874 Score = 40.1 bits (20), Expect = 0.96 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 catattgctggatcttccag 88 |||||||||||||||||||| Sbjct: 12651 catattgctggatcttccag 12632
>gb|AC121576.2| Mus musculus BAC clone RP23-244D21 from 18, complete sequence Length = 158243 Score = 40.1 bits (20), Expect = 0.96 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 catattgctggatcttccag 88 |||||||||||||||||||| Sbjct: 140315 catattgctggatcttccag 140334
>gb|AC162875.3| Mus musculus chromosome 5, clone RP24-375D24, complete sequence Length = 143518 Score = 40.1 bits (20), Expect = 0.96 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 catattgctggatcttccag 88 |||||||||||||||||||| Sbjct: 122857 catattgctggatcttccag 122876
>emb|AL732498.15| Mouse DNA sequence from clone RP23-323E6 on chromosome 4, complete sequence Length = 145881 Score = 40.1 bits (20), Expect = 0.96 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 catattgctggatcttccag 88 |||||||||||||||||||| Sbjct: 126784 catattgctggatcttccag 126803
>emb|AL844867.3| Mouse DNA sequence from clone RP23-17B8 on chromosome X, complete sequence Length = 175256 Score = 40.1 bits (20), Expect = 0.96 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 catattgctggatcttccag 88 |||||||||||||||||||| Sbjct: 107967 catattgctggatcttccag 107948
>gb|AC160982.5| Mus musculus BAC clone RP23-351J19 from chromosome 12, complete sequence Length = 231693 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 214563 atattgctggatcttccag 214545
>gb|AC155304.4| Mus musculus BAC clone RP24-212I6 from chromosome 8, complete sequence Length = 165128 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 38918 atattgctggatcttccag 38900 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 38441 atattgctggatcttccag 38459
>gb|AC156571.3| Mus musculus BAC clone RP23-264I19 from chromosome 13, complete sequence Length = 196911 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 35149 atattgctggatcttccag 35131
>ref|NG_002760.2| Mus musculus baculoviral IAP repeat-containing 1c, pseudogene 1 (Birc1c-ps1) on chromosome 13 Length = 18692 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 17582 atattgctggatcttccag 17564
>gb|AC111050.9| Mus musculus chromosome 3, clone RP24-66H10, complete sequence Length = 230651 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 199659 atattgctggatcttccag 199641
>gb|AC107702.12| Mus musculus chromosome 3, clone RP23-391G19, complete sequence Length = 219296 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 69 catattgctggatcttcca 87 ||||||||||||||||||| Sbjct: 84317 catattgctggatcttcca 84335
>gb|AC119820.20| Mus musculus chromosome 1, clone RP23-148M18, complete sequence Length = 183287 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 13753 atattgctggatcttccag 13771
>gb|AC134426.20| Mus musculus chromosome 1, clone RP24-342A12, complete sequence Length = 196208 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 42991 tattgctggatcttccagg 42973
>gb|AC158793.4| Mus musculus chromosome 1, clone RP23-269P13, complete sequence Length = 183447 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 88112 atattgctggatcttccag 88130
>gb|AC102259.7| Mus musculus chromosome 3, clone RP24-199C12, complete sequence Length = 182793 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 115211 tattgctggatcttccagg 115193
>gb|AC101672.11| Mus musculus chromosome 5, clone RP23-115F16, complete sequence Length = 204025 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 155104 atattgctggatcttccag 155122
>gb|AC161808.8| Mus musculus chromosome 5, clone RP24-386J15, complete sequence Length = 184815 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 94331 atattgctggatcttccag 94349
>gb|AC104917.9| Mus musculus chromosome 1, clone RP23-329F7, complete sequence Length = 205999 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 181635 atattgctggatcttccag 181617
>gb|AC119197.9| Mus musculus chromosome 8, clone RP24-180H20, complete sequence Length = 150207 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 27307 atattgctggatcttccag 27325
>gb|AC120364.7| Mus musculus chromosome 8, clone RP24-291F20, complete sequence Length = 193257 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 88672 atattgctggatcttccag 88654
>gb|AC132870.10| Mus musculus chromosome 15, clone RP24-206L11, complete sequence Length = 138560 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 94097 atattgctggatcttccag 94079
>gb|AY525157.1| Listonella anguillarum excinuclease ABC subunit B (uvrB) gene, partial cds; and response regulator protein (vanO), phosphorelay protein (vanU), and hypothetical UPF0052 protein genes, complete cds Length = 3274 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 67 ctcatattgctggatcttc 85 ||||||||||||||||||| Sbjct: 744 ctcatattgctggatcttc 762
>gb|AC126041.3| Mus musculus BAC clone RP24-268A23 from chromosome 18, complete sequence Length = 168391 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 17685 atattgctggatcttccag 17703
>gb|AC121267.17| Mus musculus chromosome 19, clone RP24-444E1, complete sequence Length = 160720 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 90461 atattgctggatcttccag 90443
>gb|AC121276.9| Mus musculus chromosome 1, clone RP24-249B16, complete sequence Length = 212083 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 73511 atattgctggatcttccag 73493
>gb|AC102374.7| Mus musculus chromosome 1, clone RP23-278G2, complete sequence Length = 170448 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 128218 atattgctggatcttccag 128236
>gb|AC091278.6| Mus musculus chromosome 1, clone RP23-294D6, complete sequence Length = 244656 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 242829 tattgctggatcttccagg 242847
>gb|AC161355.3| Mus musculus chromosome 1, clone RP24-149A24, complete sequence Length = 179242 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 110316 atattgctggatcttccag 110298
>gb|AC162527.5| Mus musculus BAC clone RP23-30M17 from chromosome 14, complete sequence Length = 200348 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 186412 tattgctggatcttccagg 186394
>gb|AC026232.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-396K2, complete sequence Length = 74340 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 224 tattgctggatcttccagg 206
>gb|AC068663.5| Mus musculus strain C57BL6/J chromosome 5 clone RP23-280D18, complete sequence Length = 221134 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 218383 tattgctggatcttccagg 218365
>gb|AC123866.4| Mus musculus BAC clone RP23-124I3 from chromosome 8, complete sequence Length = 217446 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 97702 atattgctggatcttccag 97684
>gb|AC120856.6| Mus musculus chromosome 1, clone RP23-284B21, complete sequence Length = 261249 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 227282 atattgctggatcttccag 227264
>gb|AC105297.35| Mus musculus strain C57BL/6J clone rp23-14k19 map 17, complete sequence Length = 236275 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 21438 atattgctggatcttccag 21456
>gb|AC123985.10| Mus musculus chromosome 14, clone RP23-154G18, complete sequence Length = 229313 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 105710 tattgctggatcttccagg 105728
>ref|XM_991074.1| PREDICTED: Mus musculus similar to CG33694-PA, isoform A (LOC670954), mRNA Length = 3083 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 68 tcatattgctggatcttcc 86 ||||||||||||||||||| Sbjct: 443 tcatattgctggatcttcc 425
>ref|XM_990951.1| PREDICTED: Mus musculus similar to CG33694-PA, isoform A (LOC666123), mRNA Length = 3083 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 68 tcatattgctggatcttcc 86 ||||||||||||||||||| Sbjct: 443 tcatattgctggatcttcc 425
>ref|XM_001001309.1| PREDICTED: Mus musculus similar to CG33694-PA, isoform A (LOC676945), mRNA Length = 3083 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 68 tcatattgctggatcttcc 86 ||||||||||||||||||| Sbjct: 443 tcatattgctggatcttcc 425
>gb|AC135188.2| Mus musculus BAC clone RP23-206P4 from chromosome 14, complete sequence Length = 182464 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 81056 atattgctggatcttccag 81038
>gb|AC123037.4| Mus musculus BAC clone RP24-527F14 from chromosome 6, complete sequence Length = 137122 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 64686 tattgctggatcttccagg 64668
>gb|AC114423.16| Mus musculus chromosome 6, clone RP23-461C23, complete sequence Length = 205074 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 68 tcatattgctggatcttcc 86 ||||||||||||||||||| Sbjct: 199352 tcatattgctggatcttcc 199334
>emb|CT009518.6| Mouse DNA sequence from clone RP23-118M14 on chromosome 13, complete sequence Length = 221250 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 162783 atattgctggatcttccag 162765
>gb|AC133646.4| Mus musculus BAC clone RP23-254F11 from chromosome 18, complete sequence Length = 209764 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 77900 atattgctggatcttccag 77918
>gb|AC122034.3| Mus musculus BAC clone RP24-403M18 from chromosome 15, complete sequence Length = 182891 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 111995 atattgctggatcttccag 112013
>gb|AC125161.3| Mus musculus BAC clone RP24-410I2 from chromosome 1, complete sequence Length = 142794 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 5928 atattgctggatcttccag 5946
>gb|AC122512.3| Mus musculus BAC clone RP24-446O11 from chromosome 3, complete sequence Length = 170225 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 167276 atattgctggatcttccag 167258
>gb|AC123790.4| Mus musculus BAC clone RP24-287C19 from chromosome 1, complete sequence Length = 175833 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 174150 atattgctggatcttccag 174168
>gb|AC105404.4| Mus musculus BAC clone RP24-112M13 from chromosome 16, complete sequence Length = 127531 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 72159 atattgctggatcttccag 72141
>gb|AC122856.3| Mus musculus BAC clone RP23-121N19 from 3, complete sequence Length = 187311 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 73657 atattgctggatcttccag 73639
>gb|AC122844.4| Mus musculus BAC clone RP23-152A2 from 7, complete sequence Length = 194266 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 36430 atattgctggatcttccag 36448
>gb|AC122298.3| Mus musculus BAC clone RP23-269A11 from 12, complete sequence Length = 151332 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 76393 atattgctggatcttccag 76375
>gb|AC117255.3| Mus musculus BAC clone RP24-481E4 from 3, complete sequence Length = 209706 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 80040 atattgctggatcttccag 80058
>gb|AC159094.4| Mus musculus chromosome 3, clone RP23-277N17, complete sequence Length = 192453 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 30715 tattgctggatcttccagg 30733
>gb|AC157766.4| Mus musculus chromosome 1, clone RP24-318F24, complete sequence Length = 145303 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 123042 tattgctggatcttccagg 123024
>gb|AC157795.4| Mus musculus chromosome 1, clone RP24-122B24, complete sequence Length = 158636 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 69111 atattgctggatcttccag 69093
>gb|AC165264.2| Mus musculus BAC clone RP23-36M22 from chromosome 17, complete sequence Length = 185631 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 52025 atattgctggatcttccag 52007
>gb|AC154715.2| Mus musculus BAC clone RP24-361A22 from chromosome 16, complete sequence Length = 172362 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 64049 atattgctggatcttccag 64031
>gb|AC163293.4| Mus musculus BAC clone RP23-156J21 from chromosome 16, complete sequence Length = 205834 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 22866 atattgctggatcttccag 22884
>gb|AC162880.4| Mus musculus chromosome 1, clone RP24-275N11, complete sequence Length = 164201 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 135211 tattgctggatcttccagg 135193
>emb|AL662783.13| Mouse DNA sequence from clone RP23-378N18 on chromosome 11 Contains the 5' end of a novel gene, a novel gene (4933430M04Rik) and a pseudogene similar to part of DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (Ddx5), complete sequence Length = 181503 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 136236 atattgctggatcttccag 136218
>emb|AL929414.5| Mouse DNA sequence from clone RP23-222A19 on chromosome 11, complete sequence Length = 153928 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 45461 atattgctggatcttccag 45443
>emb|AL669853.5| Mouse DNA sequence from clone RP23-204F22 on chromosome 11 Contains part of the Abca13 gene for ATP-binding cassette sub-family A (ABC1) member 13, complete sequence Length = 205759 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 162639 atattgctggatcttccag 162657
>emb|AL845294.3| Mouse DNA sequence from clone RP23-285N19 on chromosome 4 Contains a ribosomal protein L9 (Rpl9) pseudogene, a cysteine-rich secretory protein 1 (Crisp1) pseudogene and a eukaryotic translation initiation factor 1A (Eif1a) pseudogene, complete sequence Length = 167418 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 151195 atattgctggatcttccag 151177
>emb|AL606783.13| Mouse DNA sequence from clone RP23-374O23 on chromosome 13 Contains part of the gene for a novel protein similar to axonemal dynein heavy polypeptide (DNAH), complete sequence Length = 127451 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 100063 atattgctggatcttccag 100045
>emb|BX294196.6| Mouse DNA sequence from clone RP23-247H18 on chromosome X, complete sequence Length = 57938 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 44138 tattgctggatcttccagg 44120
>gb|AC101688.13| Mus musculus chromosome 5, clone RP23-212P12, complete sequence Length = 200300 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 29245 atattgctggatcttccag 29227
>gb|AC156557.8| Mus musculus chromosome 7, clone RP23-321F8, complete sequence Length = 209053 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 27276 atattgctggatcttccag 27294
>emb|CR556699.5| Mouse DNA sequence from clone RP23-127C3 on chromosome X, complete sequence Length = 109237 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 24726 tattgctggatcttccagg 24744
>dbj|AK142819.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:D930021I20 product:unclassifiable, full insert sequence Length = 3083 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 68 tcatattgctggatcttcc 86 ||||||||||||||||||| Sbjct: 2641 tcatattgctggatcttcc 2659
>gb|AC122735.18| Mus musculus chromosome 3, clone RP23-215I1, complete sequence Length = 182999 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 903 atattgctggatcttccag 885
>gb|AC092752.2| Genomic sequence for Mus musculus, clone RP23-51O3, complete sequence Length = 226416 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 161501 atattgctggatcttccag 161483
>gb|AC174221.4| Mus musculus BAC clone RP24-237K1 from chromosome y, complete sequence Length = 171789 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 91134 tattgctggatcttccagg 91116
>gb|AC161365.2| Mus musculus BAC clone RP24-374C7 from chromosome 12, complete sequence Length = 128769 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 55037 atattgctggatcttccag 55055
>gb|AC153649.4| Mus musculus BAC clone RP24-93B8 from chromosome 1, complete sequence Length = 162838 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 16902 atattgctggatcttccag 16920
>emb|AL731842.14| Mouse DNA sequence from clone RP23-181D11 on chromosome X, complete sequence Length = 194121 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 8272 atattgctggatcttccag 8290
>gb|AC155328.5| Mus musculus 6 BAC RP24-75K10 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 216930 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 68 tcatattgctggatcttcc 86 ||||||||||||||||||| Sbjct: 23083 tcatattgctggatcttcc 23065
>gb|AC157092.6| Mus musculus 10 BAC RP24-397N4 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 141291 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 51338 atattgctggatcttccag 51320
>gb|AC154876.7| Mus musculus chromosome 3, clone RP23-190D19, complete sequence Length = 196840 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 143689 atattgctggatcttccag 143671
>gb|AC007978.15|AC007978 Mus musculus BAC MGS3-335O7 (Genome Systems Mouse BAC Library) complete sequence Length = 183936 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 60979 tattgctggatcttccagg 60961
>gb|AF242434.1|AF242433S2 Mus musculus delta Naip2 pseudogene, exons 15 and 16 Length = 16063 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 15118 atattgctggatcttccag 15136
>gb|AF367969.1|AF367967S3 Mus musculus neuronal apoptosis inhibitory protein 2 (Naip2) gene, exons 1 through 8 and complete cds; neuronal apoptosis inhibitory protein 5 (Naip5) gene, complete cds; delta neuronal apoptosis inhibitory protein (deltaNaip) pseudogene; and neuronal apoptosis inhibitory protein 6 (Naip6) gene, complete cds Length = 147984 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 93478 atattgctggatcttccag 93496
>gb|AC148974.5| Mus musculus BAC clone RP24-165K23 from chromosome y, complete sequence Length = 200783 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 9947 tattgctggatcttccagg 9965
>gb|AC127305.5| Mus musculus BAC clone RP23-289H23 from 3, complete sequence Length = 211760 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 69 catattgctggatcttcca 87 ||||||||||||||||||| Sbjct: 34114 catattgctggatcttcca 34132
>gb|AC104928.8| Mus musculus chromosome 8, clone RP24-111K8, complete sequence Length = 177873 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 99568 atattgctggatcttccag 99550
>gb|AC121113.13| Mus musculus chromosome 1, clone RP23-53N22, complete sequence Length = 210381 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 32390 atattgctggatcttccag 32372
>gb|AC162372.5| Mus musculus chromosome 19, clone RP23-177G18, complete sequence Length = 178801 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 129200 atattgctggatcttccag 129218
>emb|CT030255.8| Mouse DNA sequence from clone RP23-267P22 on chromosome 16, complete sequence Length = 178284 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 97390 atattgctggatcttccag 97408
>emb|CT476831.7| Mouse DNA sequence from clone RP23-414J18 on chromosome 16, complete sequence Length = 193062 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 91074 atattgctggatcttccag 91056
>gb|AC131584.7| Mus musculus chromosome 1, clone RP23-215C21, complete sequence Length = 197346 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 148289 atattgctggatcttccag 148307
>emb|CT030187.6| Mouse DNA sequence from clone RP23-38L5 on chromosome 13, complete sequence Length = 152073 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 31559 atattgctggatcttccag 31541
>gb|AC132373.4| Mus musculus BAC clone RP23-480H8 from 1, complete sequence Length = 192562 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 69476 atattgctggatcttccag 69494
>gb|AC132289.3| Mus musculus BAC clone RP24-317E22 from 1, complete sequence Length = 168350 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 23252 atattgctggatcttccag 23270
>gb|AC154372.1| Mus musculus BAC clone RP23-113F18 from 16, complete sequence Length = 183227 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 75116 atattgctggatcttccag 75098
>emb|AL953890.7| Mouse DNA sequence from clone RP23-321B3 on chromosome 2, complete sequence Length = 157722 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 83576 atattgctggatcttccag 83594
>emb|AL929259.13| Mouse DNA sequence from clone RP23-141E12 on chromosome 2, complete sequence Length = 153645 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 46221 tattgctggatcttccagg 46203
>emb|AL713990.16| Mouse DNA sequence from clone RP23-224N1 on chromosome X, complete sequence Length = 163330 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 62785 atattgctggatcttccag 62767
>gb|AC153422.5| Mus musculus 10 BAC RP23-427I15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 197906 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 27 ctaagctccatagtcaaca 45 ||||||||||||||||||| Sbjct: 164234 ctaagctccatagtcaaca 164216
>gb|AC162175.10| Mus musculus chromosome 7, clone RP23-327E18, complete sequence Length = 224178 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 161571 atattgctggatcttccag 161553
>gb|AC162889.2| Mus musculus chromosome 7, clone RP24-373A4, complete sequence Length = 136728 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 61188 atattgctggatcttccag 61206
>gb|AC164172.10| Mus musculus 10 BAC RP23-392K16 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 184194 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 140904 tattgctggatcttccagg 140922
>gb|AC169983.2| Mus musculus BAC clone RP23-401A24 from chromosome 3, complete sequence Length = 193953 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 44788 atattgctggatcttccag 44770
>emb|AL671853.7| Mouse DNA sequence from clone RP23-275N2 on chromosome X, complete sequence Length = 200224 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 55479 atattgctggatcttccag 55497
>emb|AL773592.5| Mouse DNA sequence from clone RP23-336B11 on chromosome 4, complete sequence Length = 219956 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 93052 atattgctggatcttccag 93070
>emb|AL672193.10| Mouse DNA sequence from clone RP23-443O18 on chromosome X, complete sequence Length = 210236 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 125175 atattgctggatcttccag 125193
>emb|AL691500.7| Mouse DNA sequence from clone RP23-182H15 on chromosome X, complete sequence Length = 196828 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 156586 atattgctggatcttccag 156568
>emb|AL670292.9| Mouse DNA sequence from clone RP23-231H22 on chromosome X, complete sequence Length = 217063 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 70 atattgctggatcttccag 88 ||||||||||||||||||| Sbjct: 117705 atattgctggatcttccag 117687
>emb|AL513347.11| Mouse DNA sequence from clone RP23-476D16 on chromosome X, complete sequence Length = 176287 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 91691 tattgctggatcttccagg 91709
>emb|AL732433.7| Mouse DNA sequence from clone RP23-349N21 on chromosome X, complete sequence Length = 196655 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 186353 tattgctggatcttccagg 186371
>emb|AL671875.12| Mouse DNA sequence from clone RP23-296M12 on chromosome X, complete sequence Length = 192292 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 176681 tattgctggatcttccagg 176663
>emb|AL714007.10| Mouse DNA sequence from clone RP23-295M3 on chromosome X, complete sequence Length = 146552 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 99904 tattgctggatcttccagg 99886
>emb|AL808140.5| Mouse DNA sequence from clone RP23-147K5 on chromosome X, complete sequence Length = 162772 Score = 38.2 bits (19), Expect = 3.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 tattgctggatcttccagg 89 ||||||||||||||||||| Sbjct: 156885 tattgctggatcttccagg 156903 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 494,488 Number of Sequences: 3902068 Number of extensions: 494488 Number of successful extensions: 39924 Number of sequences better than 10.0: 120 Number of HSP's better than 10.0 without gapping: 120 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 39639 Number of HSP's gapped (non-prelim): 285 length of query: 89 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 68 effective length of database: 17,151,101,840 effective search space: 1166274925120 effective search space used: 1166274925120 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)