>gb|AY534122.1|SEG_AY534122S1 Aegilops tauschii transposon XJ, complete sequence; putative Bowman
            Birk trypsin inhibitor gene, complete cds; Stowaway MITE,
            complete sequence; and insertion sequences xl_tt1a and
            xl_tt1b putative ripening related protein genes, complete
            cds
          Length = 26073

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 280  ggcagctcttgcaggtcggagcacactgctcgacctcgtc 319
            ||||| ||||||||||||| || |||||||||||||||||
Sbjct: 8897 ggcaggtcttgcaggtcggggcgcactgctcgacctcgtc 8858

>ref|NM_009900.1| Mus musculus chloride channel 2 (Clcn2), mRNA
          Length = 3148

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 276  ggctggcagctcttgcaggtc 296
            |||||||||||||||||||||
Sbjct: 1112 ggctggcagctcttgcaggtc 1092

>dbj|AK141656.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:D030011H03 product:chloride
            channel 2, full insert sequence
          Length = 3945

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 276  ggctggcagctcttgcaggtc 296
            |||||||||||||||||||||
Sbjct: 2270 ggctggcagctcttgcaggtc 2250

>dbj|AK171231.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630312D12
           product:chloride channel 2, full insert sequence
          Length = 2934

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 276 ggctggcagctcttgcaggtc 296
           |||||||||||||||||||||
Sbjct: 928 ggctggcagctcttgcaggtc 908

>dbj|AK155104.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630201N06
           product:chloride channel 2, full insert sequence
          Length = 2934

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 276 ggctggcagctcttgcaggtc 296
           |||||||||||||||||||||
Sbjct: 928 ggctggcagctcttgcaggtc 908

>dbj|AK165000.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
            library, clone:E130114N01 product:chloride channel 2,
            full insert sequence
          Length = 3513

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 276  ggctggcagctcttgcaggtc 296
            |||||||||||||||||||||
Sbjct: 1162 ggctggcagctcttgcaggtc 1142

>dbj|AK172148.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830048E20 product:chloride channel 2,
            full insert sequence
          Length = 3757

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 276  ggctggcagctcttgcaggtc 296
            |||||||||||||||||||||
Sbjct: 1617 ggctggcagctcttgcaggtc 1597

>gb|AF097415.1|AF097415 Mus musculus chloride channel CLC-2 (Clcn2) mRNA, complete cds
          Length = 3148

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 276  ggctggcagctcttgcaggtc 296
            |||||||||||||||||||||
Sbjct: 1112 ggctggcagctcttgcaggtc 1092

>gb|AF139724.1|AF139724 Mus musculus voltage-regulated and volume-regulated chloride channel
            ClC-2 mRNA, complete cds
          Length = 3107

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 276  ggctggcagctcttgcaggtc 296
            |||||||||||||||||||||
Sbjct: 1063 ggctggcagctcttgcaggtc 1043

>emb|CT010490.10| Mouse DNA sequence from clone RP23-148P12 on chromosome 16, complete
             sequence
          Length = 206348

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 276   ggctggcagctcttgcaggtc 296
             |||||||||||||||||||||
Sbjct: 57146 ggctggcagctcttgcaggtc 57166

>gb|AC121857.2| Mus musculus BAC clone RP24-98A9 from 1, complete sequence
          Length = 171124

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 382    gcctctcttcgtctcccccc 401
              ||||||||||||||||||||
Sbjct: 122749 gcctctcttcgtctcccccc 122768

>emb|BX572594.1| Rhodopseudomonas palustris CGA009 complete genome; segment 2/16
          Length = 348971

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 300   gcacactgctcgacctcgtc 319
             ||||||||||||||||||||
Sbjct: 92006 gcacactgctcgacctcgtc 91987

>gb|AC083837.4| Homo sapiens chromosome 8, clone RP11-79H23, complete sequence
          Length = 166114

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 372   catttccacggcctctcttc 391
             ||||||||||||||||||||
Sbjct: 88381 catttccacggcctctcttc 88362

>gb|AC153649.4| Mus musculus BAC clone RP24-93B8 from chromosome 1, complete sequence
          Length = 162838

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 382    gcctctcttcgtctcccccc 401
              ||||||||||||||||||||
Sbjct: 152173 gcctctcttcgtctcccccc 152192

>gb|AY103562.1| Zea mays PCO085487 mRNA sequence
          Length = 2258

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 365  gtcgcancatttccacggcctct 387
            |||||| ||||||||||||||||
Sbjct: 2199 gtcgcagcatttccacggcctct 2177

>gb|AY104323.1| Zea mays PCO085485 mRNA sequence
          Length = 1303

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 365 gtcgcancatttccacggcctct 387
           |||||| ||||||||||||||||
Sbjct: 579 gtcgcagcatttccacggcctct 557


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,941,030
Number of Sequences: 3902068
Number of extensions: 1941030
Number of successful extensions: 31760
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31741
Number of HSP's gapped (non-prelim): 19
length of query: 453
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 431
effective length of database: 17,147,199,772
effective search space: 7390443101732
effective search space used: 7390443101732
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)